- Email: [email protected]
Angiogenic Activity of Dentin Matrix Components
Basic Research—Biology
Angiogenic Activity of Dentin Matrix Components Rong Zhang, DDS, PhD,*† Paul R. Cooper, BSc, PhD,* Gay Smith, BSc, MSc,* Jacques E. No¨r, DDS, PhD,‡ and Anthony J. Smith, BSc, PhD* Abstract Angiogenesis is key to both the development and regeneration of the dentin-pulp complex. Objective: We hypothesized that proangiogenic signaling molecules sequestered in dentin matrix can be solubilised to induce angiogenic events. Methods: Matrix components were extracted from powdered sound human dentin with EDTA and their dose-dependent (0.0001-5 mg/mL) effects examined in endothelial cells in an in vitro angiogenic tube formation assay, proliferation assay, and transcriptional regulation of the VEGF and VEGFR2 genes. Results: Lower concentrations of dentin matrix components were found to show proangiogenic activity, whereas higher concentrations suppressed angiogenic activity. Conclusion: This study highlights that the release of dentin matrix components after dental injury can contribute to the angiogenic events that support pulp regeneration. (J Endod 2011;37:26–30)
Key Words Angiogenesis, dentin, endodontics, growth factors, regeneration, revascularization, stem cells
From the *Department of Oral Biology, School of Dentistry, University of Birmingham, Birmingham, UK; †Department of Operative Dentistry and Endodontics, School of Stomatology, Fourth Military Medical University, Xi’an, China; and ‡ University of Michigan School of Dentistry, Ann Arbor, MI, USA. Address requests for reprints to Dr Anthony J. Smith, Oral Biology, School of Dentistry, University of Birmingham, St Chads Queensway, Birmingham, B4 6NN UK. E-mail address: [email protected]. 0099-2399/$ - see front matter Copyright ª 2011 American Association of Endodontists. doi:10.1016/j.joen.2010.08.042
D
uring dentin-pulp regeneration, interplay between pulp stem cells and signaling molecules (often derived from the dentin matrix) drives the process of reparative dentinogenesis (1, 2). Angiogenesis is fundamental to both tissue development and wound healing (3). The dental pulp has a rich vasculature, and the regressive changes seen in this vasculature after tooth development are reversed at sites of injury to provide effective nutrient delivery for reparative processes. Such revascularization may be effective in the treatment of immature permanent teeth with pulpal necrosis (4–6). Signaling of angiogenic events at sites of injury is critical for tissue repair, and proangiogenic growth factors, such as Vascular Endothelial Growth Factor (VEGF) (7–11), appear to be important mediators of this signalling. The expression of these growth factors by odontoblasts and cells in the core of the dental pulp (12–14) may contribute to the signaling of angiogenesis during reparative dentinogenesis, and pulp fibroblast expression of VEGF and Fibroblast Growth Factor -2 (FGF-2) has been implicated in the proangiogenic effects of these cells in vitro (13). However, the half-life of these growth factors can be very short, and for VEGF this is in the order of minutes (15). This implies the need for sustained expression or the release of such growth factors if they are to play a significant role in mediating angiogenic events. Sequestration of a number of angiogenic growth factors in the dentin matrix (16) provides a ‘‘fossilized’’ pool of these molecules protecting their bioactivity and allowing sustained release during matrix breakdown in caries or from the application of restorative materials (17, 18). Pulp tissue engineering in which stem cells from exfoliated deciduous teeth were seeded in a poly-L-lactic acid (PLLA)-based scaffold within a slice of a human tooth allowed differentiation of dentinsecreting odontoblasts, fibroblasts, and a microvascular network in the tissue construct (19). The authors of this study hypothesized that the local release of bioactive molecules from the tooth slice was responsible for morphogenic signaling of stem cell differentiation, resulting from the low pH generated by the PLLA scaffold degradation. The demonstration of the presence of angiogenic factors in the dentin matrix highlights their potential for participation in reparative events in the tooth, and the present study aims to investigate the functional activity of isolated dentin matrix components in angiogenesis.
Materials and Methods Preparation of Dentin Matrix Components An EDTA-soluble preparation of dentin matrix components was isolated by the extraction of powdered sound human dentin with 10% (w/v) EDTA (pH = 7.2) containing 10mmol/L of N-ethylmaleimide and 5 mmol/L of phenylmethylsulphonyl fluoride as protease inhibitors for 7 days at 4 C with a rotary mixer. After extraction, the preparation was exhaustively dialysed against distilled water before lyophilization (20).
In Vitro Endothelial Tube Angiogenesis Assay An in vitro endothelial tube commercial assay based on coculture of human endothelial cells on an interstitial cell feeder layer (AngioKit, TCS Cellworks, UK) was used to investigate the angiogenic effects of the dentin matrix preparation (0.0001 mg/mL-5 mm/mL concentration range) together with blank (medium alone), negative (20 mmol/L of suramin), and positive (recombinant VEGF 2 ng/mL) controls. This assay is well established for an in vitro study of endothelial cells in angiogenesis (21) and briefly involves the following: cells were cultured for 11 days in a humidified incubator in an atmosphere of 5% CO2 in air with media changes at 4, 7, and 9 days after which cells were fixed with 70% (v/v) ethanol. Branched, tubular, capillary-like structures were visualized immunohistochemically by staining for the endothelial markers
26
Zhang et al.
JOE — Volume 37, Number 1, January 2011
Basic Research—Biology PECAM1 (CD31) and von Willebrand factor according to the kit manufacturer’s instructions. Image analysis (Image-Pro Plus; MediaCybernetics, Bethesda, MD) was used to quantify the vessel number, the total length, and branch points.
Effects of Dentin Matrix Components on Endothelial Cell Proliferation The effects of a range of concentrations of dentin matrix components (0.0001-1 mg/mL) on human umbilical vein endothelial cell (HUVEC) proliferation was assessed in passage 3 primary HUVEC cells (Promocell, Heidelberg, Germany) cultured for up to 8 days in 24well plates (seeding density 5,700 cells/well) in endothelial cell supplemented medium (Promocell) at 37 C in an atmosphere of 5% CO2 in air. Viable cell counts were performed every other day using a hemocytometer slide after Trypan blue staining, and comparisons were made to control cultures in the absence of dentin matrix components. Statistical Analyses Data for the angiogenesis and proliferation assays were analyzed using the Mann-Whitney U test.
RNA Isolation and Semiquantitative–Polymerase Chain Reaction Analysis To investigate direct effects of dentin matrix components on endothelial cells, expression of VEGF and VEGF-R2 was examined in passage 3 HUVEC (Promocell) cultured in 35-mm dishes (seeding density 1.14 104 cells/mL) with endothelial cell supplemented medium (Promocell) in the presence or absence of dentin matrix components (0.0001-1 mg/mL). Total RNA for each growth condition was extracted after 9 days of culture using an RNeasy kit (Qiagen, Crawley, UK) according to the manufacturer’s instructions. One to 2 micrograms of DNase digested total RNA from each growth condition were reverse transcribed to single-stranded complementary DNA using an Omniscript Reverse Transcriptase kit (Qiagen). Semiquantitative-PCR analysis was performed using REDTaq ReadyMix PCR reaction mix with MgCl2 (Sigma Chemical Co, Gillingham, UK) and with the following primers: VEGF (F)-5’ CTGAGGAGTCCAACATCACCATG 3’; VEGF (R)-5’ CCTCGGCTTGTCACATCTGCAAG 3’ (product size: 353 bp); VEGF-R2 (F)-5’ TGCCTACCTCACCTGTTTCC 3’; VEGF-R2 (R)-5’-TGATATCCGGACTGGTAGCC-3’ (product size: 373 bp); GAPDH (F)-5’ CCACCCATGGCAAATTCCATGGCA 3’; and GAPDH (R)-5’ TCTAGACGGCAGGTCAGGTCCACC 3’ (product size: 550 bp). Briefly, 50
Figure 1. In vitro endothelial tube assay for angiogenic activity. (A) CD31 immunostaining after 11 days culture in the presence of 0.0001 to 5 mg/mL of dentin matrix components and blank (medium alone), negative (20 mmol/L suramin), and positive (2 ng/mL of VEGF) controls (magnification 40). Quantification of (B) the number of vessels, (C) the number of branch points, and (D) the total length of vessels (mm) (Statistically significant from control a p < 0.05, b p < 0.001).
JOE — Volume 37, Number 1, January 2011
Angiogenic Activity of Dentin Matrix Components
27
Basic Research—Biology ng of complementary DNA were used in a 25-mL PCR system, which was subjected to 30 to 35 cycles. Amplification was performed at 94 C for 30 seconds, 60 C to 68 C for 30 seconds and 72 C for 30 seconds. The PCR products were subjected to electrophoresis on a 1.5% agarose gel, which was stained with ethidium bromide. AIDA image analysis software (Raytest, Straubenhardt, Germany) was used to quantify the amplified products which were normalized against the human GAPDH housekeeping gene. Data presented are representative of three independent experiments.
Results Dentin Matrix Components Promote Angiogenesis in an In Vitro Endothelial Tube Assay Using an in vitro endothelial tube formation assay of angiogenesis, dentin matrix components showed dose-dependent effects on vessel total length, the numbers of vessels, and the numbers of branch points relative to control cultures (without the addition of inhibitors or
promoters of angiogenesis) (Fig. 1). All of these parameters were decreased when suramin (negative control) was included in the assay, whereas VEGF (positive control) showed increases in the vessel total length and the numbers of branch points but not the vessel number. Dentin matrix components showed maximal increases in all three assay parameters when added to cultures at a concentration of 0.01 mg/mL, and lesser increases were evident even at a concentration of 0.0001 mg/ mL. At concentrations of 0.1 mg/mL and higher, the dentin matrix components were found to be inhibitory to angiogenesis.
Effects of Dentin Matrix Components on Endothelial Cell Proliferation and Gene Expression Dose-dependent effects of dentin matrix components on HUVEC proliferation were observed with maximal effects observed at a concentration of 0.0001 mg/mL when added to cultures (Fig. 2). Higher concentrations of dentin matrix components provided less stimulation of HUVEC proliferation, and concentrations of 0.1 and 1.0 mg/mL were observed to inhibit HUVEC proliferation.
100000 90000 80000
Medium
Cells/Well
70000
0.0001
60000
0.001
50000
0.01
40000
0.1
30000
1
20000 10000 0 0
2
4
6
8
10
Days 140
VEGF-R2
120 100
1.0
0.1
0.01
GAPDH
0.001
VEGF
0.0001
Control VEGF-R2
Relative expression level
80 60 40 20 0 C
0.0001
0.001
0.01
160 140 120 100 80 60 40 20 0
0.1
1
VEGF
C
0.0001
0.001
0.01
0.1
1
Dentin matrix components (mg/ml)
Figure 2. Endothelial cell behavior in the presence of 0.0001 to 1 mg/mL of dentin matrix components and control (medium alone). (A) Cell proliferation analysis for up to 8 days in culture. (B) Relative levels of VEGF and VEGFR2/KDR gene expression.
28
Zhang et al.
JOE — Volume 37, Number 1, January 2011
Basic Research—Biology Dentin matrix components showed a dose-dependent response in the expression of the proangiogenic growth factor VEGF and its receptor VEGFR2 (Fig. 2). A concentration of 0.01 mg/mL of dentin matrix components showed optimal expressions of these genes. Although this was the only concentration to up-regulate VEGFR2 expression, VEGF showed a progressive up-regulation from 0.0001 to 0.01 mg/ mL. Concentrations of 0.01 or 1.0 mg/mL of dentin matrix components caused a decrease in the expression levels of these genes.
Discussion Angiogenesis is fundamental to both tissue development and wound healing (3). During pulpal healing, revasularization is key to the maintenance of tissue vitality although the mechanisms underlying such revascularization are unclear. Dentin contains a rich cocktail of growth factors and cytokines (2, 22, 23) that are sequestered in the matrix during dentinogenesis through their interactions with proteoglycans and other extracellular matrix components (24, 25). This fossilized store of bioactive molecules protects them from degradation in the absence of dental disease and provides a reservoir of signaling molecules to initiate regenerative events in the tissue after injury. A number of proangiogenic growth factors have been isolated from dentin (16, 26), but to date only preliminary investigations of their potential functional activity have been undertaken (27). In the present study, we have shown that isolated dentin matrix components have stimulatory effects on endothelial cell proliferation even at the low concentration of 0.0001 mg/mL and that at higher concentrations (0.1 and 1.0 mg/mL) these components inhibited endothelial cell proliferation. Such stimulatory effects of dentine matrix components on cellular proliferation parallel those seen in odontoblast-like, pulp-derived, and fibroblast cell lines (28). In the in vitro endothelial tube formation assay of angiogenesis, dentin matrix components showed positive dose-dependent effects on vessel total length, the numbers of vessels, and the numbers of branch points relative to control cultures (without addition of inhibitors or promoters of angiogenesis). Although the same dose-dependent trends were seen in the endothelial cell proliferation and endothelial tube formation assays, the peak effects in the latter occurred at a higher concentration of dentin matrix components, perhaps reflecting the greater complexity of endothelial tube formation versus simple cellular proliferation. A central role for VEGF in angiogenesis is well recognized, and in vitro VEGF positively regulates many endothelial cell functions including proliferation, migration, and capillary sprouting (29–31). Indeed, VEGF is also able to induce endothelial cell differentiation in the Stem cells from Human Exfoliated Deciduous teeth (SHED) population of dental pulp stem cells (32). Interestingly, the proangiogenic effects of dentin matrix components in the present study were observed at concentrations that contained much lower levels of VEGF than the positive VEGF control for the assay. Dentin matrix preparations at concentrations of 0.0001 to 0.01 mg/mL will contain approximately 10 4 to 10 6 ng/mL of VEGF based on the levels reported in these preparations (16), whereas the VEGF-positive control in the endothelial tube formation assay was at a concentration of 2 ng/mL and gave rise to similar proangiogenic responses. Little information exists on the angiogenic effects of treatment with multiple growth factors, but it appears that the cocktail of growth factors derived from dentin matrix acts synergistically, leading to an appreciable amplification of the angiogenic effects. VEGF has been reported to attenuate actions of TGF-ß in endothelial cells at the transcriptional and intracellular signalling levels (33), and such interactions may help to explain some of these synergistic actions of components derived from the dentin matrix. Although the proangiogenic activity of the dentin matrix components cannot be ascribed to any JOE — Volume 37, Number 1, January 2011
one growth factor or cytokine, exciting opportunities exist for study of the complex and synergistic interactions between these molecules. Although the treatment of endothelial cells with optimal concentrations of dentin matrix components for angiogenesis only led to moderate increases in expression of the VEGF-R2 or its ligand by the endothelial cells, at higher concentrations (0.1 and 1.0 mg/mL) of dentin matrix components the expressions of these genes were suppressed. This parallels the data for both endothelial and pulp-derived (28) cell proliferation and the in vitro tube formation assay in which these higher levels of dentin matrix components were also inhibitory. These inhibitory effects were prominent at higher concentrations of dentin matrix components and highlight the potential impact of release of these components on tissue regeneration in more active carious lesions. Regeneration in the dentin-pulp complex after injury is a fine balance between the stimulatory molecular signaling events and the inhibitory influences of inflammatory and other defense processes. Comparisons of tissue responses to active and more slowly progressing carious lesions suggest that pulpal repair and regeneration are compromised in more active lesions (34, 35). This may in part reflect the persistent tissue challenge from bacterial metabolites in more active lesions but also the effects of the higher concentrations of dentin matrix components being released. Although these effects cannot be ascribed to any one component in such a complex mixture of molecules, many of the growth factors and cytokines present in dentin have multifunctional effects, and molecules like TGF-b are known to stimulate many cellular formative events as well as being able to induce apoptosis at higher concentrations (36, 37). Thus, the identification of teeth with less active disease may be prudent in the selection of clinical cases for regenerative endodontic treatment. This study has shown the proangiogenic effects of dentin matrix components and highlights the potential of these molecules in stimulating angiogenic events associated with revascularization during pulp repair and regeneration. The co-operative action of angiogenic growth factors sequestered in the dentin matrix together with those expressed by fibroblasts and other cells in the pulp core provides a powerful mechanism for self-healing in the pulp. The dose dependency of these angiogenic effects indicates that careful selection of clinical cases for revascularization should maximize opportunities for positive treatment outcomes.
References 1. Smith AJ, Lesot H. Induction and regulation of crown dentinogenesis—embryonic events as a template for dental tissue repair. Crit Rev Oral Biol Med 2001;12: 425–37. 2. Goldberg M, Smith AJ. Cells and extracellular matrices of dentin and pulp: biological strategies for repair and tissue engineering. Crit Rev Oral Biol Med 2004;15:4–12. 3. Folkmann J, Shing Y. Angiogenesis. J Biol Chem 1992;267:1093–14. 4. Jung IY, Lee SJ, Hargreaves KM. Biologically based treatment of immature permanent teeth with pulpal necrosis: a case series. J Endod 2008;34:876–87. 5. Thibodeau B, Teixeira F, Yamauchi M, et al. Pulp revascularization of immature dog teeth with apical periodontitis. J Endod 2007;33:680–9. 6. Seale NS, Glickman GN. Contemporary perspectives on vital pulp therapy: views from the endodontists and pediatric dentists. J Endod 2008;34:S57–61. 7. Telles PD, Hanks CT, Machado MA, et al. Lipoteichoic acid up-regulates VEGF expression in macrophages and pulp cells. J Dent Res 2003;82:466–70. 8. Grando Mattuella L, Westphalen Bento L, de Figueiredo JA, et al. Vascular endothelial growth factor and its relationship with the dental pulp. J Endod 2007;33: 524–30. 9. Mullane EM, Dong Z, Sedgley CM, et al. Effects of VEGF and FGF2 on the revascularization of severed dental pulps. J Dent Res 2008;87:1144–8. 10. Soden RI, Botero TM, Hanks CT, et al. Angiogenic signalling triggered by cariogenic bacteria in pulp cells. J Dent Res 2009;88:835–40. 11. Botero TM, Son JS, Vodopyanov D, et al. MAPK signalling is required for LPSinduced VEGF in pulp stem cells. J Dent Res 2010;89:264–9. 12. Artese L, Rubini C, Ferrero G, et al. Vascular endothelial growth factor (VEGF) expression in healthy and inflamed human dental pulps. J Endod 2002;28:20–3.
Angiogenic Activity of Dentin Matrix Components
29
Basic Research—Biology 13. Tran-Hung L, Mathieu S, About I. Role of human pulp fibroblasts in angiogenesis. J Dent Res 2006;85:819–23. 14. Scheven BA, Man J, Millard JL, et al. VEGF and odontoblast-like cells: stimulation by low frequency ultrasound. Arch Oral Biol 2009;54:185–91. 15. Eppler SM, Combs DL, Henry TD, et al. A target-mediated model to describe the pharmacokinetics and hemodynamic effects of recombinant human vascular endothelial growth factor in humans. Clin Pharmacol Ther 2002;72:20–32. 16. Roberts-Clark D, Smith AJ. Angiogenic growth factors in human dentine matrix. Arch Oral Biol 2000;45:1013–6. 17. Graham L, Cooper PR, Cassidy N, et al. The effect of calcium hydroxide on solubilisation of bio-active dentine matrix components. Biomaterials 2006;27:2865–73. 18. Tomson PL, Grover LM, Lumley PJ, et al. Dissolution of bio-active dentine matrix components by mineral trioxide aggregate. J Dent 2007;35:636–42. 19. Cordeiro MM, Dong Z, Kaneko T, et al. Dental pulp tissue engineering with stem cells from exfoliated deciduous teeth. J Endod 2008;34:962–9. 20. Smith AJ, Tobias RS, Plant CG, et al. In vivo morphogenetic activity of dentine matrix proteins. J Biol Buccale 1990;18:123–9. 21. D’Andrea LD, Iaccarino G, Fattorusso R, et al. Targeting angiogenesis: structural characterization and biological properties of a de novo engineered VEGF mimicking peptide. Proc Nat Acad Sci U S A 2005;102:14215–20. 22. Smith AJ. Vitality of the dentin-pulp complex in health and disease: growth factors as key mediators. J Dent Educ 2003;67:678–89. 23. Cooper PR, Takahashi Y, Graham LW, et al. Inflammation-regeneration interplay in the dentine-pulp complex. J Dent 2010;38:687–97. 24. Baker SM, Sugars RV, Wendel M, et al. TGF-ß/extracellular matrix interactions in dentin matrix: a role in regulating sequestration and protection of bioactivity. Calc Tiss Int 2009;85:66–74. 25. Smith AJ, Matthews JB, Hall RC. Transforming growth factor- b1 (TGF- b1) in dentine matrix: ligand activation and receptor expression. Eur J Oral Sci 1998; 106:179–84.
30
Zhang et al.
26. Cassidy N, Fahey M, Prime SS, et al. Comparative analysis of transforming growth factor-beta (TGF- b) isoforms 1-3 in human and rabbit dentine matrices. Arch Oral Biol 1997;42:219–23. 27. Pearce SC, Hudlicka O, Smith AJ. In vivo effects of dentine matrix on angiogenesis in rat skeletal muscle. J Dent Res 1996;75:173. 28. Musson DS, McLachlan JL, Sloan AJ, et al. Adrenomedullin is expressed during rodent dental tissue development and promotes cell growth and mineralisation. Biol Cell 2010;102:145–57. 29. Risau W, Flamme I. Vasculogenesis. Annu Rev Cell Dev Biol 1995;11:73–91. 30. Pepper MS, Ferrara N, Orci L, et al. Potent synergism between vascular endothelial growth factor and basic fibroblast growth factor in the induction of angiogenesis in vitro. Biochem Biophys Res Commun 1992;89:824–31. 31. Holmes DI, Zachary I. The vascular endothelial growth factor (VEGF) family: angiogenic factors in health and disease. Genome Biol 2005;6:209–19. 32. Sakai VT, Zhang Z, Dong Z, et al. SHED differentiate into functional odontoblasts and endothelium. J Dent Res 2010;89:791–6. 33. Yamauchi K, Nishimura Y, Shigematsu S, et al. Vascular endothelial cell growth factor attenuates actions of transforming growth factor- b in human endothelial cells. J Biol Chem 2004;279:55104–8. 34. Bjørndal L, Darvann T, Thylstrup A. A quantitative light microscopic study of the odontoblast and subodontoblastic reactions to active and arrested enamel caries without cavitation. Caries Res 1998;32:59–69. 35. Bjørndal L, Darvann T. A light microscopic study of odontoblastic and nonodontoblastic cells involved in tertiary dentinogenesis in well-defined cavitated carious lesions. Caries Res 1999;33:50–60. 36. Schuster N, Krieglstein K. Mechanisms of TGF-beta-mediated apoptosis. Cell Tiss Res 2002;307:1–14. 37. Wu DT, Bitzer M, Ju W, et al. TGF- b concentration specifies differential signalling profiles of growth arrest/differentiation and apoptosis in podocytes. J Am Soc Nephrol 2005;16:3211–21.
JOE — Volume 37, Number 1, January 2011
Angiogenic Activity of Dentin Matrix Components Rong Zhang, DDS, PhD,*† Paul R. Cooper, BSc, PhD,* Gay Smith, BSc, MSc,* Jacques E. No¨r, DDS, PhD,‡ and Anthony J. Smith, BSc, PhD* Abstract Angiogenesis is key to both the development and regeneration of the dentin-pulp complex. Objective: We hypothesized that proangiogenic signaling molecules sequestered in dentin matrix can be solubilised to induce angiogenic events. Methods: Matrix components were extracted from powdered sound human dentin with EDTA and their dose-dependent (0.0001-5 mg/mL) effects examined in endothelial cells in an in vitro angiogenic tube formation assay, proliferation assay, and transcriptional regulation of the VEGF and VEGFR2 genes. Results: Lower concentrations of dentin matrix components were found to show proangiogenic activity, whereas higher concentrations suppressed angiogenic activity. Conclusion: This study highlights that the release of dentin matrix components after dental injury can contribute to the angiogenic events that support pulp regeneration. (J Endod 2011;37:26–30)
Key Words Angiogenesis, dentin, endodontics, growth factors, regeneration, revascularization, stem cells
From the *Department of Oral Biology, School of Dentistry, University of Birmingham, Birmingham, UK; †Department of Operative Dentistry and Endodontics, School of Stomatology, Fourth Military Medical University, Xi’an, China; and ‡ University of Michigan School of Dentistry, Ann Arbor, MI, USA. Address requests for reprints to Dr Anthony J. Smith, Oral Biology, School of Dentistry, University of Birmingham, St Chads Queensway, Birmingham, B4 6NN UK. E-mail address: [email protected]. 0099-2399/$ - see front matter Copyright ª 2011 American Association of Endodontists. doi:10.1016/j.joen.2010.08.042
D
uring dentin-pulp regeneration, interplay between pulp stem cells and signaling molecules (often derived from the dentin matrix) drives the process of reparative dentinogenesis (1, 2). Angiogenesis is fundamental to both tissue development and wound healing (3). The dental pulp has a rich vasculature, and the regressive changes seen in this vasculature after tooth development are reversed at sites of injury to provide effective nutrient delivery for reparative processes. Such revascularization may be effective in the treatment of immature permanent teeth with pulpal necrosis (4–6). Signaling of angiogenic events at sites of injury is critical for tissue repair, and proangiogenic growth factors, such as Vascular Endothelial Growth Factor (VEGF) (7–11), appear to be important mediators of this signalling. The expression of these growth factors by odontoblasts and cells in the core of the dental pulp (12–14) may contribute to the signaling of angiogenesis during reparative dentinogenesis, and pulp fibroblast expression of VEGF and Fibroblast Growth Factor -2 (FGF-2) has been implicated in the proangiogenic effects of these cells in vitro (13). However, the half-life of these growth factors can be very short, and for VEGF this is in the order of minutes (15). This implies the need for sustained expression or the release of such growth factors if they are to play a significant role in mediating angiogenic events. Sequestration of a number of angiogenic growth factors in the dentin matrix (16) provides a ‘‘fossilized’’ pool of these molecules protecting their bioactivity and allowing sustained release during matrix breakdown in caries or from the application of restorative materials (17, 18). Pulp tissue engineering in which stem cells from exfoliated deciduous teeth were seeded in a poly-L-lactic acid (PLLA)-based scaffold within a slice of a human tooth allowed differentiation of dentinsecreting odontoblasts, fibroblasts, and a microvascular network in the tissue construct (19). The authors of this study hypothesized that the local release of bioactive molecules from the tooth slice was responsible for morphogenic signaling of stem cell differentiation, resulting from the low pH generated by the PLLA scaffold degradation. The demonstration of the presence of angiogenic factors in the dentin matrix highlights their potential for participation in reparative events in the tooth, and the present study aims to investigate the functional activity of isolated dentin matrix components in angiogenesis.
Materials and Methods Preparation of Dentin Matrix Components An EDTA-soluble preparation of dentin matrix components was isolated by the extraction of powdered sound human dentin with 10% (w/v) EDTA (pH = 7.2) containing 10mmol/L of N-ethylmaleimide and 5 mmol/L of phenylmethylsulphonyl fluoride as protease inhibitors for 7 days at 4 C with a rotary mixer. After extraction, the preparation was exhaustively dialysed against distilled water before lyophilization (20).
In Vitro Endothelial Tube Angiogenesis Assay An in vitro endothelial tube commercial assay based on coculture of human endothelial cells on an interstitial cell feeder layer (AngioKit, TCS Cellworks, UK) was used to investigate the angiogenic effects of the dentin matrix preparation (0.0001 mg/mL-5 mm/mL concentration range) together with blank (medium alone), negative (20 mmol/L of suramin), and positive (recombinant VEGF 2 ng/mL) controls. This assay is well established for an in vitro study of endothelial cells in angiogenesis (21) and briefly involves the following: cells were cultured for 11 days in a humidified incubator in an atmosphere of 5% CO2 in air with media changes at 4, 7, and 9 days after which cells were fixed with 70% (v/v) ethanol. Branched, tubular, capillary-like structures were visualized immunohistochemically by staining for the endothelial markers
26
Zhang et al.
JOE — Volume 37, Number 1, January 2011
Basic Research—Biology PECAM1 (CD31) and von Willebrand factor according to the kit manufacturer’s instructions. Image analysis (Image-Pro Plus; MediaCybernetics, Bethesda, MD) was used to quantify the vessel number, the total length, and branch points.
Effects of Dentin Matrix Components on Endothelial Cell Proliferation The effects of a range of concentrations of dentin matrix components (0.0001-1 mg/mL) on human umbilical vein endothelial cell (HUVEC) proliferation was assessed in passage 3 primary HUVEC cells (Promocell, Heidelberg, Germany) cultured for up to 8 days in 24well plates (seeding density 5,700 cells/well) in endothelial cell supplemented medium (Promocell) at 37 C in an atmosphere of 5% CO2 in air. Viable cell counts were performed every other day using a hemocytometer slide after Trypan blue staining, and comparisons were made to control cultures in the absence of dentin matrix components. Statistical Analyses Data for the angiogenesis and proliferation assays were analyzed using the Mann-Whitney U test.
RNA Isolation and Semiquantitative–Polymerase Chain Reaction Analysis To investigate direct effects of dentin matrix components on endothelial cells, expression of VEGF and VEGF-R2 was examined in passage 3 HUVEC (Promocell) cultured in 35-mm dishes (seeding density 1.14 104 cells/mL) with endothelial cell supplemented medium (Promocell) in the presence or absence of dentin matrix components (0.0001-1 mg/mL). Total RNA for each growth condition was extracted after 9 days of culture using an RNeasy kit (Qiagen, Crawley, UK) according to the manufacturer’s instructions. One to 2 micrograms of DNase digested total RNA from each growth condition were reverse transcribed to single-stranded complementary DNA using an Omniscript Reverse Transcriptase kit (Qiagen). Semiquantitative-PCR analysis was performed using REDTaq ReadyMix PCR reaction mix with MgCl2 (Sigma Chemical Co, Gillingham, UK) and with the following primers: VEGF (F)-5’ CTGAGGAGTCCAACATCACCATG 3’; VEGF (R)-5’ CCTCGGCTTGTCACATCTGCAAG 3’ (product size: 353 bp); VEGF-R2 (F)-5’ TGCCTACCTCACCTGTTTCC 3’; VEGF-R2 (R)-5’-TGATATCCGGACTGGTAGCC-3’ (product size: 373 bp); GAPDH (F)-5’ CCACCCATGGCAAATTCCATGGCA 3’; and GAPDH (R)-5’ TCTAGACGGCAGGTCAGGTCCACC 3’ (product size: 550 bp). Briefly, 50
Figure 1. In vitro endothelial tube assay for angiogenic activity. (A) CD31 immunostaining after 11 days culture in the presence of 0.0001 to 5 mg/mL of dentin matrix components and blank (medium alone), negative (20 mmol/L suramin), and positive (2 ng/mL of VEGF) controls (magnification 40). Quantification of (B) the number of vessels, (C) the number of branch points, and (D) the total length of vessels (mm) (Statistically significant from control a p < 0.05, b p < 0.001).
JOE — Volume 37, Number 1, January 2011
Angiogenic Activity of Dentin Matrix Components
27
Basic Research—Biology ng of complementary DNA were used in a 25-mL PCR system, which was subjected to 30 to 35 cycles. Amplification was performed at 94 C for 30 seconds, 60 C to 68 C for 30 seconds and 72 C for 30 seconds. The PCR products were subjected to electrophoresis on a 1.5% agarose gel, which was stained with ethidium bromide. AIDA image analysis software (Raytest, Straubenhardt, Germany) was used to quantify the amplified products which were normalized against the human GAPDH housekeeping gene. Data presented are representative of three independent experiments.
Results Dentin Matrix Components Promote Angiogenesis in an In Vitro Endothelial Tube Assay Using an in vitro endothelial tube formation assay of angiogenesis, dentin matrix components showed dose-dependent effects on vessel total length, the numbers of vessels, and the numbers of branch points relative to control cultures (without the addition of inhibitors or
promoters of angiogenesis) (Fig. 1). All of these parameters were decreased when suramin (negative control) was included in the assay, whereas VEGF (positive control) showed increases in the vessel total length and the numbers of branch points but not the vessel number. Dentin matrix components showed maximal increases in all three assay parameters when added to cultures at a concentration of 0.01 mg/mL, and lesser increases were evident even at a concentration of 0.0001 mg/ mL. At concentrations of 0.1 mg/mL and higher, the dentin matrix components were found to be inhibitory to angiogenesis.
Effects of Dentin Matrix Components on Endothelial Cell Proliferation and Gene Expression Dose-dependent effects of dentin matrix components on HUVEC proliferation were observed with maximal effects observed at a concentration of 0.0001 mg/mL when added to cultures (Fig. 2). Higher concentrations of dentin matrix components provided less stimulation of HUVEC proliferation, and concentrations of 0.1 and 1.0 mg/mL were observed to inhibit HUVEC proliferation.
100000 90000 80000
Medium
Cells/Well
70000
0.0001
60000
0.001
50000
0.01
40000
0.1
30000
1
20000 10000 0 0
2
4
6
8
10
Days 140
VEGF-R2
120 100
1.0
0.1
0.01
GAPDH
0.001
VEGF
0.0001
Control VEGF-R2
Relative expression level
80 60 40 20 0 C
0.0001
0.001
0.01
160 140 120 100 80 60 40 20 0
0.1
1
VEGF
C
0.0001
0.001
0.01
0.1
1
Dentin matrix components (mg/ml)
Figure 2. Endothelial cell behavior in the presence of 0.0001 to 1 mg/mL of dentin matrix components and control (medium alone). (A) Cell proliferation analysis for up to 8 days in culture. (B) Relative levels of VEGF and VEGFR2/KDR gene expression.
28
Zhang et al.
JOE — Volume 37, Number 1, January 2011
Basic Research—Biology Dentin matrix components showed a dose-dependent response in the expression of the proangiogenic growth factor VEGF and its receptor VEGFR2 (Fig. 2). A concentration of 0.01 mg/mL of dentin matrix components showed optimal expressions of these genes. Although this was the only concentration to up-regulate VEGFR2 expression, VEGF showed a progressive up-regulation from 0.0001 to 0.01 mg/ mL. Concentrations of 0.01 or 1.0 mg/mL of dentin matrix components caused a decrease in the expression levels of these genes.
Discussion Angiogenesis is fundamental to both tissue development and wound healing (3). During pulpal healing, revasularization is key to the maintenance of tissue vitality although the mechanisms underlying such revascularization are unclear. Dentin contains a rich cocktail of growth factors and cytokines (2, 22, 23) that are sequestered in the matrix during dentinogenesis through their interactions with proteoglycans and other extracellular matrix components (24, 25). This fossilized store of bioactive molecules protects them from degradation in the absence of dental disease and provides a reservoir of signaling molecules to initiate regenerative events in the tissue after injury. A number of proangiogenic growth factors have been isolated from dentin (16, 26), but to date only preliminary investigations of their potential functional activity have been undertaken (27). In the present study, we have shown that isolated dentin matrix components have stimulatory effects on endothelial cell proliferation even at the low concentration of 0.0001 mg/mL and that at higher concentrations (0.1 and 1.0 mg/mL) these components inhibited endothelial cell proliferation. Such stimulatory effects of dentine matrix components on cellular proliferation parallel those seen in odontoblast-like, pulp-derived, and fibroblast cell lines (28). In the in vitro endothelial tube formation assay of angiogenesis, dentin matrix components showed positive dose-dependent effects on vessel total length, the numbers of vessels, and the numbers of branch points relative to control cultures (without addition of inhibitors or promoters of angiogenesis). Although the same dose-dependent trends were seen in the endothelial cell proliferation and endothelial tube formation assays, the peak effects in the latter occurred at a higher concentration of dentin matrix components, perhaps reflecting the greater complexity of endothelial tube formation versus simple cellular proliferation. A central role for VEGF in angiogenesis is well recognized, and in vitro VEGF positively regulates many endothelial cell functions including proliferation, migration, and capillary sprouting (29–31). Indeed, VEGF is also able to induce endothelial cell differentiation in the Stem cells from Human Exfoliated Deciduous teeth (SHED) population of dental pulp stem cells (32). Interestingly, the proangiogenic effects of dentin matrix components in the present study were observed at concentrations that contained much lower levels of VEGF than the positive VEGF control for the assay. Dentin matrix preparations at concentrations of 0.0001 to 0.01 mg/mL will contain approximately 10 4 to 10 6 ng/mL of VEGF based on the levels reported in these preparations (16), whereas the VEGF-positive control in the endothelial tube formation assay was at a concentration of 2 ng/mL and gave rise to similar proangiogenic responses. Little information exists on the angiogenic effects of treatment with multiple growth factors, but it appears that the cocktail of growth factors derived from dentin matrix acts synergistically, leading to an appreciable amplification of the angiogenic effects. VEGF has been reported to attenuate actions of TGF-ß in endothelial cells at the transcriptional and intracellular signalling levels (33), and such interactions may help to explain some of these synergistic actions of components derived from the dentin matrix. Although the proangiogenic activity of the dentin matrix components cannot be ascribed to any JOE — Volume 37, Number 1, January 2011
one growth factor or cytokine, exciting opportunities exist for study of the complex and synergistic interactions between these molecules. Although the treatment of endothelial cells with optimal concentrations of dentin matrix components for angiogenesis only led to moderate increases in expression of the VEGF-R2 or its ligand by the endothelial cells, at higher concentrations (0.1 and 1.0 mg/mL) of dentin matrix components the expressions of these genes were suppressed. This parallels the data for both endothelial and pulp-derived (28) cell proliferation and the in vitro tube formation assay in which these higher levels of dentin matrix components were also inhibitory. These inhibitory effects were prominent at higher concentrations of dentin matrix components and highlight the potential impact of release of these components on tissue regeneration in more active carious lesions. Regeneration in the dentin-pulp complex after injury is a fine balance between the stimulatory molecular signaling events and the inhibitory influences of inflammatory and other defense processes. Comparisons of tissue responses to active and more slowly progressing carious lesions suggest that pulpal repair and regeneration are compromised in more active lesions (34, 35). This may in part reflect the persistent tissue challenge from bacterial metabolites in more active lesions but also the effects of the higher concentrations of dentin matrix components being released. Although these effects cannot be ascribed to any one component in such a complex mixture of molecules, many of the growth factors and cytokines present in dentin have multifunctional effects, and molecules like TGF-b are known to stimulate many cellular formative events as well as being able to induce apoptosis at higher concentrations (36, 37). Thus, the identification of teeth with less active disease may be prudent in the selection of clinical cases for regenerative endodontic treatment. This study has shown the proangiogenic effects of dentin matrix components and highlights the potential of these molecules in stimulating angiogenic events associated with revascularization during pulp repair and regeneration. The co-operative action of angiogenic growth factors sequestered in the dentin matrix together with those expressed by fibroblasts and other cells in the pulp core provides a powerful mechanism for self-healing in the pulp. The dose dependency of these angiogenic effects indicates that careful selection of clinical cases for revascularization should maximize opportunities for positive treatment outcomes.
References 1. Smith AJ, Lesot H. Induction and regulation of crown dentinogenesis—embryonic events as a template for dental tissue repair. Crit Rev Oral Biol Med 2001;12: 425–37. 2. Goldberg M, Smith AJ. Cells and extracellular matrices of dentin and pulp: biological strategies for repair and tissue engineering. Crit Rev Oral Biol Med 2004;15:4–12. 3. Folkmann J, Shing Y. Angiogenesis. J Biol Chem 1992;267:1093–14. 4. Jung IY, Lee SJ, Hargreaves KM. Biologically based treatment of immature permanent teeth with pulpal necrosis: a case series. J Endod 2008;34:876–87. 5. Thibodeau B, Teixeira F, Yamauchi M, et al. Pulp revascularization of immature dog teeth with apical periodontitis. J Endod 2007;33:680–9. 6. Seale NS, Glickman GN. Contemporary perspectives on vital pulp therapy: views from the endodontists and pediatric dentists. J Endod 2008;34:S57–61. 7. Telles PD, Hanks CT, Machado MA, et al. Lipoteichoic acid up-regulates VEGF expression in macrophages and pulp cells. J Dent Res 2003;82:466–70. 8. Grando Mattuella L, Westphalen Bento L, de Figueiredo JA, et al. Vascular endothelial growth factor and its relationship with the dental pulp. J Endod 2007;33: 524–30. 9. Mullane EM, Dong Z, Sedgley CM, et al. Effects of VEGF and FGF2 on the revascularization of severed dental pulps. J Dent Res 2008;87:1144–8. 10. Soden RI, Botero TM, Hanks CT, et al. Angiogenic signalling triggered by cariogenic bacteria in pulp cells. J Dent Res 2009;88:835–40. 11. Botero TM, Son JS, Vodopyanov D, et al. MAPK signalling is required for LPSinduced VEGF in pulp stem cells. J Dent Res 2010;89:264–9. 12. Artese L, Rubini C, Ferrero G, et al. Vascular endothelial growth factor (VEGF) expression in healthy and inflamed human dental pulps. J Endod 2002;28:20–3.
Angiogenic Activity of Dentin Matrix Components
29
Basic Research—Biology 13. Tran-Hung L, Mathieu S, About I. Role of human pulp fibroblasts in angiogenesis. J Dent Res 2006;85:819–23. 14. Scheven BA, Man J, Millard JL, et al. VEGF and odontoblast-like cells: stimulation by low frequency ultrasound. Arch Oral Biol 2009;54:185–91. 15. Eppler SM, Combs DL, Henry TD, et al. A target-mediated model to describe the pharmacokinetics and hemodynamic effects of recombinant human vascular endothelial growth factor in humans. Clin Pharmacol Ther 2002;72:20–32. 16. Roberts-Clark D, Smith AJ. Angiogenic growth factors in human dentine matrix. Arch Oral Biol 2000;45:1013–6. 17. Graham L, Cooper PR, Cassidy N, et al. The effect of calcium hydroxide on solubilisation of bio-active dentine matrix components. Biomaterials 2006;27:2865–73. 18. Tomson PL, Grover LM, Lumley PJ, et al. Dissolution of bio-active dentine matrix components by mineral trioxide aggregate. J Dent 2007;35:636–42. 19. Cordeiro MM, Dong Z, Kaneko T, et al. Dental pulp tissue engineering with stem cells from exfoliated deciduous teeth. J Endod 2008;34:962–9. 20. Smith AJ, Tobias RS, Plant CG, et al. In vivo morphogenetic activity of dentine matrix proteins. J Biol Buccale 1990;18:123–9. 21. D’Andrea LD, Iaccarino G, Fattorusso R, et al. Targeting angiogenesis: structural characterization and biological properties of a de novo engineered VEGF mimicking peptide. Proc Nat Acad Sci U S A 2005;102:14215–20. 22. Smith AJ. Vitality of the dentin-pulp complex in health and disease: growth factors as key mediators. J Dent Educ 2003;67:678–89. 23. Cooper PR, Takahashi Y, Graham LW, et al. Inflammation-regeneration interplay in the dentine-pulp complex. J Dent 2010;38:687–97. 24. Baker SM, Sugars RV, Wendel M, et al. TGF-ß/extracellular matrix interactions in dentin matrix: a role in regulating sequestration and protection of bioactivity. Calc Tiss Int 2009;85:66–74. 25. Smith AJ, Matthews JB, Hall RC. Transforming growth factor- b1 (TGF- b1) in dentine matrix: ligand activation and receptor expression. Eur J Oral Sci 1998; 106:179–84.
30
Zhang et al.
26. Cassidy N, Fahey M, Prime SS, et al. Comparative analysis of transforming growth factor-beta (TGF- b) isoforms 1-3 in human and rabbit dentine matrices. Arch Oral Biol 1997;42:219–23. 27. Pearce SC, Hudlicka O, Smith AJ. In vivo effects of dentine matrix on angiogenesis in rat skeletal muscle. J Dent Res 1996;75:173. 28. Musson DS, McLachlan JL, Sloan AJ, et al. Adrenomedullin is expressed during rodent dental tissue development and promotes cell growth and mineralisation. Biol Cell 2010;102:145–57. 29. Risau W, Flamme I. Vasculogenesis. Annu Rev Cell Dev Biol 1995;11:73–91. 30. Pepper MS, Ferrara N, Orci L, et al. Potent synergism between vascular endothelial growth factor and basic fibroblast growth factor in the induction of angiogenesis in vitro. Biochem Biophys Res Commun 1992;89:824–31. 31. Holmes DI, Zachary I. The vascular endothelial growth factor (VEGF) family: angiogenic factors in health and disease. Genome Biol 2005;6:209–19. 32. Sakai VT, Zhang Z, Dong Z, et al. SHED differentiate into functional odontoblasts and endothelium. J Dent Res 2010;89:791–6. 33. Yamauchi K, Nishimura Y, Shigematsu S, et al. Vascular endothelial cell growth factor attenuates actions of transforming growth factor- b in human endothelial cells. J Biol Chem 2004;279:55104–8. 34. Bjørndal L, Darvann T, Thylstrup A. A quantitative light microscopic study of the odontoblast and subodontoblastic reactions to active and arrested enamel caries without cavitation. Caries Res 1998;32:59–69. 35. Bjørndal L, Darvann T. A light microscopic study of odontoblastic and nonodontoblastic cells involved in tertiary dentinogenesis in well-defined cavitated carious lesions. Caries Res 1999;33:50–60. 36. Schuster N, Krieglstein K. Mechanisms of TGF-beta-mediated apoptosis. Cell Tiss Res 2002;307:1–14. 37. Wu DT, Bitzer M, Ju W, et al. TGF- b concentration specifies differential signalling profiles of growth arrest/differentiation and apoptosis in podocytes. J Am Soc Nephrol 2005;16:3211–21.
JOE — Volume 37, Number 1, January 2011