- Email: [email protected]
Kazal-type proteinase inhibitor from disk abalone (Haliotis discus discus): Molecular characterization and transcriptional response upon immune stimulation
Fish & Shellfish Immunology 35 (2013) 1039e1043
Contents lists available at SciVerse ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Short communication
Kazal-type proteinase inhibitor from disk abalone (Haliotis discus discus): Molecular characterization and transcriptional response upon immune stimulation W.D. Niroshana Wickramaarachchi a, Mahanama De Zoysa b, Ilson Whang a, Qiang Wan a, Jehee Lee a, c, * a
Department of Marine Life Sciences, School of Marine Biomedical Sciences, Jeju National University, Jeju Self-Governing Province 690-756, Republic of Korea College of Veterinary Medicine, Chungnam National University, Yuseong-gu, Daejeon 305-764, Republic of Korea c Marine and Environmental Institute, Jeju National University, Jeju Special Self-Governing Province 690-814, Republic of Korea b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 30 May 2013 Received in revised form 3 July 2013 Accepted 5 July 2013 Available online 13 July 2013
Proteinases and proteinase inhibitors are involved in several biological and physiological processes in all multicellular organisms. Proteinase inhibitors play a key role in regulating the activity of the respective proteinases. Among serine proteinase inhibitors, kazal-type proteinase inhibitors (KPIs) are widely found in mammals, avians, and a variety of invertebrates. In this study, we describe the identification of a kazaltype serine proteinase inhibitor (Ab-KPI) from the disk abalone, Haliotis discus discus, which is presumably involved in innate immunity. The full-length cDNA of Ab-KPI includes 600 bp nucleotides with an open reading frame (ORF) encoding a polypeptide of 143 amino acids. The deduced amino acid sequence of Ab-KPI contains a putative 17-amino acid signal peptide and two tandem kazal domains with high similarity to other kazal-type SPIs. Each kazal domain consists of reactive site (P1) residue containing a leucine (L), and a threonine (T) located in the second amino acid position after the second conserved cysteine of each domain. Temporal expression of Ab-KPI was assessed by real time quantitative PCR in hemocytes and mantle tissue following bacterial and viral hemorrhagic septicemia virus (VHSV) challenge, and tissue injury. At 6 h post-bacterial and -VHSV challenge, Ab-KPI expression in hemocytes was increased 14-fold and 4-fold, respectively, compared to control samples. The highest up-regulations upon tissue injury were shown at 9 h and 12 h in hemocytes and mantle, respectively. The transcriptional modulation of Ab-KPI following bacterial and viral challenges and tissue injury indicates that it might be involved in immune defense as well as wound healing process in abalone. Ó 2013 Elsevier Ltd. All rights reserved.
Keywords: Disk abalone Kazal-type proteinase inhibitor Transcriptional modulation Immune challenges Tissue injury
1. Introduction Endogenous proteinases present in the multicellular organisms regulate diverse and critically important physiological and immunological reactions [1]. Enzymatic regulation, which is mediated by different types of proteinase inhibitors (PIs), is important for the maintenance of all metabolic reactions in living cells; for example, PIs are involved in blood coagulation, activation of the
* Corresponding author. Marine Molecular Genetics Lab, Department of Marine Life Sciences, College of Ocean Science, Jeju National University, 66 Jejudaehakno, Ara-Dong, Jeju 690-756, Republic of Korea. Tel.: þ82 64 754 3472; fax: þ82 64 756 3493. E-mail addresses: [email protected], [email protected] (J. Lee). 1050-4648/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2013.07.005
complement system, inflammatory reactions, immune responses, and development [2]. Kazal-type proteinase inhibitors (KPIs) are widely identified in multicellular organisms, and mostly responsible for inhibition of serine proteinase [3]. Among serine PIs, KPIs are well characterized. KPI was originally isolated from bovine pancreas [4] in which the inhibitor controls excessive proteolytic activities in the alimentary organs. Related inhibitor genes were subsequently identified from invertebrates such as the arthropod, Pacifastacus leniusculus, and in blood sucking animals such as the insect, Rhodnius prolixus, in which KPIs assist in preventing blood coagulation, and thus facilitate insect to acquire more blood [5]. However, knowledge of kazal inhibitors in mollusks innate immunity is limited. To date, KPIs have been characterized from zhikong scallops, bay scallops, and eastern oyster. Several studies have shown that KPIs inhibit the activity of bacterial
1040
W.D.N. Wickramaarachchi et al. / Fish & Shellfish Immunology 35 (2013) 1039e1043
compounds like subtilisin, and exhibit bacteriostatic activity against Bacullius subtilis [6,7] and Staphylococcus aurious [8]. Furthermore, a potent role for KPIs in invertebrate immunity has been demonstrated by investigations of their involvement in the response against pathogenic microbial challenge [9]. A typical or canonical kazal domain comprises 40e60 amino acid residues, including six cysteine residues that form a 1e5, 2e4, 3e6 disulphide bond pattern. A number of kazal domains have been shown to evolve at different evolutionary rates [9]. For example, certain amino acid residues that reside between two consecutive cysteines can vary between kazal domains within the same individual, and sometimes lack certain disulphide bridges. Disk abalone is an economically important gastropod in Korean aquaculture. However, abalone farming has recently experienced outbreaks of mass mortality due to bacterial diseases [10]. A few pathogenic Vibrio species have been already identified for abalone diseases during last two decades [11]. Therefore, understanding of genes involved in anti-bacteria defense system of abalone is important for effective disease control. In this study, we characterized one of KPIs in disk abalone, Haliotis discus discus, designated as Ab-KPI. Our methods include cDNA cloning, sequence characterization, tissue-specific expression profiling, and transcription response in hemocytes, and mantle tissue following stimulation with bacteria, viral hemorrhagic septicemia virus (VHSV), and wound healing. Finally, we assessed the phylogenetics of Ab-KPI in the context of KPIs derived from other invertebrate species. 2. Materials and methods 2.1. Isolation of kazal-type proteinase inhibitor cDNA in disk abalone We constructed a normalized cDNA library from disk abalone using RNA isolated from whole tissues (gills, mantle, digestive tract, hepatopancreas, head, and muscle). Briefly, total RNA was isolated from pooled tissues of three healthy abalones using the Tri ReagentÔ (Sigma, USA), according to the manufacturer’s instructions. Polyadenylated messenger RNA (mRNA) was then purified using an mRNA isolation kit (FastTractÒ 2.0; Invitrogen, USA). First strand cDNA synthesis and normalization were carried out using the CreatorÔ SMARTÔ cDNA library construction kit (Clontech, USA), and Trimmer cDNA normalization kit (Evrogen, Russia), respectively. After that, the sequencing of abalone cDNA was performed on a GS-FLX Titanium system (DNA link, Inc.). A cDNA sequence with the highest homology to known KPIs was identified by a BLAST-X search on NCBI [12]. 2.2. Sequence characterization The Ab-KPI full-length sequence was analyzed by DNAssist (v2.2) and BLAST-X. Identities and similarities were compared with other known KPI sequences available in the NCBI and ENSEMBL databases. Characteristic domains or motifs were identified using the PROSITE profile database [13] and SMART proteomic database [14]. Identity, similarity, and gap percentages were calculated using EMBOSS pair-wise alignment algorithms (http:// www.ebi.ac.uk/Tools/psa/emboss_needle/). Signal peptide predictions were accomplished using the SignalP worldwide web server [15]. Disulfide bond prediction was carried out by the prosite database of protein domains, families, and functional sites program [16]. Multiple sequence alignments, and phylogenetic analyses were performed using ClustalW (v2.0) [17], based on known KPI amino acid sequences of other organisms. The phylogenetic tree was constructed with the MEGA software package (v5.0) [18] using the neighbor-joining (NJ) method; bootstrap values were based on 5000 replicates.
2.3. Experimental animals Healthy disk abalones (w50 g) were obtained from the Youngsoo abalone farm (Jeju Island, Republic of Korea). During the experiment, they were maintained in flat-bottomed fiberglass tanks (40 L) with sand-filtered aerated seawater at a temperature of 18 1 C. They were fed daily with fresh seaweed (Undaria pinnatifida). To minimize stress factors, a maximum of 10 individuals were housed per 40 L tank and laboratory environmental settings were uniformly maintained during the experiment. 2.4. Abalone tissues and hemocytes collection Three abalones were dissected, and tissues from gills, mantle, abductor muscle, hepatopancreas, and digestive tract were collected. All tissues were snap-frozen in liquid nitrogen, and stored at 80 C. Hemolymph (1 mL/animal) was collected in a sterilized syringe from the pericardial cavity of three abalones separately, and immediately centrifuged at 3000 g for 10 min at 4 C. The supernatant was removed, and the hemocytes were collected. 2.5. Immune challenge and tissue injury experiments In the bacterial challenge experiments, three bacterial strains were obtained from the Korean Collection for Type Cultures including two Gram-negative strains, Vibrio alginolyticus (KCTC2472), and Vibrio parahemolyticus (KCTC2729); and one Gram-positive strain, Listeria monocytogenes (KCTC3710). Bacteria cultures were prepared according to accepted culture preparation methodologies. Briefly, V. alginolyticus and V. parahemolyticus were cultured on marine agar plates at 25 C overnight. A single colony was inoculated in marine broth at 25 C for 16 h, while shaken at 200 rpm. L. monocytogenes was cultured on LB agar plates at 30 C overnight, and inoculated in LB broth at 30 C for 16 h. Bacterial pellets for all the three cultures (1.5 mL) were obtained by centrifugation (7000 g at 4 C for 5 min) and re-suspended in phosphate-buffered saline (PBS). Abalones were intramuscularly (i.m.) injected with 50 mL (per abalone) of bacterial mixture having a cell count of 5 107 cells/mL in bacterial stock. For the viral challenge experiments, we used a Korean isolate of VHSV, which was isolated from infected olive flounder, Paralichthys olivaceus, and propagated according to methods described previously [19]. Abalones injected with 50 mL of PBS were maintained separately for the use as controls in each time points. Tissue injury experiments were carried out on the mantle and shell as described previously [20]. Abalone mantle tissue and hemolymph were collected from experimental and control groups at 3, 6, 12, 24, and 48 h post injection (n ¼ 3). Hemocytes were collected from hemolymph as described above in section 2.4. 2.6. RNA extraction and cDNA synthesis Total RNA was isolated from the tissues of selected triplicates of disk abalone using TRIzol Reagent (SigmaeAldrich). For hepatopancreas tissue samples, an additional clean-up procedure with the RNeasy mini kit (Qiagen Hilden, Germany) was performed to remove polysaccharides and pigments that would interfere with subsequent enzymatic processes. The total RNA concentration was determined by spectrophotometric measurement of absorbance at 260 nm (Bio-Rad, Hercules, CA, USA). First strand cDNA was synthesized by using PrimeScriptÔ first strand cDNA synthesis kit (TaKaRa, Japan). In brief, RNA was incubated with 1 mL of 50 mM oligo(dT)20, and 1 mL of 10 mM dNTP for 5 min at 65 C and immediately cooled on ice. Then, 4 mL of 5 PrimeScriptTM buffer, 0.5 mL of RNase inhibitor (20 U), and 1 mL of PrimeScriptTM RTase (200 U) were added, and the mixture was incubated for 1 h at 42 C.
W.D.N. Wickramaarachchi et al. / Fish & Shellfish Immunology 35 (2013) 1039e1043
The reaction was terminated by raising the temperature to 70 C for 15 min. The synthesized cDNA was diluted 40-fold and stored at 20 C. 2.7. Ab-KPI mRNA expression by quantitative real time PCR (qPCR) Synthesized cDNA was used as template for qPCR. Two pairs of gene-specific primers (Forward: AAGGCCCACTGTCAGGATCTTACT and Reverse: TGGCCATCTGGGAACAGAAGAACT) were used (designed by Primer 3.0) to amplify Ab-KPI. Ribosomal protein L5 gene-specific primers (Forward: TCACCAACAAGGACATCATTTGTC and Reverse: CAGGAGGAGTCCAGTGCAGTATG) were used to amplify the reference gene. qPCR was carried out in a 15 mL reaction volume containing 4 mL of cDNA (1:40 dilution), 7.5 mL of 2 SYBR Green master mix, 0.6 mL of each primer (10 pmol/mL), and 2.3 mL of PCR-grade water using the Thermal Cycler DiceTM Real Time System (TaKaRa). The thermal profile was one cycle of 95 C for 3 min, followed by 45 cycles of 95 C for 20 s, 58 C for 20 s, and 72 C for 30 s. To verify that each primer pair produced only a single product, a dissociation curve was generated for the product by heating from 60 C to 95 C at the end of the reaction. For each cDNA sample, reactions were performed in triplicate. A reaction carried out without cDNA sample was used as the negative control. Finally, the Ct values obtained from qPCR were converted into relative expression levels using the 2DDCt method [21]. For the expression profiles, the ribosomal protein L5 normalized mRNA levels were compared with the levels detected in the respective PBS-injected controls were used to calculate the relative fold-difference for each time point. All data have been expressed as mean SD values, and significant differences of each group with respect to the control (0 h) were analyzed using the Student’s t-test with the SPSS statistical software package (v16.0; SPSS Inc., USA). Values of P < 0.05 were considered statistically significant. 3. Results and discussion Based on BLAST-X analysis of EST data from the normalized cDNA library, we have identified the full-length cDNA sequence of the kazal-type proteinase inhibitor from disk abalone (H. discus discus), designated as Ab-KPI. The sequence was deposited in NCBI under the accession number ADQ43244. The complete cDNA sequence is 600 bp in length, composed of a 26 bp 50 -UTR, 432 bp open reading frame (ORF) encoding 143 amino acids, and a 142 bp 30 -UTR including a polyadenylation (470AATAAA 475) signal and poly A tail (Fig. 1). The predicted molecular mass of Ab-KPI was 16 kDa,
1041
and its theoretical isoelectric point was 7.6. The start codon and stop codon were found at nucleotide positions 1-3 (ATG) and 430432 (TAG) from the 50 end of the cDNA sequence, respectively. Based on the prediction from the SignalP server, Ab-KPI ORF consists of a 17-amino acid signal peptide [15]. Motif analysis revealed that Ab-KPI contains two typical kazal domains (Ab-KPI-D1and AbKPI-D2) and each contains 57, and 55 amino acids, respectively. The number of amino acids in a typical or canonical kazal domain is comprised of 40e60 amino acids, including spacer amino acids; however, most of the amino acid residues in the common kazal motif could be varied among the invertebrate species [9]. Each domain of Ab-KPI contains a unique characteristic of six conserved cysteine residues responsible for forming three disulfide bridges (C1eC5, C2eC4, C3eC6), which has been identified previously in other classical KPI family members [16]. In each domain, the active site is considered to be the second amino acid from the second conserved cysteine. The presence of kazal domains and the existence of conserved motifs, together with the three intra-domain disulfide bonds strongly suggest that Ab-KPI is a member of the KPI family. Previous studies have shown that KPIs in different organism might comprise of single or multiple kazal domains due to different evolutionary rates [22,23]. The number of kazal domains varies drastically amongst mollusk species. In contrast to the twodomain structure in H. discus discus, 12 and 6 kazal domains have been identified in KPIs of the zhikong scallop (Chlamys farreri) [24] and bay scallop (Argopecten irradians) [25]. Although variable numbers of kazal domains are present in KPIs, not all of them may be required to carry out particular biological functions [9]. The inhibitory specificity of kazal domains also varies, depending on the reactive P1 amino acid (Supplementary data, Fig. 1) [7,26]. This amino acid specifically interacts with the active site of the cognate enzyme [27,28]. Ab-KPI has two kazal domains that consist of two P1 reactive sites, namely L and T. The L active site residue may give inhibitory activity to subtilisin and elastase, whereas the T active site residue may act against subtilisin, trypsin, and proteinase K [29,30]. However, many studies have shown that multi-domain KPIs contain one or more inactive domains [31]. In the pairwise sequence alignment, Ab-KPI showed the highest similarity with serine proteinase inhibitors of crustaceans. Ab-KPI exhibited 31.3% and 29.6% sequence identity to PIs characterized from signal crayfish (Pacifastacus leniusculus : ACB78013) and fresh water crayfish (Procambarus clarkii :ADI96222), respectively. It also shared 18.3% identity with a PI sequence from the eastern oyster (Crassostrea virginica : DQ092546) (Supplementary data, Table 1).
Fig. 1. Nucleotide sequence (above) and deduced amino acid sequence (below) of Ab-KPI (ADQ43244). The letters in bold denote start codon (ATG), stop cordon (TAG), and polyadenylation signal. A signal peptide is underlined in bold and two kazal domains are shaded in gray. Characteristic conserved cysteine residues responsible for the formation of disulfide bridges are boxed and P1 active sites are circled. The nucleotide and amino acid positions are numbered along the right margins of each corresponding line.
1042
W.D.N. Wickramaarachchi et al. / Fish & Shellfish Immunology 35 (2013) 1039e1043
Furthermore, a multiple alignment of Ab-KPI with KPIs from other related species revealed that the kazal domain is highly conserved across invertebrate species (Supplementary data, Fig. 1). Phylogenetic analysis revealed that all mollusk KPIs belong to one cluster, distinguishing them from other known invertebrate KPIs (Supplementary data, Fig. 2). According to the results of tissue specific mRNA expression, we found that Ab-KPI was constitutively expressed in all the tissues examined, although the level of expression varied between tissues. The highest expression level was observed in the hepatopancreas, whereas the lowest expression was observed in the digestive tract (P < 0.05) (Supplementary data, Fig. 3.). KPI was previously reported to be primarily expressed in various tissues of invertebrates, including hemocytes, hepatopancreas, gills, stomach, and reproductive organs [3,24,31,32]. In crustaceans, ample amounts of KPI expression were observed in hemocytes of Chinese white shrimp Fenneropenaeus chinensis [33] and crayfish P. leniusculus [5] whereas in both eyestalk and hemocytes of swimming crab Portunus trituberculatus [32] Additionally, hepatopancreas in F. chinensis was also exhibited as a prominent KPI expressing tissue, similar as the observation of Ab-KPI in our study [9]. Abalones are susceptible to different types of bacteria. Several Vibrio species, such as V. alginolyticus, different strains of Vibrio paraheamolyticus and Vibrio carchariae have been isolated in small abalone [10]. Furthermore, isolation experiments have proven that the principle agents behind mass mortality in the abalone farms in China and Taiwan were majorly Vibrio species as well as some viruses [10,34]. Hence, we used both bacteria mixture and VHSV in the immune challenge experiments, which have been proven to successfully evoke abalone immune response in our earlier studies. In time course experiment of disk abalone, transcriptional response of Ab-KPI was investigated in hemocytes and mantle tissues upon bacterial, viral, and tissue injury challenges. After bacterial and VHSV challenge, hemocytes showed a nearly 14-fold and 4-fold increase in relative expression at 6 h p.i. compared to controls (Fig. 2A). Many studies have shown that the expression of KPIs can be enhanced by the pathogenic infection, and their functions are important for hostresponses against microbial challenge [9,33]. It is well-known that pathogens produce virulence factors during infection, such as proteinases, which aid penetration into the host cell. PIs can act on these pathogenic proteinases and prevent entry of invading pathogen. Therefore, PIs are suggested to have antimicrobial activity against invading bacteria [8]. Furthermore, in many mollusk species, KPIs are up-regulated during bacterial and viral challenges. For example, in bay scallops, A. irradians, a six-domain KPI was up-regulated after Vibrio anguillarum injection. Similarly, a twelve-domain KPI in the zhikong scallop, C. farreri was also up-regulated during V. anguillarum bacterial challenge [24,25]. In our study, we also observed increased Ab-KPI mRNA expression at 6 h p.i following both bacterial and VHSV challenge, further confirming an important role for KPIs in innate immunity. In the context of tissue injury, Ab-KPI was up-regulated in both hemocytes and the mantle. In hemocytes, up-regulation began at 6 h p.i, and was highest at 9 h after the injury. In the mantle, Ab-KPI up-regulation was first observed at 3 h, and continued to increase up to 12 h after injury (Fig. 2B). A similar pattern of up-regulation has also been observed in bay scallops (A. irradians) at 8 h after tissue injury [25]. These results confirmed that Ab-KPI is activated during inflammatory responses associated with tissue injury and bacterial and viral challenge. However, additional study will be required for the biochemical and regulatory mechanisms of Ab-KPI in the abalone defense system. In summary, we identified the kazal-type proteinase inhibitor, Ab-KPI, from disk abalone. Transcriptional modulation of Ab-KPI observed following tissue injury and immune challenge indicates its involvement in wound healing and the innate immune response
Fig. 2. (A) Relative mRNA expression in abalone hemocytes in response to challenge by mixture of three bacteria (Vibrio alginolyticus, Vibrio parahemolyticus and Listeria monocytogenes) and VHSV. The amount of Ab-KPI mRNA relative to both internal control ribosomal protein and PBS-injected controls is expressed as mean SD (n ¼ 3). Significant up-regulations (P < 0.05 vs. un-injected control at 0 h) are marked with asterisks. (B) Relative mRNA expression in hemocytes and mantle of abalone in response to tissue injury, as detected by qPCR. The amount of Ab-KPI mRNA relative to both internal control ribosomal protein and uninjured controls is expressed as mean SD (n ¼ 3). Significant up-regulations (P < 0.05 vs. uninjured control) are marked with asterisks.
of disk abalone. Our study will possibly aid future investigations of proteinase inhibitors in mollusks and other invertebrates. However, regulatory and defense mechanisms of Ab-KPI in the disk abalone require further study. Acknowledgments This research was supported by the MSIP (Ministry of Science, ICT & Future Planning), Korea, under the ITRC (Information Technology Research Center) support program supervised by the NIPA National IT Industry Promotion Agency (NIPA-2013-H030113-2009). Appendix A. Supplementary data Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.fsi.2013.07.005. References [1] Nikapitiya C, De Zoysa M, Oh C, Lee Y, Ekanayake PM, Whang I, et al. Disk abalone (Haliotis discus discus) expresses a novel antistasin-like serine protease inhibitor: molecular cloning and immune response against bacterial infection. Fish & Shellfish Immunology 2010;28:661e71. [2] Takada A, Takada Y, Urano T. The physiological aspects of fibrinolysis. Thrombosis Research 1994;76:1e31.
W.D.N. Wickramaarachchi et al. / Fish & Shellfish Immunology 35 (2013) 1039e1043 [3] Li XC, Zhang RR, Sun RR, Lan JF, Zhao XF, Wang JX. Three kazal-type serine proteinase inhibitors from the red swamp crayfish Procambarus clarkii and the characterization, function analysis of hcPcSPI2. Fish & Shellfish Immunology 2010;28:942e51. [4] Kazal LA, Spicer DS, Brahinsky RA. Isolation of a crystalline trypsin inhibitoranticoagulant protein from pancreas. Journal of the American Chemical Society 1948;70:3034e40. [5] Cerenius L, Liu H, Zhang Y, Rimphanitchayakit V, Tassanakajon A, Gunnar Andersson M, et al. High sequence variability among hemocyte-specific kazaltype proteinase inhibitors in decapod crustaceans. Developmental and Comparative Immunology 2010;34:69e75. [6] Somprasong N, Rimphanitchayakit V, Tassanakajon A. A five-domain kazaltype serine proteinase inhibitor from black tiger shrimp Penaeus monodon and its inhibitory activities. Developmental and Comparative Immunology 2006;30:998e1008. [7] Donpudsa S, Tassanakajon A, Rimphanitchayakit V. Domain inhibitory and bacteriostatic activities of the five-domain kazal-type serine proteinase inhibitor from black tiger shrimp Penaeus monodon. Developmental and Comparative Immunology 2009:481e8. 2008/10/22 ed. [8] Augustin R, Siebert S, Bosch TC. Identification of a kazal-type serine protease inhibitor with potent anti-staphylococcal activity as part of Hydra’s innate immune system. Developmental and Comparative Immunology 2009;33: 830e7. [9] Rimphanitchayakit V, Tassanakajon A. Structure and function of invertebrate kazal-type serine proteinase inhibitors. Developmental and Comparative Immunology 2010;34:377e86. [10] Liu PC, Chen YC, Huang CY, Lee KK. Virulence of Vibrio parahaemolyticus isolated from cultured small abalone, Haliotis diversicolor supertexta, with withering syndrome. Letters in Applied Microbiology 2000;31:433e7. [11] Gardner GR, Harshbarger JC, Lake JL, Sawyer TK, Price KL, Stephenson MD, et al. Association of prokaryotes with symptomatic appearance of withering syndrome in black abalone Haliotis cracherodii. Journal of Invertebrate Pathology 1995;66:111e20. [12] Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. Journal of Molecular Biology 1990;215:403e10. [13] Bairoch A, Bucher P, Hofmann K. The PROSITE database, its status in 1997. Nucleic Acids Research 1997;25:217e21. [14] Letunic I, Doerks T, Bork P. SMART 6: recent updates and new developments. Nucleic Acids Research 2009;37:D229e32. [15] Bendtsen JD, Nielsen H, von Heijne G, Brunak S. Improved prediction of signal peptides: SignalP 3.0. Journal of Molecular Biology 2004;340:783e95. [16] De Castro E, Sigrist CJ, Gattiker A, Bulliard V, Langendijk-Genevaux PS, Gasteiger E, et al. ScanProsite: detection of PROSITE signature matches and ProRule-associated functional and structural residues in proteins. Nucleic Acids Research 2006;34:W362e5. [17] Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 1994;22:4673e80. [18] Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 2011;28:2731e9.
1043
[19] De Zoysa M, Jung S, Lee J. First molluscan TNF-alpha homologue of the TNF superfamily in disk abalone: molecular characterization and expression analysis. Fish & Shellfish Immunology 2009;26:625e31. [20] De Zoysa M, Nikapitiya C, Lee Y, Lee S, Oh C, Whang I, et al. First molluscan transcription factor activator protein-1 (Ap-1) member from disk abalone and its expression profiling against immune challenge and tissue injury. Fish & Shellfish Immunology 2010;29:1028e36. [21] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001;25: 402e8. [22] Jimenez-Vega F, Vargas-Albores F. A four-kazal domain protein in Litopenaeus vannamei hemocytes. Developmental and Comparative Immunology 2005;29: 385e91. [23] Xue QG, Waldrop GL, Schey KL, Itoh N, Ogawa M, Cooper RK, et al. A novel slow-tight binding serine protease inhibitor from eastern oyster (Crassostrea virginica) plasma inhibits perkinsin, the major extracellular protease of the oyster protozoan parasite Perkinsus marinus. Comparative Biochemistry and Physiology Part B, Biochemistry & Molecular Biology 2006;145:16e26. [24] Wang B, Zhao J, Song L, Zhang H, Wang L, Li C, et al. Molecular cloning and expression of a novel kazal-type serine proteinase inhibitor gene from Zhikong scallop Chlamys farreri, and the inhibitory activity of its recombinant domain. Fish & Shellfish Immunology 2008;24:629e37. [25] Zhu L, Song L, Chang Y, Xu W, Wu L. Molecular cloning, characterization and expression of a novel serine proteinase inhibitor gene in bay scallops (Argopecten irradians, Lamarck 1819). Fish & Shellfish Immunology 2006;20: 320e31. [26] Wang ZH, Zhao XF, Wang JX. Characterization, kinetics, and possible function of kazal-type proteinase inhibitors of Chinese white shrimp, Fenneropenaeus chinensis. Fish & Shellfish Immunology 2009;26:885e97. [27] Ozawa K, Laskowski Jr M. The reactive site of trypsin inhibitors. The Journal of Biological Chemistry 1966;241:3955e61. [28] Laskowski Jr M, Kato I. Protein inhibitors of proteinases. Annual Review of Biochemistry 1980;49:593e626. [29] Nirmala X, Mita K, Vanisree V, Zurovec M, Sehnal F. Identification of four small molecular mass proteins in the silk of Bombyx mori. Insect Molecular Biology 2001;10:437e45. [30] Visetnan S, Donpudsa S, Supungul P, Tassanakajon A, Rimphanitchayakit V. Kazal-type serine proteinase inhibitors from the black tiger shrimp Penaeus monodon and the inhibitory activities of SPIPm4 and 5. Fish & Shellfish Immunology 2009;27:266e74. [31] Qian YQ, Li Y, Yang F, Yu YQ, Yang JS, Yang WJ. Two kazal-type protease inhibitors from Macrobrachium nipponense and Eriocheir sinensis: comparative analysis of structure and activities. Fish & Shellfish Immunology 2012;32: 446e58. [32] Wang S, Cui Z, Liu Y, Li Q, Song C. The first kazal-type serine proteinase inhibitor in the swimming crab Portunus trituberculatus involved in immune response to bacteria and fungi. Aquaculture 2012;356e357:55e60. [33] Kong HJ, Cho HK, Park E-M, Hong G-E, Kim Y-O, Nam B-H, et al. Molecular cloning of kazal-type proteinase inhibitor of the shrimp Fenneropenaeus chinensis. Fish & Shellfish Immunology 2009;26:109e14. [34] Cai J, Han H, Song Z, Li C, Zhou J. Isolation and characterization of pathogenic Vibrio alginolyticus from diseased postlarval abalone, Haliotis diversicolor supertexta (Lischke). Aquaculture Research 2006;37:1222e6.
Contents lists available at SciVerse ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Short communication
Kazal-type proteinase inhibitor from disk abalone (Haliotis discus discus): Molecular characterization and transcriptional response upon immune stimulation W.D. Niroshana Wickramaarachchi a, Mahanama De Zoysa b, Ilson Whang a, Qiang Wan a, Jehee Lee a, c, * a
Department of Marine Life Sciences, School of Marine Biomedical Sciences, Jeju National University, Jeju Self-Governing Province 690-756, Republic of Korea College of Veterinary Medicine, Chungnam National University, Yuseong-gu, Daejeon 305-764, Republic of Korea c Marine and Environmental Institute, Jeju National University, Jeju Special Self-Governing Province 690-814, Republic of Korea b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 30 May 2013 Received in revised form 3 July 2013 Accepted 5 July 2013 Available online 13 July 2013
Proteinases and proteinase inhibitors are involved in several biological and physiological processes in all multicellular organisms. Proteinase inhibitors play a key role in regulating the activity of the respective proteinases. Among serine proteinase inhibitors, kazal-type proteinase inhibitors (KPIs) are widely found in mammals, avians, and a variety of invertebrates. In this study, we describe the identification of a kazaltype serine proteinase inhibitor (Ab-KPI) from the disk abalone, Haliotis discus discus, which is presumably involved in innate immunity. The full-length cDNA of Ab-KPI includes 600 bp nucleotides with an open reading frame (ORF) encoding a polypeptide of 143 amino acids. The deduced amino acid sequence of Ab-KPI contains a putative 17-amino acid signal peptide and two tandem kazal domains with high similarity to other kazal-type SPIs. Each kazal domain consists of reactive site (P1) residue containing a leucine (L), and a threonine (T) located in the second amino acid position after the second conserved cysteine of each domain. Temporal expression of Ab-KPI was assessed by real time quantitative PCR in hemocytes and mantle tissue following bacterial and viral hemorrhagic septicemia virus (VHSV) challenge, and tissue injury. At 6 h post-bacterial and -VHSV challenge, Ab-KPI expression in hemocytes was increased 14-fold and 4-fold, respectively, compared to control samples. The highest up-regulations upon tissue injury were shown at 9 h and 12 h in hemocytes and mantle, respectively. The transcriptional modulation of Ab-KPI following bacterial and viral challenges and tissue injury indicates that it might be involved in immune defense as well as wound healing process in abalone. Ó 2013 Elsevier Ltd. All rights reserved.
Keywords: Disk abalone Kazal-type proteinase inhibitor Transcriptional modulation Immune challenges Tissue injury
1. Introduction Endogenous proteinases present in the multicellular organisms regulate diverse and critically important physiological and immunological reactions [1]. Enzymatic regulation, which is mediated by different types of proteinase inhibitors (PIs), is important for the maintenance of all metabolic reactions in living cells; for example, PIs are involved in blood coagulation, activation of the
* Corresponding author. Marine Molecular Genetics Lab, Department of Marine Life Sciences, College of Ocean Science, Jeju National University, 66 Jejudaehakno, Ara-Dong, Jeju 690-756, Republic of Korea. Tel.: þ82 64 754 3472; fax: þ82 64 756 3493. E-mail addresses: [email protected], [email protected] (J. Lee). 1050-4648/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2013.07.005
complement system, inflammatory reactions, immune responses, and development [2]. Kazal-type proteinase inhibitors (KPIs) are widely identified in multicellular organisms, and mostly responsible for inhibition of serine proteinase [3]. Among serine PIs, KPIs are well characterized. KPI was originally isolated from bovine pancreas [4] in which the inhibitor controls excessive proteolytic activities in the alimentary organs. Related inhibitor genes were subsequently identified from invertebrates such as the arthropod, Pacifastacus leniusculus, and in blood sucking animals such as the insect, Rhodnius prolixus, in which KPIs assist in preventing blood coagulation, and thus facilitate insect to acquire more blood [5]. However, knowledge of kazal inhibitors in mollusks innate immunity is limited. To date, KPIs have been characterized from zhikong scallops, bay scallops, and eastern oyster. Several studies have shown that KPIs inhibit the activity of bacterial
1040
W.D.N. Wickramaarachchi et al. / Fish & Shellfish Immunology 35 (2013) 1039e1043
compounds like subtilisin, and exhibit bacteriostatic activity against Bacullius subtilis [6,7] and Staphylococcus aurious [8]. Furthermore, a potent role for KPIs in invertebrate immunity has been demonstrated by investigations of their involvement in the response against pathogenic microbial challenge [9]. A typical or canonical kazal domain comprises 40e60 amino acid residues, including six cysteine residues that form a 1e5, 2e4, 3e6 disulphide bond pattern. A number of kazal domains have been shown to evolve at different evolutionary rates [9]. For example, certain amino acid residues that reside between two consecutive cysteines can vary between kazal domains within the same individual, and sometimes lack certain disulphide bridges. Disk abalone is an economically important gastropod in Korean aquaculture. However, abalone farming has recently experienced outbreaks of mass mortality due to bacterial diseases [10]. A few pathogenic Vibrio species have been already identified for abalone diseases during last two decades [11]. Therefore, understanding of genes involved in anti-bacteria defense system of abalone is important for effective disease control. In this study, we characterized one of KPIs in disk abalone, Haliotis discus discus, designated as Ab-KPI. Our methods include cDNA cloning, sequence characterization, tissue-specific expression profiling, and transcription response in hemocytes, and mantle tissue following stimulation with bacteria, viral hemorrhagic septicemia virus (VHSV), and wound healing. Finally, we assessed the phylogenetics of Ab-KPI in the context of KPIs derived from other invertebrate species. 2. Materials and methods 2.1. Isolation of kazal-type proteinase inhibitor cDNA in disk abalone We constructed a normalized cDNA library from disk abalone using RNA isolated from whole tissues (gills, mantle, digestive tract, hepatopancreas, head, and muscle). Briefly, total RNA was isolated from pooled tissues of three healthy abalones using the Tri ReagentÔ (Sigma, USA), according to the manufacturer’s instructions. Polyadenylated messenger RNA (mRNA) was then purified using an mRNA isolation kit (FastTractÒ 2.0; Invitrogen, USA). First strand cDNA synthesis and normalization were carried out using the CreatorÔ SMARTÔ cDNA library construction kit (Clontech, USA), and Trimmer cDNA normalization kit (Evrogen, Russia), respectively. After that, the sequencing of abalone cDNA was performed on a GS-FLX Titanium system (DNA link, Inc.). A cDNA sequence with the highest homology to known KPIs was identified by a BLAST-X search on NCBI [12]. 2.2. Sequence characterization The Ab-KPI full-length sequence was analyzed by DNAssist (v2.2) and BLAST-X. Identities and similarities were compared with other known KPI sequences available in the NCBI and ENSEMBL databases. Characteristic domains or motifs were identified using the PROSITE profile database [13] and SMART proteomic database [14]. Identity, similarity, and gap percentages were calculated using EMBOSS pair-wise alignment algorithms (http:// www.ebi.ac.uk/Tools/psa/emboss_needle/). Signal peptide predictions were accomplished using the SignalP worldwide web server [15]. Disulfide bond prediction was carried out by the prosite database of protein domains, families, and functional sites program [16]. Multiple sequence alignments, and phylogenetic analyses were performed using ClustalW (v2.0) [17], based on known KPI amino acid sequences of other organisms. The phylogenetic tree was constructed with the MEGA software package (v5.0) [18] using the neighbor-joining (NJ) method; bootstrap values were based on 5000 replicates.
2.3. Experimental animals Healthy disk abalones (w50 g) were obtained from the Youngsoo abalone farm (Jeju Island, Republic of Korea). During the experiment, they were maintained in flat-bottomed fiberglass tanks (40 L) with sand-filtered aerated seawater at a temperature of 18 1 C. They were fed daily with fresh seaweed (Undaria pinnatifida). To minimize stress factors, a maximum of 10 individuals were housed per 40 L tank and laboratory environmental settings were uniformly maintained during the experiment. 2.4. Abalone tissues and hemocytes collection Three abalones were dissected, and tissues from gills, mantle, abductor muscle, hepatopancreas, and digestive tract were collected. All tissues were snap-frozen in liquid nitrogen, and stored at 80 C. Hemolymph (1 mL/animal) was collected in a sterilized syringe from the pericardial cavity of three abalones separately, and immediately centrifuged at 3000 g for 10 min at 4 C. The supernatant was removed, and the hemocytes were collected. 2.5. Immune challenge and tissue injury experiments In the bacterial challenge experiments, three bacterial strains were obtained from the Korean Collection for Type Cultures including two Gram-negative strains, Vibrio alginolyticus (KCTC2472), and Vibrio parahemolyticus (KCTC2729); and one Gram-positive strain, Listeria monocytogenes (KCTC3710). Bacteria cultures were prepared according to accepted culture preparation methodologies. Briefly, V. alginolyticus and V. parahemolyticus were cultured on marine agar plates at 25 C overnight. A single colony was inoculated in marine broth at 25 C for 16 h, while shaken at 200 rpm. L. monocytogenes was cultured on LB agar plates at 30 C overnight, and inoculated in LB broth at 30 C for 16 h. Bacterial pellets for all the three cultures (1.5 mL) were obtained by centrifugation (7000 g at 4 C for 5 min) and re-suspended in phosphate-buffered saline (PBS). Abalones were intramuscularly (i.m.) injected with 50 mL (per abalone) of bacterial mixture having a cell count of 5 107 cells/mL in bacterial stock. For the viral challenge experiments, we used a Korean isolate of VHSV, which was isolated from infected olive flounder, Paralichthys olivaceus, and propagated according to methods described previously [19]. Abalones injected with 50 mL of PBS were maintained separately for the use as controls in each time points. Tissue injury experiments were carried out on the mantle and shell as described previously [20]. Abalone mantle tissue and hemolymph were collected from experimental and control groups at 3, 6, 12, 24, and 48 h post injection (n ¼ 3). Hemocytes were collected from hemolymph as described above in section 2.4. 2.6. RNA extraction and cDNA synthesis Total RNA was isolated from the tissues of selected triplicates of disk abalone using TRIzol Reagent (SigmaeAldrich). For hepatopancreas tissue samples, an additional clean-up procedure with the RNeasy mini kit (Qiagen Hilden, Germany) was performed to remove polysaccharides and pigments that would interfere with subsequent enzymatic processes. The total RNA concentration was determined by spectrophotometric measurement of absorbance at 260 nm (Bio-Rad, Hercules, CA, USA). First strand cDNA was synthesized by using PrimeScriptÔ first strand cDNA synthesis kit (TaKaRa, Japan). In brief, RNA was incubated with 1 mL of 50 mM oligo(dT)20, and 1 mL of 10 mM dNTP for 5 min at 65 C and immediately cooled on ice. Then, 4 mL of 5 PrimeScriptTM buffer, 0.5 mL of RNase inhibitor (20 U), and 1 mL of PrimeScriptTM RTase (200 U) were added, and the mixture was incubated for 1 h at 42 C.
W.D.N. Wickramaarachchi et al. / Fish & Shellfish Immunology 35 (2013) 1039e1043
The reaction was terminated by raising the temperature to 70 C for 15 min. The synthesized cDNA was diluted 40-fold and stored at 20 C. 2.7. Ab-KPI mRNA expression by quantitative real time PCR (qPCR) Synthesized cDNA was used as template for qPCR. Two pairs of gene-specific primers (Forward: AAGGCCCACTGTCAGGATCTTACT and Reverse: TGGCCATCTGGGAACAGAAGAACT) were used (designed by Primer 3.0) to amplify Ab-KPI. Ribosomal protein L5 gene-specific primers (Forward: TCACCAACAAGGACATCATTTGTC and Reverse: CAGGAGGAGTCCAGTGCAGTATG) were used to amplify the reference gene. qPCR was carried out in a 15 mL reaction volume containing 4 mL of cDNA (1:40 dilution), 7.5 mL of 2 SYBR Green master mix, 0.6 mL of each primer (10 pmol/mL), and 2.3 mL of PCR-grade water using the Thermal Cycler DiceTM Real Time System (TaKaRa). The thermal profile was one cycle of 95 C for 3 min, followed by 45 cycles of 95 C for 20 s, 58 C for 20 s, and 72 C for 30 s. To verify that each primer pair produced only a single product, a dissociation curve was generated for the product by heating from 60 C to 95 C at the end of the reaction. For each cDNA sample, reactions were performed in triplicate. A reaction carried out without cDNA sample was used as the negative control. Finally, the Ct values obtained from qPCR were converted into relative expression levels using the 2DDCt method [21]. For the expression profiles, the ribosomal protein L5 normalized mRNA levels were compared with the levels detected in the respective PBS-injected controls were used to calculate the relative fold-difference for each time point. All data have been expressed as mean SD values, and significant differences of each group with respect to the control (0 h) were analyzed using the Student’s t-test with the SPSS statistical software package (v16.0; SPSS Inc., USA). Values of P < 0.05 were considered statistically significant. 3. Results and discussion Based on BLAST-X analysis of EST data from the normalized cDNA library, we have identified the full-length cDNA sequence of the kazal-type proteinase inhibitor from disk abalone (H. discus discus), designated as Ab-KPI. The sequence was deposited in NCBI under the accession number ADQ43244. The complete cDNA sequence is 600 bp in length, composed of a 26 bp 50 -UTR, 432 bp open reading frame (ORF) encoding 143 amino acids, and a 142 bp 30 -UTR including a polyadenylation (470AATAAA 475) signal and poly A tail (Fig. 1). The predicted molecular mass of Ab-KPI was 16 kDa,
1041
and its theoretical isoelectric point was 7.6. The start codon and stop codon were found at nucleotide positions 1-3 (ATG) and 430432 (TAG) from the 50 end of the cDNA sequence, respectively. Based on the prediction from the SignalP server, Ab-KPI ORF consists of a 17-amino acid signal peptide [15]. Motif analysis revealed that Ab-KPI contains two typical kazal domains (Ab-KPI-D1and AbKPI-D2) and each contains 57, and 55 amino acids, respectively. The number of amino acids in a typical or canonical kazal domain is comprised of 40e60 amino acids, including spacer amino acids; however, most of the amino acid residues in the common kazal motif could be varied among the invertebrate species [9]. Each domain of Ab-KPI contains a unique characteristic of six conserved cysteine residues responsible for forming three disulfide bridges (C1eC5, C2eC4, C3eC6), which has been identified previously in other classical KPI family members [16]. In each domain, the active site is considered to be the second amino acid from the second conserved cysteine. The presence of kazal domains and the existence of conserved motifs, together with the three intra-domain disulfide bonds strongly suggest that Ab-KPI is a member of the KPI family. Previous studies have shown that KPIs in different organism might comprise of single or multiple kazal domains due to different evolutionary rates [22,23]. The number of kazal domains varies drastically amongst mollusk species. In contrast to the twodomain structure in H. discus discus, 12 and 6 kazal domains have been identified in KPIs of the zhikong scallop (Chlamys farreri) [24] and bay scallop (Argopecten irradians) [25]. Although variable numbers of kazal domains are present in KPIs, not all of them may be required to carry out particular biological functions [9]. The inhibitory specificity of kazal domains also varies, depending on the reactive P1 amino acid (Supplementary data, Fig. 1) [7,26]. This amino acid specifically interacts with the active site of the cognate enzyme [27,28]. Ab-KPI has two kazal domains that consist of two P1 reactive sites, namely L and T. The L active site residue may give inhibitory activity to subtilisin and elastase, whereas the T active site residue may act against subtilisin, trypsin, and proteinase K [29,30]. However, many studies have shown that multi-domain KPIs contain one or more inactive domains [31]. In the pairwise sequence alignment, Ab-KPI showed the highest similarity with serine proteinase inhibitors of crustaceans. Ab-KPI exhibited 31.3% and 29.6% sequence identity to PIs characterized from signal crayfish (Pacifastacus leniusculus : ACB78013) and fresh water crayfish (Procambarus clarkii :ADI96222), respectively. It also shared 18.3% identity with a PI sequence from the eastern oyster (Crassostrea virginica : DQ092546) (Supplementary data, Table 1).
Fig. 1. Nucleotide sequence (above) and deduced amino acid sequence (below) of Ab-KPI (ADQ43244). The letters in bold denote start codon (ATG), stop cordon (TAG), and polyadenylation signal. A signal peptide is underlined in bold and two kazal domains are shaded in gray. Characteristic conserved cysteine residues responsible for the formation of disulfide bridges are boxed and P1 active sites are circled. The nucleotide and amino acid positions are numbered along the right margins of each corresponding line.
1042
W.D.N. Wickramaarachchi et al. / Fish & Shellfish Immunology 35 (2013) 1039e1043
Furthermore, a multiple alignment of Ab-KPI with KPIs from other related species revealed that the kazal domain is highly conserved across invertebrate species (Supplementary data, Fig. 1). Phylogenetic analysis revealed that all mollusk KPIs belong to one cluster, distinguishing them from other known invertebrate KPIs (Supplementary data, Fig. 2). According to the results of tissue specific mRNA expression, we found that Ab-KPI was constitutively expressed in all the tissues examined, although the level of expression varied between tissues. The highest expression level was observed in the hepatopancreas, whereas the lowest expression was observed in the digestive tract (P < 0.05) (Supplementary data, Fig. 3.). KPI was previously reported to be primarily expressed in various tissues of invertebrates, including hemocytes, hepatopancreas, gills, stomach, and reproductive organs [3,24,31,32]. In crustaceans, ample amounts of KPI expression were observed in hemocytes of Chinese white shrimp Fenneropenaeus chinensis [33] and crayfish P. leniusculus [5] whereas in both eyestalk and hemocytes of swimming crab Portunus trituberculatus [32] Additionally, hepatopancreas in F. chinensis was also exhibited as a prominent KPI expressing tissue, similar as the observation of Ab-KPI in our study [9]. Abalones are susceptible to different types of bacteria. Several Vibrio species, such as V. alginolyticus, different strains of Vibrio paraheamolyticus and Vibrio carchariae have been isolated in small abalone [10]. Furthermore, isolation experiments have proven that the principle agents behind mass mortality in the abalone farms in China and Taiwan were majorly Vibrio species as well as some viruses [10,34]. Hence, we used both bacteria mixture and VHSV in the immune challenge experiments, which have been proven to successfully evoke abalone immune response in our earlier studies. In time course experiment of disk abalone, transcriptional response of Ab-KPI was investigated in hemocytes and mantle tissues upon bacterial, viral, and tissue injury challenges. After bacterial and VHSV challenge, hemocytes showed a nearly 14-fold and 4-fold increase in relative expression at 6 h p.i. compared to controls (Fig. 2A). Many studies have shown that the expression of KPIs can be enhanced by the pathogenic infection, and their functions are important for hostresponses against microbial challenge [9,33]. It is well-known that pathogens produce virulence factors during infection, such as proteinases, which aid penetration into the host cell. PIs can act on these pathogenic proteinases and prevent entry of invading pathogen. Therefore, PIs are suggested to have antimicrobial activity against invading bacteria [8]. Furthermore, in many mollusk species, KPIs are up-regulated during bacterial and viral challenges. For example, in bay scallops, A. irradians, a six-domain KPI was up-regulated after Vibrio anguillarum injection. Similarly, a twelve-domain KPI in the zhikong scallop, C. farreri was also up-regulated during V. anguillarum bacterial challenge [24,25]. In our study, we also observed increased Ab-KPI mRNA expression at 6 h p.i following both bacterial and VHSV challenge, further confirming an important role for KPIs in innate immunity. In the context of tissue injury, Ab-KPI was up-regulated in both hemocytes and the mantle. In hemocytes, up-regulation began at 6 h p.i, and was highest at 9 h after the injury. In the mantle, Ab-KPI up-regulation was first observed at 3 h, and continued to increase up to 12 h after injury (Fig. 2B). A similar pattern of up-regulation has also been observed in bay scallops (A. irradians) at 8 h after tissue injury [25]. These results confirmed that Ab-KPI is activated during inflammatory responses associated with tissue injury and bacterial and viral challenge. However, additional study will be required for the biochemical and regulatory mechanisms of Ab-KPI in the abalone defense system. In summary, we identified the kazal-type proteinase inhibitor, Ab-KPI, from disk abalone. Transcriptional modulation of Ab-KPI observed following tissue injury and immune challenge indicates its involvement in wound healing and the innate immune response
Fig. 2. (A) Relative mRNA expression in abalone hemocytes in response to challenge by mixture of three bacteria (Vibrio alginolyticus, Vibrio parahemolyticus and Listeria monocytogenes) and VHSV. The amount of Ab-KPI mRNA relative to both internal control ribosomal protein and PBS-injected controls is expressed as mean SD (n ¼ 3). Significant up-regulations (P < 0.05 vs. un-injected control at 0 h) are marked with asterisks. (B) Relative mRNA expression in hemocytes and mantle of abalone in response to tissue injury, as detected by qPCR. The amount of Ab-KPI mRNA relative to both internal control ribosomal protein and uninjured controls is expressed as mean SD (n ¼ 3). Significant up-regulations (P < 0.05 vs. uninjured control) are marked with asterisks.
of disk abalone. Our study will possibly aid future investigations of proteinase inhibitors in mollusks and other invertebrates. However, regulatory and defense mechanisms of Ab-KPI in the disk abalone require further study. Acknowledgments This research was supported by the MSIP (Ministry of Science, ICT & Future Planning), Korea, under the ITRC (Information Technology Research Center) support program supervised by the NIPA National IT Industry Promotion Agency (NIPA-2013-H030113-2009). Appendix A. Supplementary data Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.fsi.2013.07.005. References [1] Nikapitiya C, De Zoysa M, Oh C, Lee Y, Ekanayake PM, Whang I, et al. Disk abalone (Haliotis discus discus) expresses a novel antistasin-like serine protease inhibitor: molecular cloning and immune response against bacterial infection. Fish & Shellfish Immunology 2010;28:661e71. [2] Takada A, Takada Y, Urano T. The physiological aspects of fibrinolysis. Thrombosis Research 1994;76:1e31.
W.D.N. Wickramaarachchi et al. / Fish & Shellfish Immunology 35 (2013) 1039e1043 [3] Li XC, Zhang RR, Sun RR, Lan JF, Zhao XF, Wang JX. Three kazal-type serine proteinase inhibitors from the red swamp crayfish Procambarus clarkii and the characterization, function analysis of hcPcSPI2. Fish & Shellfish Immunology 2010;28:942e51. [4] Kazal LA, Spicer DS, Brahinsky RA. Isolation of a crystalline trypsin inhibitoranticoagulant protein from pancreas. Journal of the American Chemical Society 1948;70:3034e40. [5] Cerenius L, Liu H, Zhang Y, Rimphanitchayakit V, Tassanakajon A, Gunnar Andersson M, et al. High sequence variability among hemocyte-specific kazaltype proteinase inhibitors in decapod crustaceans. Developmental and Comparative Immunology 2010;34:69e75. [6] Somprasong N, Rimphanitchayakit V, Tassanakajon A. A five-domain kazaltype serine proteinase inhibitor from black tiger shrimp Penaeus monodon and its inhibitory activities. Developmental and Comparative Immunology 2006;30:998e1008. [7] Donpudsa S, Tassanakajon A, Rimphanitchayakit V. Domain inhibitory and bacteriostatic activities of the five-domain kazal-type serine proteinase inhibitor from black tiger shrimp Penaeus monodon. Developmental and Comparative Immunology 2009:481e8. 2008/10/22 ed. [8] Augustin R, Siebert S, Bosch TC. Identification of a kazal-type serine protease inhibitor with potent anti-staphylococcal activity as part of Hydra’s innate immune system. Developmental and Comparative Immunology 2009;33: 830e7. [9] Rimphanitchayakit V, Tassanakajon A. Structure and function of invertebrate kazal-type serine proteinase inhibitors. Developmental and Comparative Immunology 2010;34:377e86. [10] Liu PC, Chen YC, Huang CY, Lee KK. Virulence of Vibrio parahaemolyticus isolated from cultured small abalone, Haliotis diversicolor supertexta, with withering syndrome. Letters in Applied Microbiology 2000;31:433e7. [11] Gardner GR, Harshbarger JC, Lake JL, Sawyer TK, Price KL, Stephenson MD, et al. Association of prokaryotes with symptomatic appearance of withering syndrome in black abalone Haliotis cracherodii. Journal of Invertebrate Pathology 1995;66:111e20. [12] Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. Journal of Molecular Biology 1990;215:403e10. [13] Bairoch A, Bucher P, Hofmann K. The PROSITE database, its status in 1997. Nucleic Acids Research 1997;25:217e21. [14] Letunic I, Doerks T, Bork P. SMART 6: recent updates and new developments. Nucleic Acids Research 2009;37:D229e32. [15] Bendtsen JD, Nielsen H, von Heijne G, Brunak S. Improved prediction of signal peptides: SignalP 3.0. Journal of Molecular Biology 2004;340:783e95. [16] De Castro E, Sigrist CJ, Gattiker A, Bulliard V, Langendijk-Genevaux PS, Gasteiger E, et al. ScanProsite: detection of PROSITE signature matches and ProRule-associated functional and structural residues in proteins. Nucleic Acids Research 2006;34:W362e5. [17] Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 1994;22:4673e80. [18] Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 2011;28:2731e9.
1043
[19] De Zoysa M, Jung S, Lee J. First molluscan TNF-alpha homologue of the TNF superfamily in disk abalone: molecular characterization and expression analysis. Fish & Shellfish Immunology 2009;26:625e31. [20] De Zoysa M, Nikapitiya C, Lee Y, Lee S, Oh C, Whang I, et al. First molluscan transcription factor activator protein-1 (Ap-1) member from disk abalone and its expression profiling against immune challenge and tissue injury. Fish & Shellfish Immunology 2010;29:1028e36. [21] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001;25: 402e8. [22] Jimenez-Vega F, Vargas-Albores F. A four-kazal domain protein in Litopenaeus vannamei hemocytes. Developmental and Comparative Immunology 2005;29: 385e91. [23] Xue QG, Waldrop GL, Schey KL, Itoh N, Ogawa M, Cooper RK, et al. A novel slow-tight binding serine protease inhibitor from eastern oyster (Crassostrea virginica) plasma inhibits perkinsin, the major extracellular protease of the oyster protozoan parasite Perkinsus marinus. Comparative Biochemistry and Physiology Part B, Biochemistry & Molecular Biology 2006;145:16e26. [24] Wang B, Zhao J, Song L, Zhang H, Wang L, Li C, et al. Molecular cloning and expression of a novel kazal-type serine proteinase inhibitor gene from Zhikong scallop Chlamys farreri, and the inhibitory activity of its recombinant domain. Fish & Shellfish Immunology 2008;24:629e37. [25] Zhu L, Song L, Chang Y, Xu W, Wu L. Molecular cloning, characterization and expression of a novel serine proteinase inhibitor gene in bay scallops (Argopecten irradians, Lamarck 1819). Fish & Shellfish Immunology 2006;20: 320e31. [26] Wang ZH, Zhao XF, Wang JX. Characterization, kinetics, and possible function of kazal-type proteinase inhibitors of Chinese white shrimp, Fenneropenaeus chinensis. Fish & Shellfish Immunology 2009;26:885e97. [27] Ozawa K, Laskowski Jr M. The reactive site of trypsin inhibitors. The Journal of Biological Chemistry 1966;241:3955e61. [28] Laskowski Jr M, Kato I. Protein inhibitors of proteinases. Annual Review of Biochemistry 1980;49:593e626. [29] Nirmala X, Mita K, Vanisree V, Zurovec M, Sehnal F. Identification of four small molecular mass proteins in the silk of Bombyx mori. Insect Molecular Biology 2001;10:437e45. [30] Visetnan S, Donpudsa S, Supungul P, Tassanakajon A, Rimphanitchayakit V. Kazal-type serine proteinase inhibitors from the black tiger shrimp Penaeus monodon and the inhibitory activities of SPIPm4 and 5. Fish & Shellfish Immunology 2009;27:266e74. [31] Qian YQ, Li Y, Yang F, Yu YQ, Yang JS, Yang WJ. Two kazal-type protease inhibitors from Macrobrachium nipponense and Eriocheir sinensis: comparative analysis of structure and activities. Fish & Shellfish Immunology 2012;32: 446e58. [32] Wang S, Cui Z, Liu Y, Li Q, Song C. The first kazal-type serine proteinase inhibitor in the swimming crab Portunus trituberculatus involved in immune response to bacteria and fungi. Aquaculture 2012;356e357:55e60. [33] Kong HJ, Cho HK, Park E-M, Hong G-E, Kim Y-O, Nam B-H, et al. Molecular cloning of kazal-type proteinase inhibitor of the shrimp Fenneropenaeus chinensis. Fish & Shellfish Immunology 2009;26:109e14. [34] Cai J, Han H, Song Z, Li C, Zhou J. Isolation and characterization of pathogenic Vibrio alginolyticus from diseased postlarval abalone, Haliotis diversicolor supertexta (Lischke). Aquaculture Research 2006;37:1222e6.