- Email: [email protected]
Characterization of dentin matrix protein 1 gene in crocodilia
Gene 234 (1999) 307–314 www.elsevier.com/locate/gene
Characterization of dentin matrix protein 1 gene in crocodilia S. Toyosawa 1, C. O’hUigin *, H. Tichy, J. Klein Max-Planck-Institut fu¨r Biologie, Abteilung Immungenetik, D-72076 Tu¨bingen, Germany Received 30 October 1998; received in revised form 15 April 1999; accepted 11 May 1999; Received by W.-H. Li
Abstract Several clones containing DMP1 cDNA were isolated from a caiman tooth library by screening with a platypus DMP1 probe. The caiman DMP1 shows little amino acid sequence similarity to mammalian DMP1s for much of its length. A few highly conserved regions can, however, be identified that correspond to the slowly evolving parts of the corresponding mammalian genes. Southern blot analysis using probes comprising either conserved regions or longer segments of the gene indicates that only a single DMP1 locus exists. In coding regions, exon–intron boundaries and reading frames are shared by caiman and mammalian genes with the exception of exons 1 and 5, which are longer in the caiman. The repetitive sequence of the last exon is shared by mammals and caiman as are the high Ser content and acidity due to a high proportion of Asp and Glu residues. The conserved mammalian cell-attachment signal Arg–Gly–Asp is absent in the caiman DMP1. In contrast to the amelogenin gene, the DMP1 gene appears to evolve rapidly in vertebrates. © 1999 Elsevier Science B.V. All rights reserved. Keywords: Caiman; Mineralized tissue; Reptilian tooth
1. Introduction Bone and dentin are the principal mineralized tissues of vertebrates (Miles and Poole, 1967). Dentin is a bone-like substance with a long evolutionary history that may go back all the way to the origin of vertebrates; in fact, it is considered to be one of the distinguishing characteristics of the vertebrate subphylum (Smith and Hall, 1990). Prominent constituents of dentin and bone are acidic phosphoproteins, which have been implicated in the mineralization of these tissues (Gorski, 1992). A cDNA clone of one of the acidic phosphoproteins, dentin matrix protein 1 (DMP1), was obtained by screening a rat incisor cDNA library (George et al., 1993). From the complete DMP1 cDNA sequence, it has been deduced that the secreted protein, after removal of the 16-residue signal peptide, comprises 473 amino Abbreviations: bp, base pair(s); cDNA, complementary DNA; DMP, dentin matrix protein; kb, kilobase pair; my, million years; PCR, polymerase chain reaction; pfu, plaque-forming units; RACE, rapid amplification of cDNA ends; RT, reverse transcriptase; UTR, untranslated region(s). * Corresponding author. Tel.:+49-7071-601290; fax:+49-7071-600437. E-mail address: colm.o’[email protected] (C. O’hUigin) 1 Permanent address: Osaka University Faculty of Dentistry, Department of Oral Pathology, Osaka 565-0876, Japan.
acid residues. The acidity of the protein is inferred from the preponderance of Asp and Glu residues, its phosphoprotein nature from the presence of >100 Ser residues forming potential sites for phosphorylation by casein kinases I and II. Transcripts of the DMP1 gene were originally detected by Northern blot hybridization in odontoblasts (George et al., 1993), but were later shown by in-situ hybridization to be present also in other mineralized tissues, including bone, cementum, and enamel (D’Souza et al., 1997; MacDougall et al., 1998), as well as in fetal bovine brain (Hirst et al., 1997a). Homologs of the DMP1 gene or of its transcript have been cloned also in humans (Hirst et al., 1997b), cattle ( Hirst et al., 1997a), mouse (MacDougall et al., 1998), as well as wallaby, opossum, and platypus ( Toyosawa et al., 1999). In each of these species, the DMP1 gene is present in a single copy in the haploid genome. Zoo blot analysis suggests that a DMP1 homolog is also present in monkeys, sheep, and dog (Hirst et al., 1997a). There is evidence in humans, cattle and rat for alternative splicing of the DMP1 transcript involving the presence or absence of exon 5 (Hirst et al., 1997a,b; MacDougall et al., 1998). In terms of dental evolution, crocodilia are probably the most interesting order within the class Reptilia. Crocodilians arose from a stock of diapsid reptiles, the Archosauria, which also gave rise to dinosaurs, ptero-
0378-1119/99/$ – see front matter © 1999 Elsevier Science B.V. All rights reserved. PII: S0 3 7 8 -1 1 1 9 ( 9 9 ) 0 0 19 5 - X
308
S. Toyosawa et al. / Gene 234 (1999) 307–314
saurs, and birds (Carroll, 1988). Archosaurs diverged from other reptiles in the Triassic, producing an assemblage referred to as Thecodontia, then continued to expand throughout the Mesozoic, only to decline rapidly some 65 million years (my) ago, at the beginning of the Cenozoic. Crocodilians are the only surviving archosaurs. They can be traced back to the Middle Triassic, some 240 my ago, to the thecodont stock with which they share a number of ‘non-reptilian’ features (Ferguson, 1981). They share some of these features, with mammals, such as teeth set in sockets. Since, however, mammals evolved from a different (synapsidian) reptile branch, the similarities are presumably the result of convergent evolution. The basic crocodilian features were established in the Late Triassic some 180– 200 my ago and have persisted to this day. Their status as ‘living fossils’ as well as their relationship to birds, on the one hand, and the thecondants with mammallike characteristics, on the other hand, make crocodilians a key group in the study of tooth evolution. As part of our effort to trace the evolution of the major toothforming genes, we have, therefore, included crocodilians in our analysis. Here, we describe the identification of DMP1- encoding cDNA clones from a crocodilian representative, the caiman.
Approximately 105 clones of the caiman cDNA library were screened with a 32P-labeled platypus exon 6 DMP1 probe ( Toyosawa et al., 1999). Low-stringency screening yielded a number of positive plaques, which were then purified by repeated plating and selection with the same probe. After three rounds of plaque purification, three positive cDNA clones (dmp2, 7, and 12) were identified, and their insert sizes were determined by agarose gel electrophoresis of polymerase chain reaction (PCR) products generated using flanking lgt10 primers. The inserts were subcloned into Sma I-digested pUC18 plasmid vector by using the SureClone ligation kit (Pharmacia Biotech), and sequenced.
2. Materials and methods
2.3. Isolation of cDNA 5∞-ends by 5∞-rapid amplification of cDNA ends (RACE)
2.1. Source of DNA and RNA and preparation of cDNA library Tissue ( jaw) samples from 3-day-old smooth-fronted caiman, Paleosuchus palpebrosus, were frozen in liquid nitrogen immediately after excision and kept frozen at −70°C until their use. Genomic DNA was isolated from the tissues by phenol/chloroform extraction (Ausubel et al., 1988). The frozen tissues were homogenized to a fine powder, and total RNA was extracted (Chirgwin et al., 1979). Poly (A+) RNA was isolated, and cDNA was synthesized with the help of the mRNA purification kit (Pharmacia Biotech, Freiburg, Germany) and the
TimeSaver cDNA synthesis kits (Pharmacia Biotech), respectively. The cDNA was inserted into EcoRIdigested lgt10 vector (Stratagene, Heidelberg, Germany), and the cDNA library was in vitro-packaged with the help of the GigapackA cloning kit (Stratagene) and used to transform competent E. coli NM514 bacteria. The initial titer of the library was 1.2×106 plaqueforming units (pfu); the library was amplified once to a titer of 1.5×1011 pfu/mg. 2.2. Screening of the cDNA library
The longest clone (clone dmp7; 2 kb) isolated from the library lacked parts of the 5∞ end. To obtain a fulllength clone, a reverse transcriptase (RT )-PCR was carried out using a 5∞-RACE kit (Gibco BRL, Eggenstein, Germany). One microgram of total RNA prepared from caiman jaws was used for the first-strand cDNA synthesis with random hexamer primers. An intermediate terminal deoxynucleotidyltransferase tailing reaction was carried out prior to amplification. The first-strand cDNA products were then amplified by PCR with caiman DMP1-specific primers, DEN-52 (5∞GCTTCGGTCATACCTGCTAACAAT-3∞; sites 1055– 1032), and DEN-57 (5∞-GTCATTGCCTTCATTGG-
Table 1 Oligonucleotide primers used in the determination of exon–intron boundariesa Designation
Sequence
Specificity (exon, codon number)
Orientation
DEN-69 DEN-63 DEN-80 DEN-81 DEN-82 DEN-61 DEN-60 DEN-55
AAGTGCCACTGAGATACAGATGTATAA CTTAGAGCTGCCATCGTGAACATT GTTCACGATGGCAGCTCTAAGGAA GAGGGCAGCTAATGTCTCAGATGA GTTGATTCATCTGAGACATTAGCT TTTATGATGACTCTGCTTAATTCT GACCTCAATGGAAATGATGTTGAT ACTAGGATCTTTTCCATTTGTATC
E1, E3, E3, E4, E4, E5, E5, E6,
S A S A S A S A
a A, antisense primer; S, sense primer; E, exon; UTR, untranslated region.
5∞UTR 24–31 25–32 37–44 35–42 138–145 117–124 232–239
S. Toyosawa et al. / Gene 234 (1999) 307–314
TCTCATGTAAAAT-3∞; sites 440–411). The PCR products, denoted dmp5∞-1 and dmp5∞-2, were subcloned into SmaI-digested pUC18 plasmid vector. 2.4. DNA sequencing Sequencing was performed by the dideoxy chaintermination method using the AutoRead Sequencing Kit (Pharmacia Biotech). The reactions were processed by the Automated Laser Fluorescent (A.L.F.) Sequencer (Pharmacia Biotech). The following internal primers deduced from the caiman DMP1 sequences were used for sequencing: DEN53 (5∞-AGTCGCTCAAGGGAAGACGTCACCAG-3∞; sites 1449–1474), DEN54 (5∞-ATGCTCAAAGTATTTCCTAACAAT-3∞; sites 2465–2488) and DEN86 (5∞-GACAGCAGTCACTCTGAAGAGAGT-3∞; sites 1398–1421). To determine the exon–intron organization of the caiman DMP1 gene, primers were designed to amplify regions of the individual exon–intron boundaries (Table 1), and the genomic sequence data were compared with the cDNA sequences. 2.5. Southern blot analysis For Southern blots, 10 mg of genomic DNA were digested with restriction enzymes, and the resulting fragments were separated by electrophoresis on a 0.8% agarose gel (Gibco BRL) and transferred to a hybridization membrane (Hybond-N+, Amersham, Braunschweig, Germany) using the VacuGene blotting system (Pharmacia Biotech). The filters were incubated for 5 h in a prehybridization solution containing 1× Denhardt’s solution, 5×SSC, 0.2% SDS, and 5×106 cpm of the probe, 32P-labeled by the random priming method to a specific activity of 1×109 cpm/mg with the help of a ReadyToGo DNA labeling kit (Pharmacia Biotech). Filters were washed in 2× SSC, 0.1% SDS for 20 min at room temperature and then used to expose XAR5 films ( Kodak, Stuttgart, Germany) with intensifying screens for 3–5 days.
309
2.6. Data analysis The nucleotide and inferred protein sequences were aligned with the aid of the SeqPup (Gilbert, 1995) computer program. The evolutionary relationships were then evaluated using distances estimated by the method of Li (1993). 3. Results and discussion 3.1. Characterization of the caiman DMP1 cDNA The complete coding sequence of the caiman DMP1 mRNA was deduced from three separate overlapping cDNA clones. One of these clones (dmp7) was isolated from the lgt10 cDNA library; the other two (dmp5∞-1 and dmp5∞-2) were generated by RT-PCR. Two additional clones (dmp2, dmp12) were used to confirm the DMP1 sequence (Fig. 1). The complete caiman DMP1 coding sequence is 2821 bp long and contains an open reading frame for 657 amino acid residues beginning with the translation start site at 138 bp and 16-residue hydrophobic signal peptide (Fig. 2). Blast searches of the putative peptide revealed the highest similarity to mammalian DMP1 sequences. The stop codon at 2109 bp is followed by a 3∞ untranslated region ( UTR) of 719 bp with a putative polyadenylation signal ATTAAA at 2796 bp. Exon–intron boundaries of the caiman DMP1 gene were determined by sequencing corresponding regions of genomic DNA (Table 2). The boundaries of exons 2, 3, and 4 correspond to those reported for the mammalian DMP1 genes, whereas those of exons 1 and 5 do not, the former containing a longer 5∞ region and the latter a longer 3∞ region. All exon–intron boundaries occur in reading frame 0, a property shared by caiman and human sequences (Hirst et al. 1997b; Fig. 3). The coding region of the caiman DMP1 gene has only a low sequence similarity with the mammalian DMP1 cDNA sequences ( Fig. 4). The caiman protein sequence shows 27, 26, and 27.4% sequence similarity
Fig. 1. Cloning scheme of caiman DMP1 cDNA. The positions of initiation and stop codons are shown by arrows. Thick lines indicate the sizes and positions of PCR fragments derived from the cDNA.
310
S. Toyosawa et al. / Gene 234 (1999) 307–314
Fig. 2. Nucleotide sequence of caiman DMP1 cDNA. The coding region is displayed by codons and the deduced protein sequence is given as a one-letter amino acid code. Vertical lines indicate the positions of the exon boundaries.
311
S. Toyosawa et al. / Gene 234 (1999) 307–314 Table 2 Exon–intron organization of caiman DMP1 genesa Number
1 2 3 4 5 6
Exon size (bp)
74 48 33 357 >2199
Intron size (bp)
2000 117 2500 412 650
5∞ boundary
CAC GCT GAA GCC CAC
ACA CAC TGG CTC TCT
AAG CCC AGG AGG CTG
Sequence of exon–intron junctions Intron
3∞ boundary
gtaatgatcattgag gtaagtacgtgtttag gtaagtaattccacag gtaactattcctgcag gtaagagtacttctag
TTG GTA GTT TAT GAG
CAC CCC GAT GCA GAT
ACA AAC TCA ACA GTC
a Nucleotide sequences of exons are in upper-case letters, and nucleotide sequences of introns are in lower-case letters.
with the human, cattle, and mouse sequences, respectively. At least three regions of high sequence similarity can be identified; they encompass positions 215–225, 325–335, and 630–660 of the amino acid alignment. Additionally, the caiman DMP1 sequence shares several other features with the mammalian DMP1 sequences. Acidity is imposed on the DMP1 molecule by the high content of aspartic and glutamic acids. The protein
sequence predicted from the caiman DMP1 cDNA sequence contains 13.1% Asp and 12.02% Glu, which are values comparable to those found in the mammalian DMP1 sequences (George et al., 1993; Hirst et al., 1997a,b; MacDougall et al., 1998; Toyosawa et al., 1999). Serine is an essential residue of the sequence motif recognized by the casein kinases I and II (Marshak and Carroll, 1991) and the target of phosphorylation
Fig. 3. Comparison of the exon–intron organization of caiman, human, cattle, and mouse DMP1 genes. Boxed regions indicate exons; translated regions are indicated by hatching. Arrows indicate the positions of initiation and stop codons where known. Sizes of the caiman introns (in bp) are shown.
312
S. Toyosawa et al. / Gene 234 (1999) 307–314
Fig. 4. Amino acid alignment of mammalian and caiman DMP1 sequences. The simple majority consensus sequence is given at the top. Identity with the consensus is indicated by a dash (-); a dot (.) indicates the absence of sequence information and an asterisk (*) a gap introduced to improve the alignment.
catalyzed by these enzymes. The predicted serine content of the sequence translated from the caiman cDNA is 18.7%, which is similar to that reported for the mammalian proteins (George et al., 1993; Hirst et al., 1997a,b; MacDougall et al., 1998; Toyosawa et al., 1999). To investigate the possibility that other DMP1-like loci may exist in the caiman, we carried out a Southern blot analysis using as a probe either a near complete exon 6 or a segment encompassing part of exon 6 and
the beginning of the 3∞ UTR conserved between mammals and caiman. The results of the analysis are consistent with the presence of a single DMP1 locus in the caiman genome ( Fig. 5). A single band is found following digestion with either HindIII, TaqI, or PstI restriction endonucleases. The cell-attachment Arg–Gly–Asp ( RGD) motif is not specific for the DMP1 molecules, but is found to be present in a number of other acidic phosphoproteins
S. Toyosawa et al. / Gene 234 (1999) 307–314
313
conserved within mammals but not in the caiman sequence. We conclude that cell attachment may occur by other means, if at all, in the caiman.
3.2. Evolutionary analysis
Fig. 5. Southern blot analysis of caiman DMP1. Lanes marked H, T, and P indicate digestion of genomic DNA with HindIII, TaqI, and PstI restriction endonucleases, respectively.
such as osteopontin (Oldberg et al., 1986; Young et al., 1990), bone sialoprotein ( Fisher et al., 1990), and dentin sialophosphoprotein (MacDougall et al., 1998). The RGD sequence is strictly conserved among all the sequenced mammalian proteins and is thought to have an important biological function in mammalian DMP1 molecules. However, the RGD motif is absent in the caiman DMP1 molecule. Moreover, the segment of the mammalian protein flanking the RGD motif is also
The low degree of sequence similarity between the caiman and the mammalian DMP1 genes is in agreement with expectations derived from evolutionary analysis. In mammals, DMP1 is a rapidly evolving gene. The number of synonymous substitutions between mouse and human lineages, as measured by the method of Li (1993), is close to saturation at 0.98 substitutions per site. This substitution rate places DMP1 among the most rapidly evolving genes of the sample of 28 mouse and human genes surveyed by O’hUigin and Li (1992), including a variety of housekeeping, hormone-encoding, and cellstructure-encoding genes. This observation indicates that the underlying mutation rate at the DMP1 locus is high. The number of non-synonymous substitutions (0.199 per site) is also high compared to the genes in that survey, the average value for the 28 genes being 0.049 per site. By contrast, another gene involved in tooth formation, amelogenin, has evolved more conservatively, having accumulated 0.23 synonymous and 0.08 non-synonymous substitutions per site ( Toyosawa et al. 1998) since the divergence of the human and mouse lineages. A rapidly evolving gene may nevertheless remain recognizable over a longer divergence time if it contains regions that evolve slowly. To identify such regions, we
Fig. 6. Plot of percentage non-synonymous substitution (K %) per site against codon position in pairwise comparisons of human (H ), cattle (C ), a and mouse (M ) DMP1 sequences. A sliding window of 10 codons was used, and measurements were taken at five-codon intervals. Small alignment gaps ( less than eight residues) were ignored in the plot. Arrows point to regions conserved between mammalian and caiman sequences. The unbroken line shows the H–C comparison, the heavy dashed line H–M, and the light dashed line C–M.
314
S. Toyosawa et al. / Gene 234 (1999) 307–314
examined the dependence of nonsynonymous substitution rates on the position within the gene. A sliding window of 10 codons was used, within which the extent of non-synonymous substitutions was measured in pairwise comparisons of aligned human, mouse, and cattle coding sequences. The eutherian mammals were considered suitable since full-length cDNA sequences are available for these species and the shorter divergence time allows recognition of even moderately conserved regions. Fig. 6 shows that there are several regions that appear to undergo few non-synonymous substitutions (positions around codons 20, 110, 210, 410, 470, and 520 of the alignment of human, mouse, and cattle genes). We would expect from this analysis that only these regions would be conserved between mammalian and reptilian genes. In fact, of the slowly evolving regions, three correspond to the regions that are conserved between the caiman and mammalian genes, namely those around codons 110, 210 and 520 (numbered 220, 330 and 650, respectively, in Fig. 4). The functional constraints responsible for the conservation of these regions are unknown but might be an incentive for further investigation. We also predict that these regions may be conserved in the DMP1 genes of other vertebrates. 3.3. Conclusions The DMP1 gene evolves rapidly. Sequence similarities between the caiman gene and its mammalian counterparts are found only in a few conservatively evolving segments. Nevertheless, several features are shared by the caiman and mammalian DMP1 genes. The gene organization and exon–intron boundaries are generally conserved, as is the high proportion of Ser, Asp, and Glu residues in the encoded proteins. These residues are expected to contribute to extensive phosphorylation and high acidity of the caiman DMP1 protein. The cell attachment motif Arg–Gly–Asp is absent in the caiman DMP1 protein, although it is conserved in all known mammalian sequences. There appears to be only a single DMP1 locus in the caiman.
Acknowledgements We thank Dr Hans-Peter Herrmann from the Ko¨ln Zoo, Germany, for the generous gift of fertilized caiman eggs, and Ms Jane Kraushaar for editorial assistance.
References Ausubel, F.M., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K., 1988. Current Protocols in Molecular Biology. Wiley, New York.
Carroll, R.L., 1988. Vertebrate Paleontology and Evolution. W.H. Freeman, New York. Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J., Rutter, W.J., 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18, 5294–5299. D’Souza, R.N., Cavender, A., Sunavala, G., Alvarez, J., Ohshima, T., Kulkarni, A.B., MacDougall, M., 1997. Gene expression patterns of murine dentin matrix protein 1 (Dmp1) and dentin sialophosphoprotein (DSPP) suggest distinct developmental functions in vivo. J. Bone Miner. Res. 12, 2040–2049. Ferguson, M.W.J., 1981. The value of the American alligator (Alligator mississippiensis) as a model for research in craniofacial development. J. Craniofac. Genet. Dev. Biol. 1, 123–144. Fisher, L., McBride, O., Termine, J.D., Young, M.F., 1990. Human bone sialoprotein. Deduced protein sequence and chromosomal localization. J. Biol. Chem. 265, 2347–2351. George, A., Sabsay, B., Simonian, P.A.L., Veis, A., 1993. Characterization of a novel dentin matrix acidic phosphoprotein. Implications for induction of biomineralization. J. Biol. Chem. 268, 12624–12630. Gilbert, D.G., 1995. SeqPup version 0.4j: a biosequence editor and analysis application, http://iubio.bio.indiana.edu/soft/molbio/. Gorski, J.P., 1992. Acidic phosphoproteins from bone matrix, a structural rationalization of their role in biomineralization. Calcif. Tissue Int. 50, 391–396. Hirst, K.L., Ibaraki-O’Connor, K., Young, M.F., Dixon, M.J., 1997a. Cloning and expression analysis of the bovine dentin matrix acidic phosphoprotein gene. J. Dent. Res. 76, 754–760. Hirst, K.L., Simmons, D., Feng, J., Aplin, H., Dixon, M.J., MacDougall, M., 1997b. Elucidation of the sequence and the genomic organization of the human dentin matrix acidic phosphoprotein 1 (DMP1) gene: exclusion of the locus from a causative role in the pathogenesis of dentinogenesis imperfecta type II. Genomics 42, 38–45. Li, W., 1993. Unbiased estimation of the rates of synonymous and nonsynonymous substitution. J. Mol. Evol. 36, 96–99. MacDougall, M., Gu, T.T., Luan, X., Simmons, D., Chen, J., 1998. Identification of a novel isoform of mouse dentin matrix protein 1: Spatial expression in mineralized tissues. J. Bone Miner. Res. 13, 422–431. Marshak, D.R., Carroll, D., 1991. Synthetic peptide substrates for casein kinase II. Meth. Enzymol. 200, 134–156. Miles, A.E.W., Poole, D.F.G., 1967. The history and general organization of dentitions. In: Miles, A.E.W. ( Ed.), Structural and Chemical Organization of Teeth. Academic Press, London, pp. 3–44. O’hUigin, C., Li, W.-H., 1992. The molecular clock ticks regularly in muroid rodents and hamsters. J. Mol. Evol. 35, 377–384. Oldberg, A., Franzen, A., Heinegard, D., 1986. Cloning and sequence analysis of rat bone sialprotein (osteopontin) cDNA reveals an Arg–Gly–Asp cell-binding sequence. Proc. Natl. Acad. Sci. USA 83, 8819–8823. Smith, M.M., Hall, B.K., 1990. Development and evolutionary aspects of vertebrate skeletogenic and odontogenic tissues. Biol. Rev. 65, 277–373. Toyosawa, S., O’hUigin, C., Figueroa, F., Tichy, H., Klein, J., 1998. Identification and characterization of amelogenin genes in monotremes, reptiles, and amphibians. Proc. Natl. Acad. Sci. USA 95, 13056–13061. Toyosawa, S., O’hUigin, C., Klein, J., 1999. Dentin matrix protein 1 gene of prototherian and metatherian mammals. J. Mol. Evol. 48, 160–167. Young, M.F., Kerr, J.M., Termine, J.D., Wewer, U.M., Wang, M.G., McBride, O.W., Fisher, L.W., 1990. cDNA cloning, mRNA distribution and heterogenity, chromosomal location, and RFLP analysis of human osteopontin (OPN ). Genomics 7, 491–502.
Characterization of dentin matrix protein 1 gene in crocodilia S. Toyosawa 1, C. O’hUigin *, H. Tichy, J. Klein Max-Planck-Institut fu¨r Biologie, Abteilung Immungenetik, D-72076 Tu¨bingen, Germany Received 30 October 1998; received in revised form 15 April 1999; accepted 11 May 1999; Received by W.-H. Li
Abstract Several clones containing DMP1 cDNA were isolated from a caiman tooth library by screening with a platypus DMP1 probe. The caiman DMP1 shows little amino acid sequence similarity to mammalian DMP1s for much of its length. A few highly conserved regions can, however, be identified that correspond to the slowly evolving parts of the corresponding mammalian genes. Southern blot analysis using probes comprising either conserved regions or longer segments of the gene indicates that only a single DMP1 locus exists. In coding regions, exon–intron boundaries and reading frames are shared by caiman and mammalian genes with the exception of exons 1 and 5, which are longer in the caiman. The repetitive sequence of the last exon is shared by mammals and caiman as are the high Ser content and acidity due to a high proportion of Asp and Glu residues. The conserved mammalian cell-attachment signal Arg–Gly–Asp is absent in the caiman DMP1. In contrast to the amelogenin gene, the DMP1 gene appears to evolve rapidly in vertebrates. © 1999 Elsevier Science B.V. All rights reserved. Keywords: Caiman; Mineralized tissue; Reptilian tooth
1. Introduction Bone and dentin are the principal mineralized tissues of vertebrates (Miles and Poole, 1967). Dentin is a bone-like substance with a long evolutionary history that may go back all the way to the origin of vertebrates; in fact, it is considered to be one of the distinguishing characteristics of the vertebrate subphylum (Smith and Hall, 1990). Prominent constituents of dentin and bone are acidic phosphoproteins, which have been implicated in the mineralization of these tissues (Gorski, 1992). A cDNA clone of one of the acidic phosphoproteins, dentin matrix protein 1 (DMP1), was obtained by screening a rat incisor cDNA library (George et al., 1993). From the complete DMP1 cDNA sequence, it has been deduced that the secreted protein, after removal of the 16-residue signal peptide, comprises 473 amino Abbreviations: bp, base pair(s); cDNA, complementary DNA; DMP, dentin matrix protein; kb, kilobase pair; my, million years; PCR, polymerase chain reaction; pfu, plaque-forming units; RACE, rapid amplification of cDNA ends; RT, reverse transcriptase; UTR, untranslated region(s). * Corresponding author. Tel.:+49-7071-601290; fax:+49-7071-600437. E-mail address: colm.o’[email protected] (C. O’hUigin) 1 Permanent address: Osaka University Faculty of Dentistry, Department of Oral Pathology, Osaka 565-0876, Japan.
acid residues. The acidity of the protein is inferred from the preponderance of Asp and Glu residues, its phosphoprotein nature from the presence of >100 Ser residues forming potential sites for phosphorylation by casein kinases I and II. Transcripts of the DMP1 gene were originally detected by Northern blot hybridization in odontoblasts (George et al., 1993), but were later shown by in-situ hybridization to be present also in other mineralized tissues, including bone, cementum, and enamel (D’Souza et al., 1997; MacDougall et al., 1998), as well as in fetal bovine brain (Hirst et al., 1997a). Homologs of the DMP1 gene or of its transcript have been cloned also in humans (Hirst et al., 1997b), cattle ( Hirst et al., 1997a), mouse (MacDougall et al., 1998), as well as wallaby, opossum, and platypus ( Toyosawa et al., 1999). In each of these species, the DMP1 gene is present in a single copy in the haploid genome. Zoo blot analysis suggests that a DMP1 homolog is also present in monkeys, sheep, and dog (Hirst et al., 1997a). There is evidence in humans, cattle and rat for alternative splicing of the DMP1 transcript involving the presence or absence of exon 5 (Hirst et al., 1997a,b; MacDougall et al., 1998). In terms of dental evolution, crocodilia are probably the most interesting order within the class Reptilia. Crocodilians arose from a stock of diapsid reptiles, the Archosauria, which also gave rise to dinosaurs, ptero-
0378-1119/99/$ – see front matter © 1999 Elsevier Science B.V. All rights reserved. PII: S0 3 7 8 -1 1 1 9 ( 9 9 ) 0 0 19 5 - X
308
S. Toyosawa et al. / Gene 234 (1999) 307–314
saurs, and birds (Carroll, 1988). Archosaurs diverged from other reptiles in the Triassic, producing an assemblage referred to as Thecodontia, then continued to expand throughout the Mesozoic, only to decline rapidly some 65 million years (my) ago, at the beginning of the Cenozoic. Crocodilians are the only surviving archosaurs. They can be traced back to the Middle Triassic, some 240 my ago, to the thecodont stock with which they share a number of ‘non-reptilian’ features (Ferguson, 1981). They share some of these features, with mammals, such as teeth set in sockets. Since, however, mammals evolved from a different (synapsidian) reptile branch, the similarities are presumably the result of convergent evolution. The basic crocodilian features were established in the Late Triassic some 180– 200 my ago and have persisted to this day. Their status as ‘living fossils’ as well as their relationship to birds, on the one hand, and the thecondants with mammallike characteristics, on the other hand, make crocodilians a key group in the study of tooth evolution. As part of our effort to trace the evolution of the major toothforming genes, we have, therefore, included crocodilians in our analysis. Here, we describe the identification of DMP1- encoding cDNA clones from a crocodilian representative, the caiman.
Approximately 105 clones of the caiman cDNA library were screened with a 32P-labeled platypus exon 6 DMP1 probe ( Toyosawa et al., 1999). Low-stringency screening yielded a number of positive plaques, which were then purified by repeated plating and selection with the same probe. After three rounds of plaque purification, three positive cDNA clones (dmp2, 7, and 12) were identified, and their insert sizes were determined by agarose gel electrophoresis of polymerase chain reaction (PCR) products generated using flanking lgt10 primers. The inserts were subcloned into Sma I-digested pUC18 plasmid vector by using the SureClone ligation kit (Pharmacia Biotech), and sequenced.
2. Materials and methods
2.3. Isolation of cDNA 5∞-ends by 5∞-rapid amplification of cDNA ends (RACE)
2.1. Source of DNA and RNA and preparation of cDNA library Tissue ( jaw) samples from 3-day-old smooth-fronted caiman, Paleosuchus palpebrosus, were frozen in liquid nitrogen immediately after excision and kept frozen at −70°C until their use. Genomic DNA was isolated from the tissues by phenol/chloroform extraction (Ausubel et al., 1988). The frozen tissues were homogenized to a fine powder, and total RNA was extracted (Chirgwin et al., 1979). Poly (A+) RNA was isolated, and cDNA was synthesized with the help of the mRNA purification kit (Pharmacia Biotech, Freiburg, Germany) and the
TimeSaver cDNA synthesis kits (Pharmacia Biotech), respectively. The cDNA was inserted into EcoRIdigested lgt10 vector (Stratagene, Heidelberg, Germany), and the cDNA library was in vitro-packaged with the help of the GigapackA cloning kit (Stratagene) and used to transform competent E. coli NM514 bacteria. The initial titer of the library was 1.2×106 plaqueforming units (pfu); the library was amplified once to a titer of 1.5×1011 pfu/mg. 2.2. Screening of the cDNA library
The longest clone (clone dmp7; 2 kb) isolated from the library lacked parts of the 5∞ end. To obtain a fulllength clone, a reverse transcriptase (RT )-PCR was carried out using a 5∞-RACE kit (Gibco BRL, Eggenstein, Germany). One microgram of total RNA prepared from caiman jaws was used for the first-strand cDNA synthesis with random hexamer primers. An intermediate terminal deoxynucleotidyltransferase tailing reaction was carried out prior to amplification. The first-strand cDNA products were then amplified by PCR with caiman DMP1-specific primers, DEN-52 (5∞GCTTCGGTCATACCTGCTAACAAT-3∞; sites 1055– 1032), and DEN-57 (5∞-GTCATTGCCTTCATTGG-
Table 1 Oligonucleotide primers used in the determination of exon–intron boundariesa Designation
Sequence
Specificity (exon, codon number)
Orientation
DEN-69 DEN-63 DEN-80 DEN-81 DEN-82 DEN-61 DEN-60 DEN-55
AAGTGCCACTGAGATACAGATGTATAA CTTAGAGCTGCCATCGTGAACATT GTTCACGATGGCAGCTCTAAGGAA GAGGGCAGCTAATGTCTCAGATGA GTTGATTCATCTGAGACATTAGCT TTTATGATGACTCTGCTTAATTCT GACCTCAATGGAAATGATGTTGAT ACTAGGATCTTTTCCATTTGTATC
E1, E3, E3, E4, E4, E5, E5, E6,
S A S A S A S A
a A, antisense primer; S, sense primer; E, exon; UTR, untranslated region.
5∞UTR 24–31 25–32 37–44 35–42 138–145 117–124 232–239
S. Toyosawa et al. / Gene 234 (1999) 307–314
TCTCATGTAAAAT-3∞; sites 440–411). The PCR products, denoted dmp5∞-1 and dmp5∞-2, were subcloned into SmaI-digested pUC18 plasmid vector. 2.4. DNA sequencing Sequencing was performed by the dideoxy chaintermination method using the AutoRead Sequencing Kit (Pharmacia Biotech). The reactions were processed by the Automated Laser Fluorescent (A.L.F.) Sequencer (Pharmacia Biotech). The following internal primers deduced from the caiman DMP1 sequences were used for sequencing: DEN53 (5∞-AGTCGCTCAAGGGAAGACGTCACCAG-3∞; sites 1449–1474), DEN54 (5∞-ATGCTCAAAGTATTTCCTAACAAT-3∞; sites 2465–2488) and DEN86 (5∞-GACAGCAGTCACTCTGAAGAGAGT-3∞; sites 1398–1421). To determine the exon–intron organization of the caiman DMP1 gene, primers were designed to amplify regions of the individual exon–intron boundaries (Table 1), and the genomic sequence data were compared with the cDNA sequences. 2.5. Southern blot analysis For Southern blots, 10 mg of genomic DNA were digested with restriction enzymes, and the resulting fragments were separated by electrophoresis on a 0.8% agarose gel (Gibco BRL) and transferred to a hybridization membrane (Hybond-N+, Amersham, Braunschweig, Germany) using the VacuGene blotting system (Pharmacia Biotech). The filters were incubated for 5 h in a prehybridization solution containing 1× Denhardt’s solution, 5×SSC, 0.2% SDS, and 5×106 cpm of the probe, 32P-labeled by the random priming method to a specific activity of 1×109 cpm/mg with the help of a ReadyToGo DNA labeling kit (Pharmacia Biotech). Filters were washed in 2× SSC, 0.1% SDS for 20 min at room temperature and then used to expose XAR5 films ( Kodak, Stuttgart, Germany) with intensifying screens for 3–5 days.
309
2.6. Data analysis The nucleotide and inferred protein sequences were aligned with the aid of the SeqPup (Gilbert, 1995) computer program. The evolutionary relationships were then evaluated using distances estimated by the method of Li (1993). 3. Results and discussion 3.1. Characterization of the caiman DMP1 cDNA The complete coding sequence of the caiman DMP1 mRNA was deduced from three separate overlapping cDNA clones. One of these clones (dmp7) was isolated from the lgt10 cDNA library; the other two (dmp5∞-1 and dmp5∞-2) were generated by RT-PCR. Two additional clones (dmp2, dmp12) were used to confirm the DMP1 sequence (Fig. 1). The complete caiman DMP1 coding sequence is 2821 bp long and contains an open reading frame for 657 amino acid residues beginning with the translation start site at 138 bp and 16-residue hydrophobic signal peptide (Fig. 2). Blast searches of the putative peptide revealed the highest similarity to mammalian DMP1 sequences. The stop codon at 2109 bp is followed by a 3∞ untranslated region ( UTR) of 719 bp with a putative polyadenylation signal ATTAAA at 2796 bp. Exon–intron boundaries of the caiman DMP1 gene were determined by sequencing corresponding regions of genomic DNA (Table 2). The boundaries of exons 2, 3, and 4 correspond to those reported for the mammalian DMP1 genes, whereas those of exons 1 and 5 do not, the former containing a longer 5∞ region and the latter a longer 3∞ region. All exon–intron boundaries occur in reading frame 0, a property shared by caiman and human sequences (Hirst et al. 1997b; Fig. 3). The coding region of the caiman DMP1 gene has only a low sequence similarity with the mammalian DMP1 cDNA sequences ( Fig. 4). The caiman protein sequence shows 27, 26, and 27.4% sequence similarity
Fig. 1. Cloning scheme of caiman DMP1 cDNA. The positions of initiation and stop codons are shown by arrows. Thick lines indicate the sizes and positions of PCR fragments derived from the cDNA.
310
S. Toyosawa et al. / Gene 234 (1999) 307–314
Fig. 2. Nucleotide sequence of caiman DMP1 cDNA. The coding region is displayed by codons and the deduced protein sequence is given as a one-letter amino acid code. Vertical lines indicate the positions of the exon boundaries.
311
S. Toyosawa et al. / Gene 234 (1999) 307–314 Table 2 Exon–intron organization of caiman DMP1 genesa Number
1 2 3 4 5 6
Exon size (bp)
74 48 33 357 >2199
Intron size (bp)
2000 117 2500 412 650
5∞ boundary
CAC GCT GAA GCC CAC
ACA CAC TGG CTC TCT
AAG CCC AGG AGG CTG
Sequence of exon–intron junctions Intron
3∞ boundary
gtaatgatcattgag gtaagtacgtgtttag gtaagtaattccacag gtaactattcctgcag gtaagagtacttctag
TTG GTA GTT TAT GAG
CAC CCC GAT GCA GAT
ACA AAC TCA ACA GTC
a Nucleotide sequences of exons are in upper-case letters, and nucleotide sequences of introns are in lower-case letters.
with the human, cattle, and mouse sequences, respectively. At least three regions of high sequence similarity can be identified; they encompass positions 215–225, 325–335, and 630–660 of the amino acid alignment. Additionally, the caiman DMP1 sequence shares several other features with the mammalian DMP1 sequences. Acidity is imposed on the DMP1 molecule by the high content of aspartic and glutamic acids. The protein
sequence predicted from the caiman DMP1 cDNA sequence contains 13.1% Asp and 12.02% Glu, which are values comparable to those found in the mammalian DMP1 sequences (George et al., 1993; Hirst et al., 1997a,b; MacDougall et al., 1998; Toyosawa et al., 1999). Serine is an essential residue of the sequence motif recognized by the casein kinases I and II (Marshak and Carroll, 1991) and the target of phosphorylation
Fig. 3. Comparison of the exon–intron organization of caiman, human, cattle, and mouse DMP1 genes. Boxed regions indicate exons; translated regions are indicated by hatching. Arrows indicate the positions of initiation and stop codons where known. Sizes of the caiman introns (in bp) are shown.
312
S. Toyosawa et al. / Gene 234 (1999) 307–314
Fig. 4. Amino acid alignment of mammalian and caiman DMP1 sequences. The simple majority consensus sequence is given at the top. Identity with the consensus is indicated by a dash (-); a dot (.) indicates the absence of sequence information and an asterisk (*) a gap introduced to improve the alignment.
catalyzed by these enzymes. The predicted serine content of the sequence translated from the caiman cDNA is 18.7%, which is similar to that reported for the mammalian proteins (George et al., 1993; Hirst et al., 1997a,b; MacDougall et al., 1998; Toyosawa et al., 1999). To investigate the possibility that other DMP1-like loci may exist in the caiman, we carried out a Southern blot analysis using as a probe either a near complete exon 6 or a segment encompassing part of exon 6 and
the beginning of the 3∞ UTR conserved between mammals and caiman. The results of the analysis are consistent with the presence of a single DMP1 locus in the caiman genome ( Fig. 5). A single band is found following digestion with either HindIII, TaqI, or PstI restriction endonucleases. The cell-attachment Arg–Gly–Asp ( RGD) motif is not specific for the DMP1 molecules, but is found to be present in a number of other acidic phosphoproteins
S. Toyosawa et al. / Gene 234 (1999) 307–314
313
conserved within mammals but not in the caiman sequence. We conclude that cell attachment may occur by other means, if at all, in the caiman.
3.2. Evolutionary analysis
Fig. 5. Southern blot analysis of caiman DMP1. Lanes marked H, T, and P indicate digestion of genomic DNA with HindIII, TaqI, and PstI restriction endonucleases, respectively.
such as osteopontin (Oldberg et al., 1986; Young et al., 1990), bone sialoprotein ( Fisher et al., 1990), and dentin sialophosphoprotein (MacDougall et al., 1998). The RGD sequence is strictly conserved among all the sequenced mammalian proteins and is thought to have an important biological function in mammalian DMP1 molecules. However, the RGD motif is absent in the caiman DMP1 molecule. Moreover, the segment of the mammalian protein flanking the RGD motif is also
The low degree of sequence similarity between the caiman and the mammalian DMP1 genes is in agreement with expectations derived from evolutionary analysis. In mammals, DMP1 is a rapidly evolving gene. The number of synonymous substitutions between mouse and human lineages, as measured by the method of Li (1993), is close to saturation at 0.98 substitutions per site. This substitution rate places DMP1 among the most rapidly evolving genes of the sample of 28 mouse and human genes surveyed by O’hUigin and Li (1992), including a variety of housekeeping, hormone-encoding, and cellstructure-encoding genes. This observation indicates that the underlying mutation rate at the DMP1 locus is high. The number of non-synonymous substitutions (0.199 per site) is also high compared to the genes in that survey, the average value for the 28 genes being 0.049 per site. By contrast, another gene involved in tooth formation, amelogenin, has evolved more conservatively, having accumulated 0.23 synonymous and 0.08 non-synonymous substitutions per site ( Toyosawa et al. 1998) since the divergence of the human and mouse lineages. A rapidly evolving gene may nevertheless remain recognizable over a longer divergence time if it contains regions that evolve slowly. To identify such regions, we
Fig. 6. Plot of percentage non-synonymous substitution (K %) per site against codon position in pairwise comparisons of human (H ), cattle (C ), a and mouse (M ) DMP1 sequences. A sliding window of 10 codons was used, and measurements were taken at five-codon intervals. Small alignment gaps ( less than eight residues) were ignored in the plot. Arrows point to regions conserved between mammalian and caiman sequences. The unbroken line shows the H–C comparison, the heavy dashed line H–M, and the light dashed line C–M.
314
S. Toyosawa et al. / Gene 234 (1999) 307–314
examined the dependence of nonsynonymous substitution rates on the position within the gene. A sliding window of 10 codons was used, within which the extent of non-synonymous substitutions was measured in pairwise comparisons of aligned human, mouse, and cattle coding sequences. The eutherian mammals were considered suitable since full-length cDNA sequences are available for these species and the shorter divergence time allows recognition of even moderately conserved regions. Fig. 6 shows that there are several regions that appear to undergo few non-synonymous substitutions (positions around codons 20, 110, 210, 410, 470, and 520 of the alignment of human, mouse, and cattle genes). We would expect from this analysis that only these regions would be conserved between mammalian and reptilian genes. In fact, of the slowly evolving regions, three correspond to the regions that are conserved between the caiman and mammalian genes, namely those around codons 110, 210 and 520 (numbered 220, 330 and 650, respectively, in Fig. 4). The functional constraints responsible for the conservation of these regions are unknown but might be an incentive for further investigation. We also predict that these regions may be conserved in the DMP1 genes of other vertebrates. 3.3. Conclusions The DMP1 gene evolves rapidly. Sequence similarities between the caiman gene and its mammalian counterparts are found only in a few conservatively evolving segments. Nevertheless, several features are shared by the caiman and mammalian DMP1 genes. The gene organization and exon–intron boundaries are generally conserved, as is the high proportion of Ser, Asp, and Glu residues in the encoded proteins. These residues are expected to contribute to extensive phosphorylation and high acidity of the caiman DMP1 protein. The cell attachment motif Arg–Gly–Asp is absent in the caiman DMP1 protein, although it is conserved in all known mammalian sequences. There appears to be only a single DMP1 locus in the caiman.
Acknowledgements We thank Dr Hans-Peter Herrmann from the Ko¨ln Zoo, Germany, for the generous gift of fertilized caiman eggs, and Ms Jane Kraushaar for editorial assistance.
References Ausubel, F.M., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K., 1988. Current Protocols in Molecular Biology. Wiley, New York.
Carroll, R.L., 1988. Vertebrate Paleontology and Evolution. W.H. Freeman, New York. Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J., Rutter, W.J., 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18, 5294–5299. D’Souza, R.N., Cavender, A., Sunavala, G., Alvarez, J., Ohshima, T., Kulkarni, A.B., MacDougall, M., 1997. Gene expression patterns of murine dentin matrix protein 1 (Dmp1) and dentin sialophosphoprotein (DSPP) suggest distinct developmental functions in vivo. J. Bone Miner. Res. 12, 2040–2049. Ferguson, M.W.J., 1981. The value of the American alligator (Alligator mississippiensis) as a model for research in craniofacial development. J. Craniofac. Genet. Dev. Biol. 1, 123–144. Fisher, L., McBride, O., Termine, J.D., Young, M.F., 1990. Human bone sialoprotein. Deduced protein sequence and chromosomal localization. J. Biol. Chem. 265, 2347–2351. George, A., Sabsay, B., Simonian, P.A.L., Veis, A., 1993. Characterization of a novel dentin matrix acidic phosphoprotein. Implications for induction of biomineralization. J. Biol. Chem. 268, 12624–12630. Gilbert, D.G., 1995. SeqPup version 0.4j: a biosequence editor and analysis application, http://iubio.bio.indiana.edu/soft/molbio/. Gorski, J.P., 1992. Acidic phosphoproteins from bone matrix, a structural rationalization of their role in biomineralization. Calcif. Tissue Int. 50, 391–396. Hirst, K.L., Ibaraki-O’Connor, K., Young, M.F., Dixon, M.J., 1997a. Cloning and expression analysis of the bovine dentin matrix acidic phosphoprotein gene. J. Dent. Res. 76, 754–760. Hirst, K.L., Simmons, D., Feng, J., Aplin, H., Dixon, M.J., MacDougall, M., 1997b. Elucidation of the sequence and the genomic organization of the human dentin matrix acidic phosphoprotein 1 (DMP1) gene: exclusion of the locus from a causative role in the pathogenesis of dentinogenesis imperfecta type II. Genomics 42, 38–45. Li, W., 1993. Unbiased estimation of the rates of synonymous and nonsynonymous substitution. J. Mol. Evol. 36, 96–99. MacDougall, M., Gu, T.T., Luan, X., Simmons, D., Chen, J., 1998. Identification of a novel isoform of mouse dentin matrix protein 1: Spatial expression in mineralized tissues. J. Bone Miner. Res. 13, 422–431. Marshak, D.R., Carroll, D., 1991. Synthetic peptide substrates for casein kinase II. Meth. Enzymol. 200, 134–156. Miles, A.E.W., Poole, D.F.G., 1967. The history and general organization of dentitions. In: Miles, A.E.W. ( Ed.), Structural and Chemical Organization of Teeth. Academic Press, London, pp. 3–44. O’hUigin, C., Li, W.-H., 1992. The molecular clock ticks regularly in muroid rodents and hamsters. J. Mol. Evol. 35, 377–384. Oldberg, A., Franzen, A., Heinegard, D., 1986. Cloning and sequence analysis of rat bone sialprotein (osteopontin) cDNA reveals an Arg–Gly–Asp cell-binding sequence. Proc. Natl. Acad. Sci. USA 83, 8819–8823. Smith, M.M., Hall, B.K., 1990. Development and evolutionary aspects of vertebrate skeletogenic and odontogenic tissues. Biol. Rev. 65, 277–373. Toyosawa, S., O’hUigin, C., Figueroa, F., Tichy, H., Klein, J., 1998. Identification and characterization of amelogenin genes in monotremes, reptiles, and amphibians. Proc. Natl. Acad. Sci. USA 95, 13056–13061. Toyosawa, S., O’hUigin, C., Klein, J., 1999. Dentin matrix protein 1 gene of prototherian and metatherian mammals. J. Mol. Evol. 48, 160–167. Young, M.F., Kerr, J.M., Termine, J.D., Wewer, U.M., Wang, M.G., McBride, O.W., Fisher, L.W., 1990. cDNA cloning, mRNA distribution and heterogenity, chromosomal location, and RFLP analysis of human osteopontin (OPN ). Genomics 7, 491–502.