- Email: [email protected]
Colocalization of dentin matrix protein 1 and dentin sialoprotein at late stages of rat molar development
Matrix Biology 23 (2004) 371 – 379 www.elsevier.com/locate/matbio
Colocalization of dentin matrix protein 1 and dentin sialoprotein at late stages of rat molar development Otto Babaa, Chunlin Qina,*, Jan C. Brunna, James N. Wygantb, Bradley W. McIntyreb, William T. Butlera a
Department of Endodontics and Periodontics, The University of Texas-Houston Health Science Center Dental Branch, 6516 M.D. Anderson Boulevard, DBB Rm 375, Houston, TX 77030, USA b Department of Immunology, The University of Texas MD Anderson Cancer Center at Houston, 1515 Holcombe Boulevard, Box 180, Houston, TX 77030, USA Received 12 April 2004; received in revised form 26 July 2004; accepted 26 July 2004
Abstract Dentin matrix protein 1 (DMP1) and dentin sialophosphoprotein (DSPP) are acidic proteins found in the extracellular matrices of bones and teeth. Recent data from gene knockouts, along with those of gene mutations, indicate that these two phosphoproteins are critical for bone and tooth development and/or maintenance. However, the precise functions of the two proteins have not been elucidated. In order to gain insights into their functions in tooth formation, we performed systematic, comparative investigations on the immunolocalization of DMP1 and dentin sialoprotein (DSP, a cleaved fragment of DSPP), using the rat first molar at different developmental stages as a model. Immunohistochemistry (IHC) was performed with specific, monoclonal antibodies against the COOH-terminal fragments of DMP1 and against DSP. In 1-day- and 1-week-old rats, weak immunoreactions for DMP1 were observed in dentinal tubules while stronger reactions for DSP were seen in the tubules and predentin. In rats older than 2 weeks, immunoreactions for DMP1 were found in dentinal tubules, predentin and odontoblasts. In 5-week- and 8-week-old rats, strong immunoreactions for DMP1 were widely distributed in odontoblasts and predentin. The distribution pattern of DSP was strikingly similar to that of DMP1 after 2 weeks and the localization of each was distinctly different from that of bone sialoprotein (BSP). The unique colocalization of DMP1 and DSPP in tooth development suggests that the two proteins play complementary and/or synergistic roles in formation and maintenance of healthy teeth. D 2004 Elsevier B.V./International Society of Matrix Biology. All rights reserved. Keywords: Dentin matrix protein 1; Dentin sialoprotein; Monoclonal antibody; Immunohistochemistry; Odontoblast; Dentinal tubules
1. Introduction The extracellular matrix (ECM) of bone and dentin contains a number of noncollagenous proteins (NCPs). One category of NCPs, the SIBLING (Small IntegrinBinding LIgand, N-linked Glycoprotein) family, includes bone sialoprotein (BSP), osteopontin (OPN), dentin matrix protein 1 (DMP1), dentin sialophosphoprotein (DSPP), matrix extracellular phosphoglycoprotein (MEPE) and enamelin (ENAM) (Fisher and Fedarko, 2003). Because
* Corresponding author. Tel.: +1 713 500 4583; fax: +1 713 500 0459. E-mail address: [email protected] (C. Qin).
these polyanionic SIBLING proteins are especially prominent in mineralized tissues and are secreted into the ECM during the formation and mineralization of these tissues, they probably play key biological roles in the mineralization of bone and dentin (Veis, 1993; Butler, 1998; Jain et al., 2002). DMP1, as predicted from its cDNA sequence, has unusually large numbers of acidic, phosphorylated domains, a property that would be consistent with a role in regulation of matrix mineralization (George et al., 1993). This purported biological function is supported by observations that transgenic MC3T3-E1 cells overexpressing DMP1 demonstrate higher levels of in vitro mineralization (Narayanan et al., 2001). Furthermore, recombinant DMP1 possesses calcium-binding ability under physiological con-
0945-053X/$ - see front matter D 2004 Elsevier B.V./International Society of Matrix Biology. All rights reserved. doi:10.1016/j.matbio.2004.07.008
372
O. Baba et al. / Matrix Biology 23 (2004) 371–379
ditions, suggesting that it could be a nucleator for apatite deposition in vitro (He et al., 2003). Recent findings from gene knockout mice further indicate a role for DMP1 in mineralization (Ye et al., 2004). These DMP1 deficient mice showed reduced levels of dentin along with increased predentin thickness, enlarged pulp chambers, the absence
or delayed development of third molars and downregulation of DSPP (Ye et al., 2004). The expression of DMP1 in osteocytes was elevated by mechanical stress (GluhakHeinrich et al., 2003), suggesting that this molecule may be a key factor in the maintenance of mineralized tissue homeostasis. Recent protein chemistry data indicate that
Fig. 1. Buccolingual sections of 1-day-old rat mandibular M1. (A) IHC for DMP1; (B) IHC for DSP; (C) IHC for negative control (1% fetal bovine serum in place of primary antibody); (D) ISH for DMP1 mRNA; (E) ISH for DSPP mRNA. At this stage, dentin and enamel formation has begun; thin layers of dentin (D in panel C, stained green), predentin (D in panel C, unstained) and enamel are observed (arrowhead in panel C). Immunoreactions for DMP1 are detected only in dentinal tubules (A, arrows) while positive reactions for DSP are detected in dentinal tubules (B, arrows) and predentin (B, arrowhead). No positive signals were detected in the negative control (C). Intense signals for DMP1 mRNA are detected in osteocytes (D, arrowheads), but not in odontoblasts. Clear DSPP mRNA expression is detected in odontoblasts and preameloblasts (E). Bar, 50 Am; AB, ameloblast; Alb, alveolar bone or bone surrounding tooth germ; D, dentin; OD, odontoblast.
O. Baba et al. / Matrix Biology 23 (2004) 371–379
DMP is naturally present as processed fragments in bone or dentin, namely 37 K fragments from the NH2-terminal region and 57 K fragments from the COOH-terminal region (Qin et al., 2003). The data indicate that the proteolytic processing of rat DMP1 results from cleavage at the NH2terminus of four aspartic acid residues (i.e., –X–Asp– bonds) in a manner very similar to that of DSPP (see below). Sequencing of the DSPP cDNA indicates that its transcripts encode a large protein that is proteolytically processed to form two smaller proteins: dentin phosphoprotein (DPP) and dentin sialoprotein (DSP), present as individual molecules in the ECM of dentin. DPP, the most abundant NCP in the ECM of dentin, is an important initiator and modulator for the formation and growth of hydroxyapatite (HA) crystals (Boskey et al., 1990; Saito et al., 1997). While the functions of DSP are presently undefined, sequence data from DSP tryptic peptides, along with comparison to the cDNA-deduced amino acid sequence, showed that processing involves cleavage of two –X–Asp–
373
bonds (Qin et al., 2001), similar to those identified in DMP1. The importance of DSPP in dentinogenesis is indicated by observations that mutations in the DSPP gene are associated with dentinogenesis imperfecta in humans (Xiao et al., 2001; Zhang et al., 2001) and that DSPP gene knockout mice show hypomineralization of dentin (widening of predentin, Sreenath et al., 2003), a phenotype similar to the dental manifestations in DMP1 knockout mice. Immunohistochemistry (IHC) and in situ hybridization (ISH) have been employed to study the expression of DMP1. Shortly after its discovery, expression of DMP1 by odontoblasts was reported (George et al., 1994). Later studies showed that, DMP1 transcripts were predominantly expressed in osteocytes and mature osteoblasts (Toyosawa et al., 2001; Feng et al., 2003). The majority of signals for DMP1 protein were localized in the pericellular matrix of osteocytes, including their cell processes (Toyosawa et al., 2001). A more recent study on the expression of DMP1 during the root dentin formation (Toyosawa et al., 2004), employing both IHC and ISH techniques showed gene
Fig. 2. Buccolingual sections of mandibular M1 from 1-week (A, B) and 2-week-old rats (C, D). (A and C) IHC for DMP1; (B and D) IHC for DSP. At 1 week, immunoreactions for DMP1 are observed in dentinal tubules (A, arrows). The inset shows a higher magnification view of dentinal tubules near the cusp region. Immunoreactions for DSP are detected in dentinal tubules (B, arrows), predentin (B, arrowhead) and odontoblasts (B, thin arrow) beneath the cusp. At 2 weeks (C and D), M1 had not erupted and the root dentin formation was ongoing. Immunoreactions for DMP1 are observed in odontoblasts (C, thin arrow) and predentin (C, arrowhead) beneath the cusp as well as in dentinal tubules (C, arrows). Immunostaining for DSP at 2 weeks is detected in dentinal tubules (D, arrows), predentin (D, arrowhead) and odontoblasts (D, thin arrow) in the coronal area. Bar, 50 Am in panels A and B (10 Am, inset of A); Bar, 100 Am in C and D; Alb, Alveolar bone or bone surrounding tooth germ; D, dentin; E, enamel; P, dental pulp.
374
O. Baba et al. / Matrix Biology 23 (2004) 371–379
expression and protein localization of DMP1 in cementocytes and cementum. Extensive ISH and IHC studies from our laboratory showed the expression of DSP (DSPP) in odontoblasts, preameloblasts, predentin, dentinal tubules and dental pulp (Butler et al., 1992; D’Souza et al., 1992; Ritchie et al., 1996, 1997; Be`gue-Kirn et al., 1998a,b). Recent data indicate that DSPP is also expressed in bone and cementum at a level lower than in dentin (Qin et al., 2002; Baba et al., 2004). Although their overall amino acid sequences are dissimilar, DMP1 and DSPP exhibit many similarities: both have very acidic domains that are postulated to be the calciumbinding sites and numerous phosphorylation sites that could play a role in HA formation. Both are proteolytically processed (see above) in a similar fashion and both are critical for dentin mineralization. A close relationship between the two is further supported by the observation that DSPP gene and protein are downregulated in mice lacking the DMP1 gene (Ye et al., 2004). The present investigation was performed to test for similarities in the expression of DMP1 and DSPP in tooth development. We observed striking similarities in the distribution of these two molecules at later stages in the formation of rat first molars,
suggesting that DMP1 and DSPP may play similar roles in dentinogenesis. Furthermore, the expression patterns of DMP1 and DSPP differed sharply from that of BSP.
2. Results For these investigations, we employed IHC with monoclonal antibodies raised against the COOH-terminal fragments of DMP1 and against DSP, respectively. In the following sections, we compared their expression patterns during the formation of the crown and root regions of rat first molar (M1) at various stages of development (postnatal 1-day to 8-week). ISH approaches, using RNA probes that recognize DMP1 and DSPP transcripts, were utilized to strengthen our IHC findings. 2.1. One-day-old At this stage, thin layers of enamel and dentin of rat M1 have formed in some of the cusps. Immunopositive reactions for DMP1 (Fig. 1A) were observed only in dentinal tubules of mineralized dentin matrix while signals
Fig. 3. Buccolingual sections of 5-week-old rat mandibular M1. (A) IHC for DMP1; (B) IHC for DSP; (C) IHC for BSP; (D–G) higher magnifications of panel A for coronal (D) and root dentin (E), for cellular cementum (F) and alveolar bone (G) areas; (H) ISH for DMP1 in root dentin area; (I) ISH for DSPP in root dentin area. The DMP1 and DSP distribution patterns in dentin are very similar. Thus, immunoreactions for DMP1 are strong in dentinal tubules of coronal dentin (A, arrows) but weaker in those of the root area. Intense immunoreactions for DMP1 are widely found in odontoblasts (D and E, OD) and predentin (A and D, arrowheads) in both coronal and root regions. Dental pulp (A, P) is also positive for DMP1. Cementocytes (F, arrowheads) and osteocytes (G, arrowheads) and their pericellular matrix and canaliculi (F and G, arrows) show strong DMP1 immunoreactivity. Similar to those for DMP1, DSP reactions are found in dentinal tubules (B, arrows), predentin (B, arrowhead) and dental pulp. BSP signals are detected in bone and in acellular and cellular cementum matrix (C, thin arrow) but are very weak or negative in dentin matrix. Both DMP1 (H) and DSPP (I) transcripts are detected in odontoblasts of root dentin. Bar, 200 Am in panels A–C; Bar, 20 Am in panels D–I; Alb, alveolar bone; D, dentin; OD, odontoblast; P, dental pulp.
O. Baba et al. / Matrix Biology 23 (2004) 371–379
for DSP (Fig. 1B) were detected in predentin as well as in dentinal tubules. Positive reactions for DMP1 were also observed in osteocytes and canaliculi of osteocyte processes in the bone matrix surrounding the tooth germ (data not shown). Reactions for BSP were observed in bone matrix, but not in odontoblasts and dentin matrix (data not shown). No positive reactions were found in control sections (Fig. 1C) where the primary antibodies were omitted. ISH detected intense reactions for DMP1 transcripts (Fig. 1D) in osteocytes and very weak signals in odontoblasts, whereas high levels of DSPP transcripts (Fig. 1E) were detected in preameloblasts and odontoblasts.
375
odontoblasts beneath the cusp as well as in dentinal tubules and predentin. 2.3. Two-week-old At this stage, M1 has started to form root dentin but has not erupted. Positive reactions for DMP1 (Fig. 2C) were observed in dentinal tubules, predentin and odontoblasts beneath the cusps. The reactions for DSP (Fig. 2D) in dentinal tubules and odontoblasts were similar to those for DMP1. 2.4. Three-week-old
2.2. One-week-old The enamel and dentin of rat M1 have thickened. Clear immunoreactions for DMP1 (Fig. 2A) were observed in dentinal tubules in the coronal matrix beneath the cusps. Immunoreactions for DSP (Fig. 2B) were observed in
At 3 weeks, M1 had erupted and cellular cementum formation had begun. The expression pattern for DMP1 and DSP in M1 were similar (data not shown). Both molecules were observed in dentinal tubules, predentin, odontoblasts and cementocytes including their processes.
Fig. 4. Buccolingual sections of 8-week-old rat mandibular M1. (A) IHC for DMP1; (B) IHC for DSP; (C and E) higher magnifications of coronal (C) and root (E) dentin area from panel A; (D and F) higher magnifications of coronal (D) and root (F) dentin area from panel B. DMP1 and DSPP are colocalized well in dentin and cellular cementum. Immunoreactions for both molecules are intense in coronal dentinal tubules (A and B, arrows) and odontoblasts of root dentin (A, B, E and F, arrowheads), but are weaker in coronal odontoblasts (C and D, OD), predentin (C and D, arrows) and dentinal tubules in root dentin (E and F, arrows). Bar, 200 Am in panels A and B; Bar, 20 Am in panels C–F; CC, cellular cementum; D, dentin; OD, odontoblast; P, dental pulp.
376
O. Baba et al. / Matrix Biology 23 (2004) 371–379
2.5. Five-week-old At 5 weeks, immunoreactions for DMP1 in coronal dentinal tubules reached the highest level while its signals in root dentin were comparatively weak (Fig. 3A). Moreover, positive reactions were found in the dental pulp of coronal part and the upper half of the root area (Fig. 3A). Interestingly, intensive reactions in odontoblasts were widely observed in both coronal and root dentin areas (Fig. 3A, D and E). Immunoreactions for DMP1 were also clearly observed in cementocytes and along their processes (Fig. 3A and F). The immunoreactions for DSP (Fig. 3B) in the coronal dentin and cementum were similar to those for DMP1. For BSP, very weak or no immunoreactions were detected in odontoblasts and dentin (Fig. 3C), although there was a high level of positive reactions in bone, acellular and cellular cementum in which this protein was evenly distributed. It should be noted that the immunoreactions for DMP1 in osteocytes were observed throughout the developmental period that we studied (i.e., from postnatal 1-day to 8-week). In fact, bone DMP1 predominated in the pericellular regions of osteocytes and along their processes (Fig. 3G). ISH demonstrated clearly similar expression patterns of transcripts for DMP1 (Fig. 3H) and DSPP (Fig. 3I) in odontoblasts in the root area. 2.6. Eight-week-old At 8 weeks, intense signals for DMP1 were observed in odontoblasts in root dentin while the reactions in predentin of the coronal area were relatively weak (Fig. 4A, C and E). Immunoreactions for DSP (Fig. 4B, D and F) were very similar to those for DMP1. In summary, using IHC, we observed DMP1 and DSP in dentinal tubules of all the stages of rat molar development. In predentin, immunoreactions for DMP1 were detected after 2 weeks, while those for DSP were detected throughout the experimental period. Positive reactions in odontoblasts were detected after 2 weeks for DMP1 and after 1 week for DSP. In general, immunopositive reactions for DMP1 showed a tendency of growing stronger with the increase of development time, up to 5 weeks. After the age of 5 weeks, the distribution patterns of DMP1 and DSP in dental tubules, predentin, odontoblasts and cellular cementum were very similar. Very weak or no reactions for BSP were detected in odontoblasts and dentin matrix.
3. Discussion The observed similarities between DMP1 and DSPP have led us to postulate that the two molecules might function in a complementary and/or synergistic manner during tooth formation. In order to test part of this hypothesis, we performed a systematic, developmental
study comparing the expression and extracellular presence of DMP1 and DSP during dentinogenesis in the crowns and roots of rat first molars. For detection of DMP1, we used monoclonal antibodies produced with the native form of DMP1 COOH-terminal fragments as the antigen. For that of DSP, we used monoclonal antibodies that were generated earlier (Baba et al., 2004). In 1-day- and 1-week-old rats, immunoreactions for DMP1 were observed in dentinal tubules of mineralized dentin but not in predentin or odontoblasts (Fig. 1A). This accentuated distribution pattern is probably due to a higher level of accumulation of DMP1 (or its processed COOHterminal fragments) within tubules versus predentin and odontoblasts. This conclusion is consistent with our observation that, throughout the observed period, immunoreactions for DMP1 were stronger in tubules than in other areas of the tooth. After 2 weeks, immunoreactions for DMP1 became stronger with the increase of development time and were consistently observed in dentinal tubules, predentin and odontoblasts. These findings suggest that DMP1 may play a more important role at later stages of tooth development, a conclusion consistent with phenotypic changes in DMP1 knockout mice that showed significant skeletal abnormalities only after the age of 3 weeks (Ye et al., 2004). DSP was consistently localized in dentinal tubules, predentin and odontoblasts, at earlier as well as later stages of molar development. At later stages of development (i.e., after 3-weeks), DSP and DMP1 were colocalized, suggesting that the two proteins may be working in concert. A striking observation in support of this postulation is the presence of intense immunoreactions observed for both DMP1 and DSP in the crown dentinal tubules of 5- and 8-week-old rats (Figs. 3A, B and 4A, B). Furthermore, the pattern of reactions for DMP1 and DSP contrasts with that for BSP (Fig. 3C and Hosoya et al., 2003) and OPN (Hosoya et al., 2003), both of which were evenly and abundantly distributed in bone matrix but were absent or weakly positive in dentin. The strong and consistent immunoreactions for DMP1 in osteocytes, cementocytes, matrices (canaliculi) surrounding their processes (Fig. 3F and G, and Toyosawa et al., 2001, 2004), along with its localization in odontoblasts and dentinal tubules, suggest that DMP1 may be involved in the maintenance of the mineralized tissue microenvironment. Gluhak-Heinrich et al. (2003) reported that expression of DMP1 transcripts and secretion of protein were upregulated by mechanical stress. Our results showed intense immunoreactions in dentinal tubules in coronal regions at later stages (Figs. 3A and 4A) after molar eruption, where the mechanical stress from early occlusal forces would occur. Thus, one function of DMP1 and/or DSPP may involve a response to the mechanical stress by osteocytes, cementocytes, odontoblasts and their processes. In summary, using IHC and ISH techniques, we analyzed and compared the expression of DMP1, DSP (DSPP) and
O. Baba et al. / Matrix Biology 23 (2004) 371–379
BSP in the sequential stages of rat molar development. Our newly generated monoclonal antibodies have allowed us to clearly detect DMP1, leading to a better understanding of its distribution patterns in developing dentin and odontoblasts. Thus, DMP1 occurs mainly in dentinal tubules and mature odontoblasts at later stages of tooth development. The distribution pattern of DMP1 at later stages is coincident with that of DSP in dentinal tubules, odontoblasts and predentin, and this distribution is very different from that of BSP. These similar distribution patterns indicate that DMP1 and DSPP may function in a complementary and/or synergistic fashion in the developmental formation and the microenvironment maintenance of teeth.
4. Experimental procedures 4.1. Tissue preparation One-day-, 1-, 2-, 3-, 5- and 8-week-old Sprague–Dawley rats (Harlan, Indianapolis, IN, USA) were perfused with 4% paraformaldehyde in 0.1 M phosphate-buffer (pH 7.4). Mandibles were dissected and further fixed in the same fixative for 2 days at 4 8C followed by decalcification in 8% EDTA (pH 7.4) at 4 8C for 3 to 5 weeks. Tissues were processed to paraffin embedding and buccolingual serial sections (5 Am) were prepared for IHC and ISH. All animal experiments were approved by the Animal Welfare Committee of University of Texas at Houston Health Science Center. 4.2. Antibodies Monoclonal antibodies against DMP1 were produced using the 57 kDa fragments (Qin et al., 2003) as the antigen and employing techniques described previously for the generation of monoclonal antibodies against DSP (Baba et al., 2004). Briefly, 57 kDa fragments isolated from rat bone were injected into BALB/c mice. Lymphocytes were fused with P3 myeloma cells. Fusion cells showing positive reactions to 57 kDa fragments were detected by ELISA and cloned. Totally, we obtained 20 positive clones. In the present study, clone 8G10.3 was used because it showed intense reactions in IHC. The immunospecificity of clone 8G10.3 was first confirmed by dotblots using highly pure 57 kDa fragments as the antigen and was then further proven by our observation that the culture medium of this clone completely lost its immunoreactivity to DMP1 in IHC experiments after it had been preincubated with purified 57 kDa fragments. Furthermore, the immunolocalization pattern of DMP1 when clone 8G10.3 was used, was very similar to that when the antisera (a gift from Dr. Lynda Bonewald, University of Missouri at Kansas City, MO, USA) raised against a synthetic peptide matching amino acid sequences of rat DMP1 COOH-terminal region were applied (data not shown). Based on the above findings, as
377
well as the fact that purified DMP1 fragments (57 kDa) were used as the antigen, we concluded that this monoclonal antibody is specific to DMP1, although it did not recognize DMP1 fragments on Western immunoblots. In this investigation, the expanded cultured medium of clone 8G10.3 was used at a dilution of 1:50. Monoclonal antibody for DSP (Baba et al., 2004) and antiserum against BSP (LF-87) were utilized at dilutions of 1:1000 and 1:200, respectively. For BSP, we only performed IHC in 1-day- and 5-week-old rats. 4.3. Immunohistochemistry (IHC) IHC was performed as previously described (Baba et al., 2004). Briefly, paraffin sections were treated with 0.3% H2O2 in methanol solution followed by treatment of hyaluronidase for 1 h at 37 8C. Then, sections were incubated with 2% bovine serum albumin and 10% normal goat serum to avoid nonspecific immunoreactions. Primary antibodies diluted in phosphate buffered saline (PBS) containing 10% NGS were applied for 24 h at 4 8C. Biotinylated horse anti-mouse IgG (1:100, Vector, for DMP1 and DSP) and goat anti-rabbit IgG (1:400, Vector, for BSP) were used as the secondary antibody. Finally, sections were treated with ABC kit (Vector), and immunopositive loci were detected by incubation with 3,3V-diaminobenzidine tetrahydrochloride (DAB, Vector) solution. Sections were counterstained with methyl green solution. 4.4. Probes for in situ hybridization (ISH) We generated 373-bp rat RNA probes corresponding to the coding regions in exons 2, 3, 4, 5 and 6 of dmp1 (Thotakura et al., 2000) using the same method as previously described for the generation of DSPP RNA probes (Baba et al., 2004). Briefly, a primer set, 5V–gtgctctccctgtcgccaga–3V for forward and 5V–gtgtctgccgagtcctcgtca–3V for reverse, (Seqwright, Houston, TX, USA) was employed to generate cDNA inserts using PCR with total RNA extracted from molars of 5-dayold rat as the template. Next, the PCR products were cloned into the pCRII-TOPO vector (Invitrogen Life Technologies, Carlsbad, CA, USA) and transformed into competent Escherichia coli. The plasmid DNA was isolated from E. coli and sequenced. Digoxigenin-labeled single-stranded antisense and sense probes were generated using Sp6 and T7 RNA polymerases (Roche Diagnostics, Indianapolis, IN, USA), respectively, using a DIG RNA Labeling Kit (Roche). 4.5. In situ hybridization (ISH) ISH was performed as previously described (Baba et al., 2004). Briefly, the paraffin sections were treated with proteinase K followed by postfixation in 4% paraformaldehyde and acetylation in 0.1 M triethanolamine containing
378
O. Baba et al. / Matrix Biology 23 (2004) 371–379
0.5% acetic anhydride. Hybridization was performed at 52 8C for DMP1 and at 49 8C for DSPP, using either the denatured antisense or the sense probes for 20 h. After posthybridization treatments, the sections were reacted with antidigoxigenin antibody conjugated with alkaline phosphatase (Roche). The locus of hybridization was demonstrated by treating sections with 5-bromo-4-chloro-3-indolylphosphate and nitroblue tetrazolium solution according to the manufacturer’s instruction (Roche). Sections were counterstained with methyl green solution.
Acknowledgements We thank Dr. Larry W. Fisher (National Institute of Dental Research, National Institutes of Health, Bethesda, MD, USA) for supplying LF-87, anti-BSP antibody. We thank Dr. Satoru Toyosawa (Depertment of Oral Pathology, Osaka University Graduate school of Dentistry, Osaka, Japan) for his valuable comments on DMP1 expression. We thank Dr. Lynda Bonewald (University of Missouri at Kansas City, MO, USA) for providing us the antisera against DMP1. We thank Ms. Gillian Rittman and Ms. Verna Hubbard for excellent work in preparing tissue sections. This work was supported by NIH/NIDCR Grant DE05092 to WTB.
References Baba, O., Qin, C., Brunn, J.C., Jones, J.E., Wygant, J.N., McIntyre, B.W., Butler, W.T., 2004. Detection of dentin sialoprotein in periodontium. Eur. J. Oral Sci. 112, 163 – 170. Be`gue-Kirn, C., Ruch, J.-V., Ridall, A.L., Butler, W.T., 1998. Comparative analysis of mouse DSP and DPP expression in odontoblasts, preameloblasts, and experimentally induced odontoblast-like cells. Eur. J. Oral Sci. 106, 254 – 259. Be`gue-Kirn, C., Krebsbach, P.H., Bartlett, J.D., Butler, W.T., 1998. Dentin sialoprotein, dentin phosphoprotein, enamelysin and ameloblastin: tooth-specific molecules that are distinctively expressed during murine dental differentiation. Eur. J. Oral Sci. 106, 963 – 970. Boskey, A.L., Maresca, M., Doty, S., Sabsay, B., Veis, A., 1990. Concentration-dependent effects of dentin phosphophoryn in the regulation of in vitro hydroxyapatite formation and growth. Bone Miner. 11, 55 – 65. Butler, W.T., 1998. Dentin matrix proteins. Eur. J. Oral Sci. 106, 204 – 210. (Suppl.). Butler, W.T., Bhown, M., Brunn, J.C., D’Souza, R.N., Farach-Carson, M.C., Happonen, R.-P., Schrohenloher, R.E., Seyer, J.M., Somerman, M.J., Foster, R.A., Tomana, M., van Dijk, S., 1992. Isolation, characterization and immunolocalization of a 53-kDal Dentin Sialoprotein (DSP). Matrix 12, 343 – 351. D’Souza, R.N., Bronckers, A.L.J.J., Happonen, R.-P., Doga, D.A., FarachCarson, M.C., Butler, W.T., 1992. Developmental expression of a 53 kD dentin sialoprotein in rat tooth organs. J. Histochem. Cytochem. 40, 359 – 366. Feng, J.Q., Huang, H., Lu, Y., Ye, L., Xie, Y., Tsutsui, T.W., Kunieda, T., Castranio, T., Scott, G., Bonewald, L.B., Mishina, Y., 2003. The dentin matrix protein 1 (DMP1) is specifically expressed in mineralized, but not soft, tissues during development. J. Dent. Res. 82, 776 – 780.
Fisher, L.W., Fedarko, N.S., 2003. Six genes expressed in bones and teeth encode the current members of the SIBLING family of proteins. Connect. Tissue Res. 44 (Suppl. 1), 33 – 40. George, A., Sabsay, B., Simonian, P.A., Veis, A., 1993. Chracterization of a novel dentin matrix acidic phosphoprotein. J. Biol. Chem. 268, 12624 – 12630. George, A., Gui, J., Jenkins, N.A., Gilbert, D.J., Copeland, N.G., Veis, A., 1994. In situ localization and chromosomal mapping of the AG1 (DMP1) gene. J. Histochem. Cytochem. 42, 1527 – 1531. Gluhak-Heinrich, J., Ye, L., Bonewald, L.F., Feng, J.Q., MacDougall, M., Harris, S.E., Pavlin, D., 2003. Mechanical loading stimulates dentin matrix protein 1 (DMP1) expression in osteocytes in vivo. J. Bone Miner. Res. 18, 807 – 817. He, G., Dahl, Y., Veis, A., George, A., 2003. Dentin matrix protein 1 initiates hydroxyapatite formation in vitro. Connect. Tissue Res. 44 (Suppl. 1), 240 – 245. Hosoya, A., Yoshida, K., Yoshiba, N., Hoshi, K., Iwaku, M., Ozawa, H., 2003. An immunohistochemical study on hard tissue formation in a subcutaneously transplanted rat molar. Histochem. Cell Biol. 119, 27 – 35. Jain, A., Karadag, A., Fohr, B., Fisher, L.W., Fedarko, N.S., 2002. Three SIBLINGs (small integrin-binding ligand, N-linked glycoproteins) enhance factor H’s cofactor activity enabling MCP-like cellular evasion of complement-mediated attack. J. Biol. Chem. 277, 13700 – 13708. Narayanan, K., Srinivas, R., Ramachandran, A., Hao, J., Quinn, B., George, A., 2001. Differentiation of embryonic mesenchymal cells to odontoblast-like cells by overexpression of dentin matrix protein 1. Proc. Natl. Acad. Sci. U. S. A. 98, 4516 – 4521. Qin, C., Cook, R.G., Orkiszewski, R.S., Butler, W.T., 2001. Identification and characterization of the carboxyl-terminal region of rat dentin sialoprotein. J. Biol. Chem. 276, 904 – 909. Qin, C., Brunn, J.C., Cadena, E., Ridall, A., Tsujigiwa, H., Nagatsuka, H., Nagai, N., Butler, W.T., 2002. The expression of dentin sialoprotein gene in bone. J. Dent. Res. 81, 392 – 394. Qin, C., Brunn, J.C., Cook, R.G., Orkiszewski, R.S., Malone, J.P., Veis, A., Butler, W.T., 2003. Evidence for the proteolytic processing of dentin matrix protein 1. J. Biol. Chem. 278, 34700 – 34708. Ritchie, H.H., Shigeyama, Y., Somerman, M.J., Butler, W.T., 1996. Partial cDNA sequencing of mouse dentine sialoprotein and detection of its specific expression by odontoblasts. Arch. Oral Biol. 41, 571 – 575. Ritchie, H.H., Berry, J.E., Somerman, M.J., Hanks, C.T., Bronckers, A.L.J.J., Hotton, D., Papagerakis, P., Berdal, A., Butler, W.T., 1997. Dentin sialoprotein (DSP) transcripts: developmentally sustained expression in odontoblasts and transient expression in ameloblasts. Eur. J. Oral Sci. 105, 405 – 413. Saito, T., Arsenault, A.L., Yamauchi, M., Kuboki, Y., Crenshaw, M.A., 1997. Mineral induction by immobilized phosphoproteins. Bone 21, 305 – 311. Sreenath, T., Thyagarajan, T., Hall, B., Longenecker, G., D’Souza, R., Hong, S., Wright, J.T., MacDougall, M., Sauk, J., Kulkarni, A.B., 2003. Dentin sialophosphoprotein knockout mouse teeth display widened predentin zone and develop defective dentin mineralization similar to human dentinogenesis imperfecta type III. J. Biol. Chem. 278, 24874 – 24880. Thotakura, S.R., Karthikeyan, N., Smith, T., Liu, K., George, A., 2000. Cloning and characterization of rat dentin matrix protein 1 (DMP1) gene and its 5V-upstream region. J. Biol. Chem. 268, 10272 – 10277. Toyosawa, S., Shintani, S., Fujisawa, T., Ooshima, T., Sato, A., Ijuin, N., Komori, T., 2001. Dentin matrix protein 1 is predominantly expressed in chicken and rat osteocytes but not in osteoblasts. J. Bone Miner. Res. 16, 2017 – 2026. Toyosawa, S., Okabayashi, K., Komori, T., Ijuhin, N., 2004. mRNA expression and protein localization of dentin matrix protein 1 during dental root formation. Bone 34, 124 – 133. Veis, A., 1993. Mineral–matrix interactions in bone and dentin. J. Bone Miner. Res. 8 (Suppl. 2), S493 – S497.
O. Baba et al. / Matrix Biology 23 (2004) 371–379 Xiao, S., Yu, C., Chou, X., Chou, X., Yuan, W., Wang, Y., Bu, L., Fu, G., Qian, M., Yang, J., Shi, Y., Hu, L., Han, B., Wang, Z., Huang, W., Liu, J., Chen, Z., Zhao, G., Kong, X., 2001. Dentinogenesis imperfecta 1 with or without progressive hearing loss is associated with distinct mutations in DSPP. Nat. Genet. 27, 201 – 204. Ye, L., MacDougall, M., Zhang, S., Xie, Y., Zhang, J., Li, Z., Lu, Y., Mishina, Y., Feng, J.Q., 2004. Deletion of dentin matrix
379
protein-1 leads to a partial failure of maturation of predentin into dentin, hypomineralization and expanded cavities of pulp and root canal during postnatal tooth development. J. Biol. Chem. 279, 19141 – 19148. Zhang, X., Zhao, J., Li, C., Gao, S., Qiu, C., Liu, P., Wu, G., Qiang, B., Lo, W.H.Y., Shen, Y., 2001. DSPP mutation in dentinogenesis imperfecta Shields type II. Nat. Genet. 27, 151 – 152.
Colocalization of dentin matrix protein 1 and dentin sialoprotein at late stages of rat molar development Otto Babaa, Chunlin Qina,*, Jan C. Brunna, James N. Wygantb, Bradley W. McIntyreb, William T. Butlera a
Department of Endodontics and Periodontics, The University of Texas-Houston Health Science Center Dental Branch, 6516 M.D. Anderson Boulevard, DBB Rm 375, Houston, TX 77030, USA b Department of Immunology, The University of Texas MD Anderson Cancer Center at Houston, 1515 Holcombe Boulevard, Box 180, Houston, TX 77030, USA Received 12 April 2004; received in revised form 26 July 2004; accepted 26 July 2004
Abstract Dentin matrix protein 1 (DMP1) and dentin sialophosphoprotein (DSPP) are acidic proteins found in the extracellular matrices of bones and teeth. Recent data from gene knockouts, along with those of gene mutations, indicate that these two phosphoproteins are critical for bone and tooth development and/or maintenance. However, the precise functions of the two proteins have not been elucidated. In order to gain insights into their functions in tooth formation, we performed systematic, comparative investigations on the immunolocalization of DMP1 and dentin sialoprotein (DSP, a cleaved fragment of DSPP), using the rat first molar at different developmental stages as a model. Immunohistochemistry (IHC) was performed with specific, monoclonal antibodies against the COOH-terminal fragments of DMP1 and against DSP. In 1-day- and 1-week-old rats, weak immunoreactions for DMP1 were observed in dentinal tubules while stronger reactions for DSP were seen in the tubules and predentin. In rats older than 2 weeks, immunoreactions for DMP1 were found in dentinal tubules, predentin and odontoblasts. In 5-week- and 8-week-old rats, strong immunoreactions for DMP1 were widely distributed in odontoblasts and predentin. The distribution pattern of DSP was strikingly similar to that of DMP1 after 2 weeks and the localization of each was distinctly different from that of bone sialoprotein (BSP). The unique colocalization of DMP1 and DSPP in tooth development suggests that the two proteins play complementary and/or synergistic roles in formation and maintenance of healthy teeth. D 2004 Elsevier B.V./International Society of Matrix Biology. All rights reserved. Keywords: Dentin matrix protein 1; Dentin sialoprotein; Monoclonal antibody; Immunohistochemistry; Odontoblast; Dentinal tubules
1. Introduction The extracellular matrix (ECM) of bone and dentin contains a number of noncollagenous proteins (NCPs). One category of NCPs, the SIBLING (Small IntegrinBinding LIgand, N-linked Glycoprotein) family, includes bone sialoprotein (BSP), osteopontin (OPN), dentin matrix protein 1 (DMP1), dentin sialophosphoprotein (DSPP), matrix extracellular phosphoglycoprotein (MEPE) and enamelin (ENAM) (Fisher and Fedarko, 2003). Because
* Corresponding author. Tel.: +1 713 500 4583; fax: +1 713 500 0459. E-mail address: [email protected] (C. Qin).
these polyanionic SIBLING proteins are especially prominent in mineralized tissues and are secreted into the ECM during the formation and mineralization of these tissues, they probably play key biological roles in the mineralization of bone and dentin (Veis, 1993; Butler, 1998; Jain et al., 2002). DMP1, as predicted from its cDNA sequence, has unusually large numbers of acidic, phosphorylated domains, a property that would be consistent with a role in regulation of matrix mineralization (George et al., 1993). This purported biological function is supported by observations that transgenic MC3T3-E1 cells overexpressing DMP1 demonstrate higher levels of in vitro mineralization (Narayanan et al., 2001). Furthermore, recombinant DMP1 possesses calcium-binding ability under physiological con-
0945-053X/$ - see front matter D 2004 Elsevier B.V./International Society of Matrix Biology. All rights reserved. doi:10.1016/j.matbio.2004.07.008
372
O. Baba et al. / Matrix Biology 23 (2004) 371–379
ditions, suggesting that it could be a nucleator for apatite deposition in vitro (He et al., 2003). Recent findings from gene knockout mice further indicate a role for DMP1 in mineralization (Ye et al., 2004). These DMP1 deficient mice showed reduced levels of dentin along with increased predentin thickness, enlarged pulp chambers, the absence
or delayed development of third molars and downregulation of DSPP (Ye et al., 2004). The expression of DMP1 in osteocytes was elevated by mechanical stress (GluhakHeinrich et al., 2003), suggesting that this molecule may be a key factor in the maintenance of mineralized tissue homeostasis. Recent protein chemistry data indicate that
Fig. 1. Buccolingual sections of 1-day-old rat mandibular M1. (A) IHC for DMP1; (B) IHC for DSP; (C) IHC for negative control (1% fetal bovine serum in place of primary antibody); (D) ISH for DMP1 mRNA; (E) ISH for DSPP mRNA. At this stage, dentin and enamel formation has begun; thin layers of dentin (D in panel C, stained green), predentin (D in panel C, unstained) and enamel are observed (arrowhead in panel C). Immunoreactions for DMP1 are detected only in dentinal tubules (A, arrows) while positive reactions for DSP are detected in dentinal tubules (B, arrows) and predentin (B, arrowhead). No positive signals were detected in the negative control (C). Intense signals for DMP1 mRNA are detected in osteocytes (D, arrowheads), but not in odontoblasts. Clear DSPP mRNA expression is detected in odontoblasts and preameloblasts (E). Bar, 50 Am; AB, ameloblast; Alb, alveolar bone or bone surrounding tooth germ; D, dentin; OD, odontoblast.
O. Baba et al. / Matrix Biology 23 (2004) 371–379
DMP is naturally present as processed fragments in bone or dentin, namely 37 K fragments from the NH2-terminal region and 57 K fragments from the COOH-terminal region (Qin et al., 2003). The data indicate that the proteolytic processing of rat DMP1 results from cleavage at the NH2terminus of four aspartic acid residues (i.e., –X–Asp– bonds) in a manner very similar to that of DSPP (see below). Sequencing of the DSPP cDNA indicates that its transcripts encode a large protein that is proteolytically processed to form two smaller proteins: dentin phosphoprotein (DPP) and dentin sialoprotein (DSP), present as individual molecules in the ECM of dentin. DPP, the most abundant NCP in the ECM of dentin, is an important initiator and modulator for the formation and growth of hydroxyapatite (HA) crystals (Boskey et al., 1990; Saito et al., 1997). While the functions of DSP are presently undefined, sequence data from DSP tryptic peptides, along with comparison to the cDNA-deduced amino acid sequence, showed that processing involves cleavage of two –X–Asp–
373
bonds (Qin et al., 2001), similar to those identified in DMP1. The importance of DSPP in dentinogenesis is indicated by observations that mutations in the DSPP gene are associated with dentinogenesis imperfecta in humans (Xiao et al., 2001; Zhang et al., 2001) and that DSPP gene knockout mice show hypomineralization of dentin (widening of predentin, Sreenath et al., 2003), a phenotype similar to the dental manifestations in DMP1 knockout mice. Immunohistochemistry (IHC) and in situ hybridization (ISH) have been employed to study the expression of DMP1. Shortly after its discovery, expression of DMP1 by odontoblasts was reported (George et al., 1994). Later studies showed that, DMP1 transcripts were predominantly expressed in osteocytes and mature osteoblasts (Toyosawa et al., 2001; Feng et al., 2003). The majority of signals for DMP1 protein were localized in the pericellular matrix of osteocytes, including their cell processes (Toyosawa et al., 2001). A more recent study on the expression of DMP1 during the root dentin formation (Toyosawa et al., 2004), employing both IHC and ISH techniques showed gene
Fig. 2. Buccolingual sections of mandibular M1 from 1-week (A, B) and 2-week-old rats (C, D). (A and C) IHC for DMP1; (B and D) IHC for DSP. At 1 week, immunoreactions for DMP1 are observed in dentinal tubules (A, arrows). The inset shows a higher magnification view of dentinal tubules near the cusp region. Immunoreactions for DSP are detected in dentinal tubules (B, arrows), predentin (B, arrowhead) and odontoblasts (B, thin arrow) beneath the cusp. At 2 weeks (C and D), M1 had not erupted and the root dentin formation was ongoing. Immunoreactions for DMP1 are observed in odontoblasts (C, thin arrow) and predentin (C, arrowhead) beneath the cusp as well as in dentinal tubules (C, arrows). Immunostaining for DSP at 2 weeks is detected in dentinal tubules (D, arrows), predentin (D, arrowhead) and odontoblasts (D, thin arrow) in the coronal area. Bar, 50 Am in panels A and B (10 Am, inset of A); Bar, 100 Am in C and D; Alb, Alveolar bone or bone surrounding tooth germ; D, dentin; E, enamel; P, dental pulp.
374
O. Baba et al. / Matrix Biology 23 (2004) 371–379
expression and protein localization of DMP1 in cementocytes and cementum. Extensive ISH and IHC studies from our laboratory showed the expression of DSP (DSPP) in odontoblasts, preameloblasts, predentin, dentinal tubules and dental pulp (Butler et al., 1992; D’Souza et al., 1992; Ritchie et al., 1996, 1997; Be`gue-Kirn et al., 1998a,b). Recent data indicate that DSPP is also expressed in bone and cementum at a level lower than in dentin (Qin et al., 2002; Baba et al., 2004). Although their overall amino acid sequences are dissimilar, DMP1 and DSPP exhibit many similarities: both have very acidic domains that are postulated to be the calciumbinding sites and numerous phosphorylation sites that could play a role in HA formation. Both are proteolytically processed (see above) in a similar fashion and both are critical for dentin mineralization. A close relationship between the two is further supported by the observation that DSPP gene and protein are downregulated in mice lacking the DMP1 gene (Ye et al., 2004). The present investigation was performed to test for similarities in the expression of DMP1 and DSPP in tooth development. We observed striking similarities in the distribution of these two molecules at later stages in the formation of rat first molars,
suggesting that DMP1 and DSPP may play similar roles in dentinogenesis. Furthermore, the expression patterns of DMP1 and DSPP differed sharply from that of BSP.
2. Results For these investigations, we employed IHC with monoclonal antibodies raised against the COOH-terminal fragments of DMP1 and against DSP, respectively. In the following sections, we compared their expression patterns during the formation of the crown and root regions of rat first molar (M1) at various stages of development (postnatal 1-day to 8-week). ISH approaches, using RNA probes that recognize DMP1 and DSPP transcripts, were utilized to strengthen our IHC findings. 2.1. One-day-old At this stage, thin layers of enamel and dentin of rat M1 have formed in some of the cusps. Immunopositive reactions for DMP1 (Fig. 1A) were observed only in dentinal tubules of mineralized dentin matrix while signals
Fig. 3. Buccolingual sections of 5-week-old rat mandibular M1. (A) IHC for DMP1; (B) IHC for DSP; (C) IHC for BSP; (D–G) higher magnifications of panel A for coronal (D) and root dentin (E), for cellular cementum (F) and alveolar bone (G) areas; (H) ISH for DMP1 in root dentin area; (I) ISH for DSPP in root dentin area. The DMP1 and DSP distribution patterns in dentin are very similar. Thus, immunoreactions for DMP1 are strong in dentinal tubules of coronal dentin (A, arrows) but weaker in those of the root area. Intense immunoreactions for DMP1 are widely found in odontoblasts (D and E, OD) and predentin (A and D, arrowheads) in both coronal and root regions. Dental pulp (A, P) is also positive for DMP1. Cementocytes (F, arrowheads) and osteocytes (G, arrowheads) and their pericellular matrix and canaliculi (F and G, arrows) show strong DMP1 immunoreactivity. Similar to those for DMP1, DSP reactions are found in dentinal tubules (B, arrows), predentin (B, arrowhead) and dental pulp. BSP signals are detected in bone and in acellular and cellular cementum matrix (C, thin arrow) but are very weak or negative in dentin matrix. Both DMP1 (H) and DSPP (I) transcripts are detected in odontoblasts of root dentin. Bar, 200 Am in panels A–C; Bar, 20 Am in panels D–I; Alb, alveolar bone; D, dentin; OD, odontoblast; P, dental pulp.
O. Baba et al. / Matrix Biology 23 (2004) 371–379
for DSP (Fig. 1B) were detected in predentin as well as in dentinal tubules. Positive reactions for DMP1 were also observed in osteocytes and canaliculi of osteocyte processes in the bone matrix surrounding the tooth germ (data not shown). Reactions for BSP were observed in bone matrix, but not in odontoblasts and dentin matrix (data not shown). No positive reactions were found in control sections (Fig. 1C) where the primary antibodies were omitted. ISH detected intense reactions for DMP1 transcripts (Fig. 1D) in osteocytes and very weak signals in odontoblasts, whereas high levels of DSPP transcripts (Fig. 1E) were detected in preameloblasts and odontoblasts.
375
odontoblasts beneath the cusp as well as in dentinal tubules and predentin. 2.3. Two-week-old At this stage, M1 has started to form root dentin but has not erupted. Positive reactions for DMP1 (Fig. 2C) were observed in dentinal tubules, predentin and odontoblasts beneath the cusps. The reactions for DSP (Fig. 2D) in dentinal tubules and odontoblasts were similar to those for DMP1. 2.4. Three-week-old
2.2. One-week-old The enamel and dentin of rat M1 have thickened. Clear immunoreactions for DMP1 (Fig. 2A) were observed in dentinal tubules in the coronal matrix beneath the cusps. Immunoreactions for DSP (Fig. 2B) were observed in
At 3 weeks, M1 had erupted and cellular cementum formation had begun. The expression pattern for DMP1 and DSP in M1 were similar (data not shown). Both molecules were observed in dentinal tubules, predentin, odontoblasts and cementocytes including their processes.
Fig. 4. Buccolingual sections of 8-week-old rat mandibular M1. (A) IHC for DMP1; (B) IHC for DSP; (C and E) higher magnifications of coronal (C) and root (E) dentin area from panel A; (D and F) higher magnifications of coronal (D) and root (F) dentin area from panel B. DMP1 and DSPP are colocalized well in dentin and cellular cementum. Immunoreactions for both molecules are intense in coronal dentinal tubules (A and B, arrows) and odontoblasts of root dentin (A, B, E and F, arrowheads), but are weaker in coronal odontoblasts (C and D, OD), predentin (C and D, arrows) and dentinal tubules in root dentin (E and F, arrows). Bar, 200 Am in panels A and B; Bar, 20 Am in panels C–F; CC, cellular cementum; D, dentin; OD, odontoblast; P, dental pulp.
376
O. Baba et al. / Matrix Biology 23 (2004) 371–379
2.5. Five-week-old At 5 weeks, immunoreactions for DMP1 in coronal dentinal tubules reached the highest level while its signals in root dentin were comparatively weak (Fig. 3A). Moreover, positive reactions were found in the dental pulp of coronal part and the upper half of the root area (Fig. 3A). Interestingly, intensive reactions in odontoblasts were widely observed in both coronal and root dentin areas (Fig. 3A, D and E). Immunoreactions for DMP1 were also clearly observed in cementocytes and along their processes (Fig. 3A and F). The immunoreactions for DSP (Fig. 3B) in the coronal dentin and cementum were similar to those for DMP1. For BSP, very weak or no immunoreactions were detected in odontoblasts and dentin (Fig. 3C), although there was a high level of positive reactions in bone, acellular and cellular cementum in which this protein was evenly distributed. It should be noted that the immunoreactions for DMP1 in osteocytes were observed throughout the developmental period that we studied (i.e., from postnatal 1-day to 8-week). In fact, bone DMP1 predominated in the pericellular regions of osteocytes and along their processes (Fig. 3G). ISH demonstrated clearly similar expression patterns of transcripts for DMP1 (Fig. 3H) and DSPP (Fig. 3I) in odontoblasts in the root area. 2.6. Eight-week-old At 8 weeks, intense signals for DMP1 were observed in odontoblasts in root dentin while the reactions in predentin of the coronal area were relatively weak (Fig. 4A, C and E). Immunoreactions for DSP (Fig. 4B, D and F) were very similar to those for DMP1. In summary, using IHC, we observed DMP1 and DSP in dentinal tubules of all the stages of rat molar development. In predentin, immunoreactions for DMP1 were detected after 2 weeks, while those for DSP were detected throughout the experimental period. Positive reactions in odontoblasts were detected after 2 weeks for DMP1 and after 1 week for DSP. In general, immunopositive reactions for DMP1 showed a tendency of growing stronger with the increase of development time, up to 5 weeks. After the age of 5 weeks, the distribution patterns of DMP1 and DSP in dental tubules, predentin, odontoblasts and cellular cementum were very similar. Very weak or no reactions for BSP were detected in odontoblasts and dentin matrix.
3. Discussion The observed similarities between DMP1 and DSPP have led us to postulate that the two molecules might function in a complementary and/or synergistic manner during tooth formation. In order to test part of this hypothesis, we performed a systematic, developmental
study comparing the expression and extracellular presence of DMP1 and DSP during dentinogenesis in the crowns and roots of rat first molars. For detection of DMP1, we used monoclonal antibodies produced with the native form of DMP1 COOH-terminal fragments as the antigen. For that of DSP, we used monoclonal antibodies that were generated earlier (Baba et al., 2004). In 1-day- and 1-week-old rats, immunoreactions for DMP1 were observed in dentinal tubules of mineralized dentin but not in predentin or odontoblasts (Fig. 1A). This accentuated distribution pattern is probably due to a higher level of accumulation of DMP1 (or its processed COOHterminal fragments) within tubules versus predentin and odontoblasts. This conclusion is consistent with our observation that, throughout the observed period, immunoreactions for DMP1 were stronger in tubules than in other areas of the tooth. After 2 weeks, immunoreactions for DMP1 became stronger with the increase of development time and were consistently observed in dentinal tubules, predentin and odontoblasts. These findings suggest that DMP1 may play a more important role at later stages of tooth development, a conclusion consistent with phenotypic changes in DMP1 knockout mice that showed significant skeletal abnormalities only after the age of 3 weeks (Ye et al., 2004). DSP was consistently localized in dentinal tubules, predentin and odontoblasts, at earlier as well as later stages of molar development. At later stages of development (i.e., after 3-weeks), DSP and DMP1 were colocalized, suggesting that the two proteins may be working in concert. A striking observation in support of this postulation is the presence of intense immunoreactions observed for both DMP1 and DSP in the crown dentinal tubules of 5- and 8-week-old rats (Figs. 3A, B and 4A, B). Furthermore, the pattern of reactions for DMP1 and DSP contrasts with that for BSP (Fig. 3C and Hosoya et al., 2003) and OPN (Hosoya et al., 2003), both of which were evenly and abundantly distributed in bone matrix but were absent or weakly positive in dentin. The strong and consistent immunoreactions for DMP1 in osteocytes, cementocytes, matrices (canaliculi) surrounding their processes (Fig. 3F and G, and Toyosawa et al., 2001, 2004), along with its localization in odontoblasts and dentinal tubules, suggest that DMP1 may be involved in the maintenance of the mineralized tissue microenvironment. Gluhak-Heinrich et al. (2003) reported that expression of DMP1 transcripts and secretion of protein were upregulated by mechanical stress. Our results showed intense immunoreactions in dentinal tubules in coronal regions at later stages (Figs. 3A and 4A) after molar eruption, where the mechanical stress from early occlusal forces would occur. Thus, one function of DMP1 and/or DSPP may involve a response to the mechanical stress by osteocytes, cementocytes, odontoblasts and their processes. In summary, using IHC and ISH techniques, we analyzed and compared the expression of DMP1, DSP (DSPP) and
O. Baba et al. / Matrix Biology 23 (2004) 371–379
BSP in the sequential stages of rat molar development. Our newly generated monoclonal antibodies have allowed us to clearly detect DMP1, leading to a better understanding of its distribution patterns in developing dentin and odontoblasts. Thus, DMP1 occurs mainly in dentinal tubules and mature odontoblasts at later stages of tooth development. The distribution pattern of DMP1 at later stages is coincident with that of DSP in dentinal tubules, odontoblasts and predentin, and this distribution is very different from that of BSP. These similar distribution patterns indicate that DMP1 and DSPP may function in a complementary and/or synergistic fashion in the developmental formation and the microenvironment maintenance of teeth.
4. Experimental procedures 4.1. Tissue preparation One-day-, 1-, 2-, 3-, 5- and 8-week-old Sprague–Dawley rats (Harlan, Indianapolis, IN, USA) were perfused with 4% paraformaldehyde in 0.1 M phosphate-buffer (pH 7.4). Mandibles were dissected and further fixed in the same fixative for 2 days at 4 8C followed by decalcification in 8% EDTA (pH 7.4) at 4 8C for 3 to 5 weeks. Tissues were processed to paraffin embedding and buccolingual serial sections (5 Am) were prepared for IHC and ISH. All animal experiments were approved by the Animal Welfare Committee of University of Texas at Houston Health Science Center. 4.2. Antibodies Monoclonal antibodies against DMP1 were produced using the 57 kDa fragments (Qin et al., 2003) as the antigen and employing techniques described previously for the generation of monoclonal antibodies against DSP (Baba et al., 2004). Briefly, 57 kDa fragments isolated from rat bone were injected into BALB/c mice. Lymphocytes were fused with P3 myeloma cells. Fusion cells showing positive reactions to 57 kDa fragments were detected by ELISA and cloned. Totally, we obtained 20 positive clones. In the present study, clone 8G10.3 was used because it showed intense reactions in IHC. The immunospecificity of clone 8G10.3 was first confirmed by dotblots using highly pure 57 kDa fragments as the antigen and was then further proven by our observation that the culture medium of this clone completely lost its immunoreactivity to DMP1 in IHC experiments after it had been preincubated with purified 57 kDa fragments. Furthermore, the immunolocalization pattern of DMP1 when clone 8G10.3 was used, was very similar to that when the antisera (a gift from Dr. Lynda Bonewald, University of Missouri at Kansas City, MO, USA) raised against a synthetic peptide matching amino acid sequences of rat DMP1 COOH-terminal region were applied (data not shown). Based on the above findings, as
377
well as the fact that purified DMP1 fragments (57 kDa) were used as the antigen, we concluded that this monoclonal antibody is specific to DMP1, although it did not recognize DMP1 fragments on Western immunoblots. In this investigation, the expanded cultured medium of clone 8G10.3 was used at a dilution of 1:50. Monoclonal antibody for DSP (Baba et al., 2004) and antiserum against BSP (LF-87) were utilized at dilutions of 1:1000 and 1:200, respectively. For BSP, we only performed IHC in 1-day- and 5-week-old rats. 4.3. Immunohistochemistry (IHC) IHC was performed as previously described (Baba et al., 2004). Briefly, paraffin sections were treated with 0.3% H2O2 in methanol solution followed by treatment of hyaluronidase for 1 h at 37 8C. Then, sections were incubated with 2% bovine serum albumin and 10% normal goat serum to avoid nonspecific immunoreactions. Primary antibodies diluted in phosphate buffered saline (PBS) containing 10% NGS were applied for 24 h at 4 8C. Biotinylated horse anti-mouse IgG (1:100, Vector, for DMP1 and DSP) and goat anti-rabbit IgG (1:400, Vector, for BSP) were used as the secondary antibody. Finally, sections were treated with ABC kit (Vector), and immunopositive loci were detected by incubation with 3,3V-diaminobenzidine tetrahydrochloride (DAB, Vector) solution. Sections were counterstained with methyl green solution. 4.4. Probes for in situ hybridization (ISH) We generated 373-bp rat RNA probes corresponding to the coding regions in exons 2, 3, 4, 5 and 6 of dmp1 (Thotakura et al., 2000) using the same method as previously described for the generation of DSPP RNA probes (Baba et al., 2004). Briefly, a primer set, 5V–gtgctctccctgtcgccaga–3V for forward and 5V–gtgtctgccgagtcctcgtca–3V for reverse, (Seqwright, Houston, TX, USA) was employed to generate cDNA inserts using PCR with total RNA extracted from molars of 5-dayold rat as the template. Next, the PCR products were cloned into the pCRII-TOPO vector (Invitrogen Life Technologies, Carlsbad, CA, USA) and transformed into competent Escherichia coli. The plasmid DNA was isolated from E. coli and sequenced. Digoxigenin-labeled single-stranded antisense and sense probes were generated using Sp6 and T7 RNA polymerases (Roche Diagnostics, Indianapolis, IN, USA), respectively, using a DIG RNA Labeling Kit (Roche). 4.5. In situ hybridization (ISH) ISH was performed as previously described (Baba et al., 2004). Briefly, the paraffin sections were treated with proteinase K followed by postfixation in 4% paraformaldehyde and acetylation in 0.1 M triethanolamine containing
378
O. Baba et al. / Matrix Biology 23 (2004) 371–379
0.5% acetic anhydride. Hybridization was performed at 52 8C for DMP1 and at 49 8C for DSPP, using either the denatured antisense or the sense probes for 20 h. After posthybridization treatments, the sections were reacted with antidigoxigenin antibody conjugated with alkaline phosphatase (Roche). The locus of hybridization was demonstrated by treating sections with 5-bromo-4-chloro-3-indolylphosphate and nitroblue tetrazolium solution according to the manufacturer’s instruction (Roche). Sections were counterstained with methyl green solution.
Acknowledgements We thank Dr. Larry W. Fisher (National Institute of Dental Research, National Institutes of Health, Bethesda, MD, USA) for supplying LF-87, anti-BSP antibody. We thank Dr. Satoru Toyosawa (Depertment of Oral Pathology, Osaka University Graduate school of Dentistry, Osaka, Japan) for his valuable comments on DMP1 expression. We thank Dr. Lynda Bonewald (University of Missouri at Kansas City, MO, USA) for providing us the antisera against DMP1. We thank Ms. Gillian Rittman and Ms. Verna Hubbard for excellent work in preparing tissue sections. This work was supported by NIH/NIDCR Grant DE05092 to WTB.
References Baba, O., Qin, C., Brunn, J.C., Jones, J.E., Wygant, J.N., McIntyre, B.W., Butler, W.T., 2004. Detection of dentin sialoprotein in periodontium. Eur. J. Oral Sci. 112, 163 – 170. Be`gue-Kirn, C., Ruch, J.-V., Ridall, A.L., Butler, W.T., 1998. Comparative analysis of mouse DSP and DPP expression in odontoblasts, preameloblasts, and experimentally induced odontoblast-like cells. Eur. J. Oral Sci. 106, 254 – 259. Be`gue-Kirn, C., Krebsbach, P.H., Bartlett, J.D., Butler, W.T., 1998. Dentin sialoprotein, dentin phosphoprotein, enamelysin and ameloblastin: tooth-specific molecules that are distinctively expressed during murine dental differentiation. Eur. J. Oral Sci. 106, 963 – 970. Boskey, A.L., Maresca, M., Doty, S., Sabsay, B., Veis, A., 1990. Concentration-dependent effects of dentin phosphophoryn in the regulation of in vitro hydroxyapatite formation and growth. Bone Miner. 11, 55 – 65. Butler, W.T., 1998. Dentin matrix proteins. Eur. J. Oral Sci. 106, 204 – 210. (Suppl.). Butler, W.T., Bhown, M., Brunn, J.C., D’Souza, R.N., Farach-Carson, M.C., Happonen, R.-P., Schrohenloher, R.E., Seyer, J.M., Somerman, M.J., Foster, R.A., Tomana, M., van Dijk, S., 1992. Isolation, characterization and immunolocalization of a 53-kDal Dentin Sialoprotein (DSP). Matrix 12, 343 – 351. D’Souza, R.N., Bronckers, A.L.J.J., Happonen, R.-P., Doga, D.A., FarachCarson, M.C., Butler, W.T., 1992. Developmental expression of a 53 kD dentin sialoprotein in rat tooth organs. J. Histochem. Cytochem. 40, 359 – 366. Feng, J.Q., Huang, H., Lu, Y., Ye, L., Xie, Y., Tsutsui, T.W., Kunieda, T., Castranio, T., Scott, G., Bonewald, L.B., Mishina, Y., 2003. The dentin matrix protein 1 (DMP1) is specifically expressed in mineralized, but not soft, tissues during development. J. Dent. Res. 82, 776 – 780.
Fisher, L.W., Fedarko, N.S., 2003. Six genes expressed in bones and teeth encode the current members of the SIBLING family of proteins. Connect. Tissue Res. 44 (Suppl. 1), 33 – 40. George, A., Sabsay, B., Simonian, P.A., Veis, A., 1993. Chracterization of a novel dentin matrix acidic phosphoprotein. J. Biol. Chem. 268, 12624 – 12630. George, A., Gui, J., Jenkins, N.A., Gilbert, D.J., Copeland, N.G., Veis, A., 1994. In situ localization and chromosomal mapping of the AG1 (DMP1) gene. J. Histochem. Cytochem. 42, 1527 – 1531. Gluhak-Heinrich, J., Ye, L., Bonewald, L.F., Feng, J.Q., MacDougall, M., Harris, S.E., Pavlin, D., 2003. Mechanical loading stimulates dentin matrix protein 1 (DMP1) expression in osteocytes in vivo. J. Bone Miner. Res. 18, 807 – 817. He, G., Dahl, Y., Veis, A., George, A., 2003. Dentin matrix protein 1 initiates hydroxyapatite formation in vitro. Connect. Tissue Res. 44 (Suppl. 1), 240 – 245. Hosoya, A., Yoshida, K., Yoshiba, N., Hoshi, K., Iwaku, M., Ozawa, H., 2003. An immunohistochemical study on hard tissue formation in a subcutaneously transplanted rat molar. Histochem. Cell Biol. 119, 27 – 35. Jain, A., Karadag, A., Fohr, B., Fisher, L.W., Fedarko, N.S., 2002. Three SIBLINGs (small integrin-binding ligand, N-linked glycoproteins) enhance factor H’s cofactor activity enabling MCP-like cellular evasion of complement-mediated attack. J. Biol. Chem. 277, 13700 – 13708. Narayanan, K., Srinivas, R., Ramachandran, A., Hao, J., Quinn, B., George, A., 2001. Differentiation of embryonic mesenchymal cells to odontoblast-like cells by overexpression of dentin matrix protein 1. Proc. Natl. Acad. Sci. U. S. A. 98, 4516 – 4521. Qin, C., Cook, R.G., Orkiszewski, R.S., Butler, W.T., 2001. Identification and characterization of the carboxyl-terminal region of rat dentin sialoprotein. J. Biol. Chem. 276, 904 – 909. Qin, C., Brunn, J.C., Cadena, E., Ridall, A., Tsujigiwa, H., Nagatsuka, H., Nagai, N., Butler, W.T., 2002. The expression of dentin sialoprotein gene in bone. J. Dent. Res. 81, 392 – 394. Qin, C., Brunn, J.C., Cook, R.G., Orkiszewski, R.S., Malone, J.P., Veis, A., Butler, W.T., 2003. Evidence for the proteolytic processing of dentin matrix protein 1. J. Biol. Chem. 278, 34700 – 34708. Ritchie, H.H., Shigeyama, Y., Somerman, M.J., Butler, W.T., 1996. Partial cDNA sequencing of mouse dentine sialoprotein and detection of its specific expression by odontoblasts. Arch. Oral Biol. 41, 571 – 575. Ritchie, H.H., Berry, J.E., Somerman, M.J., Hanks, C.T., Bronckers, A.L.J.J., Hotton, D., Papagerakis, P., Berdal, A., Butler, W.T., 1997. Dentin sialoprotein (DSP) transcripts: developmentally sustained expression in odontoblasts and transient expression in ameloblasts. Eur. J. Oral Sci. 105, 405 – 413. Saito, T., Arsenault, A.L., Yamauchi, M., Kuboki, Y., Crenshaw, M.A., 1997. Mineral induction by immobilized phosphoproteins. Bone 21, 305 – 311. Sreenath, T., Thyagarajan, T., Hall, B., Longenecker, G., D’Souza, R., Hong, S., Wright, J.T., MacDougall, M., Sauk, J., Kulkarni, A.B., 2003. Dentin sialophosphoprotein knockout mouse teeth display widened predentin zone and develop defective dentin mineralization similar to human dentinogenesis imperfecta type III. J. Biol. Chem. 278, 24874 – 24880. Thotakura, S.R., Karthikeyan, N., Smith, T., Liu, K., George, A., 2000. Cloning and characterization of rat dentin matrix protein 1 (DMP1) gene and its 5V-upstream region. J. Biol. Chem. 268, 10272 – 10277. Toyosawa, S., Shintani, S., Fujisawa, T., Ooshima, T., Sato, A., Ijuin, N., Komori, T., 2001. Dentin matrix protein 1 is predominantly expressed in chicken and rat osteocytes but not in osteoblasts. J. Bone Miner. Res. 16, 2017 – 2026. Toyosawa, S., Okabayashi, K., Komori, T., Ijuhin, N., 2004. mRNA expression and protein localization of dentin matrix protein 1 during dental root formation. Bone 34, 124 – 133. Veis, A., 1993. Mineral–matrix interactions in bone and dentin. J. Bone Miner. Res. 8 (Suppl. 2), S493 – S497.
O. Baba et al. / Matrix Biology 23 (2004) 371–379 Xiao, S., Yu, C., Chou, X., Chou, X., Yuan, W., Wang, Y., Bu, L., Fu, G., Qian, M., Yang, J., Shi, Y., Hu, L., Han, B., Wang, Z., Huang, W., Liu, J., Chen, Z., Zhao, G., Kong, X., 2001. Dentinogenesis imperfecta 1 with or without progressive hearing loss is associated with distinct mutations in DSPP. Nat. Genet. 27, 201 – 204. Ye, L., MacDougall, M., Zhang, S., Xie, Y., Zhang, J., Li, Z., Lu, Y., Mishina, Y., Feng, J.Q., 2004. Deletion of dentin matrix
379
protein-1 leads to a partial failure of maturation of predentin into dentin, hypomineralization and expanded cavities of pulp and root canal during postnatal tooth development. J. Biol. Chem. 279, 19141 – 19148. Zhang, X., Zhao, J., Li, C., Gao, S., Qiu, C., Liu, P., Wu, G., Qiang, B., Lo, W.H.Y., Shen, Y., 2001. DSPP mutation in dentinogenesis imperfecta Shields type II. Nat. Genet. 27, 151 – 152.