Cloning and characterization of an NBS-LRR resistance gene from peanuts (Arachis hypogaea L.)

Physiological and Molecular Plant Pathology 84 (2013) 70e75

Contents lists available at ScienceDirect

Physiological and Molecular Plant Pathology journal homepage: www.elsevier.com/locate/pmpp

Cloning and characterization of an NBS-LRR resistance gene from peanuts (Arachis hypogaea L.) Chun-juan Li a,1, Yu Liu a, b,1, Yi-xiong Zheng a, Cai-xia Yan a, Ting-ting Zhang a, Shi-hua Shan a, * a b

Shandong Peanut Research Institute, Qingdao 266100, PR China Ocean University of China, Qingdao 266000, PR China

a r t i c l e i n f o

a b s t r a c t

Article history: Accepted 19 July 2013

The nucleotide-binding site (NBS)-leucine-rich repeat (LRR) gene family accounts for the largest number of known disease resistance genes and is one of the largest gene families in plant genomes. In this study, resistance gene analogs (RGAs) were isolated from peanuts based on the NBS domain. A full-length cDNA, PnAG3, was obtained by rapid amplification of cDNA ends (RACE). Sequence analysis indicated that the length of PnAG3 was 1882 bp, which included a complete open reading frame of 1335 bp that encoded for the PnAG3 protein composed of 444 amino acids. Multiple analyses showed that this protein had homology with known resistance proteins, the highest being 48.01% with a resistance protein from Arachis cardenasii. The polypeptide has a typical non-TIR-NBS-LRR gene structure. Real-time fluorescence quantitative PCR analysis showed that after Aspergillus flavus infection, expression of the PnAG3 gene in J11 (A. flavus-resistant species) increased by 16.68, 11.16 and 25.96 in the seed coat, kernel and pericarp, respectively. However, it only increased 2e3 times in JH1012 (A. flavus-sensitive species). Cloning of the putative resistance gene from peanut provides a basis for studying the structure and function of peanut disease resistance-related genes and disease resistance genetic breeding in peanuts. Ó 2013 Published by Elsevier Ltd.

Keywords: Peanut NBS-LRR Bioinformatics Real-time fluorescence quantitative PCR Aspergillus flavus Resistance

1. Introduction The peanut (Arachis hypogaea L.) is one of the four major oil crops in the world. For years, peanuts have been the highest export crop in China. However, the peanut is susceptible to Aspergillus flavus infection and pests, which result in reduced quantity and quality, especially when peanuts are affected by aflatoxin contamination. It is known that peanut A. flavus infection and its subsequent accumulation of toxic and carcinogenic secondary metabolites due to aflatoxin are serious agricultural problems, especially in dry conditions. In recent years, the European Union (EU), Association of Southeast Asian Nations (ASEAN), Japan and other peanut importing countries have made standards of peanut aflatoxin and pesticide residues more stringent. Peanut production areas with aflatoxin contamination cannot be resolved in the longterm. Furthermore, excessive levels of aflatoxin in peanuts limit the ability of the peanuts to be exported. Therefore, studies on resistant

* Corresponding author. Tel.: þ86 532 87629307. E-mail address: [email protected] (S.-h. Shan). 1 The first and second author have the same contribution. 0885-5765/$ e see front matter Ó 2013 Published by Elsevier Ltd. http://dx.doi.org/10.1016/j.pmpp.2013.07.006

varieties of peanuts should improve the understanding of resistance mechanisms to A. flavus and the methods for cultivating A. flavus-resistant peanut varieties. Through evolution, plants gradually acquired defense mechanisms to defend themselves against invading microbial pathogens, nematodes and insects; these mechanisms include structural defenses (such as thick cuticles), inhibitors (phenolic compounds, tannins, lectins, etc.), enzymes (chitinase and glucanase enzymes) and specific pathogen recognition mechanisms. The identification mechanism includes cell wall thickening, resistance gene (R gene) expression and apoptosis. Recent studies have focused on R gene cloning [1]. Genetic analysis of genetic resistance to rust and flax rust fungus pathogenicity produced the first introduction of the gene-for-gene interaction theory [2]. According to Flor’s gene-forgene hypothesis, there are coevolution relationships between plants and pathogens [3]. Each R gene of the host plant has a corresponding “non-toxic gene” pathogen. Additionally, in pathogens, there are “virulence genes” corresponding to “non-toxic genes”. The pathogens that contain “non-toxic genes” or “virulence genes” have no affinity or affinity to the host plant that have R genes, respectively [4]. The study showed that virulence genes show diversity; however, there are only five types of corresponding R

C.-j. Li et al. / Physiological and Molecular Plant Pathology 84 (2013) 70e75 Table 1 Degenerate primers.

71

Table 2 Primers used in the study.

Primer name

Conserved domain

Conserved motif

Primer sequence (50 e30 )

Pf1 Pr1

P-loop GLPL

GMGGVGKTT GLPLALKV

GGNATGGGNGGNGTNGGNAARACNAC NACYTTNAGNGCNAGNGGNAGNCC

Note: f: forward primer, r: reverse primer. N ¼ A/T/C/G, R ¼ AG, Y ¼ CT.

genes, of which, the NBS-LRR family is the most abundant and includes defense against fungi, bacteria, viruses, nematodes, etc. [5e 8]. At present, R genes have been successfully cloned from maize [9], grapefruit [10], rice [11], wheat [12]and potato [13]. Analysis of amino acid sequences of these R genes shows that most of the plant R genes encode NBS-LRR resistance proteins, such as the wheat leaf rust R gene and downy mildew. NBS (Nucleotide Binding Site) R genes are the largest category of plant disease R genes. The NBS conserved domain contains many conserved motifs, such as p-loop, kinase 2, kinase 3a and transmembrane domain GLPL [21], and may contribute to disease resistance signal transduction and play an important role in plant disease resistance. Because of the complexity of peanut genomics, the use of transposon tagging and map-based cloning to clone R genes has been very difficult in peanuts. From the above analysis, a simple, effective and feasible method to clone NBS R genes in peanuts is to design a pair of degenerate primers according to the NBS conserved regions. Using this method, the A. flavus resistance gene had been cloned in soybean, sweet potato, corn and other plants. Peanuts have high homology to soybean, sweet potato and corn; therefore, it can be deduced that the NBS-LRR R gene may also exist in peanut. On the basis of the analysis of the NBS conserved domain and some cloned R genes, we designed a pair of degenerate primers to clone the peanut NBS R gene, which lays the foundation for breeding peanuts with resistance to A. flavus. 2. Materials and methods 2.1. Materials The peanut cultivars J11 (A. flavus-resistant species) and JH1012 (A. flavus-sensitive species) were cultivated in the test field of Shandong Peanut Research Institute, China. Forty-five days before harvest, peanuts were infected with A. flavus. Infected plants were sampled three times every 10 days. Samples were taken from the seed coat, pericarp and kernel from each peanut species and kept at 80  C. The Escherichia coli strains DH5a and BL21 and PCR cloning vector pEASY-T and pMD-18-T were purchased from TIANGEN Biotech Company (Beijing). The SMARTerÔ RACE cDNA Amplification Kit was purchased from BD Bioscience Clontech Company (Palo Alto, California, USA). M-MLV transcriptase, SYBR Premix Ex Taq, restriction enzymes and the remaining enzymes were purchased from TaKaRa Biotechnology Company (Dalian, China). All other chemical reagents were of analytic purity. 2.2. Genomic DNA extraction and amplification of genomic NBS fragments Genomic DNA was extracted with cetyltrimethyl ammonium bromide (CTAB), as described by Rogers (1988). The quality and concentration of DNA were measured with electrophoresis and a spectrophotometer. By analyzing RGA sequences reported by Bertioli [1], two degenerate primers, Pf1 and Pr1 (Table 1), were designed to amplify the internal conservative fragment of the NBS domain.

Primer name

Primer sequence (50 e30 )

Company

GSP1 GSP2 GSP1-2 GSP2-2 AG3-F AG3-R DF-F DF-R PRAG3 PFAG3

GCAGCAACTCTCAATGGCAAGCACAAC ATTGTTGCCACTGCTTCTCCTTACCAG AGACAAGTTGAGCAAGAGTAGT ATTGTTGCCACTGCTTCTCCTTACCAG TGTGGAGTGTGCTTGTAGGG GCTTCGTGTCGTCACCAGTA GAGGAGAAGCAGAAGCAAGTTG AGACAGCATATCGGCACTCATC TGGTCGACATCAAGAGCAATAGGC GCGGATCCATGGAAAGTGTTCTGTT

TaKaRa TaKaRa TaKaRa TaKaRa TaKaRa TaKaRa TaKaRa TaKaRa TaKaRa TaKaRa

PCR mixture total volume was 25 mL, which contained 25 ng of template DNA, 1 U Taq polymerase, 0.2 mM dNTPs, 2.5 mL 10 PCR buffer (with Mg2þ) and 0.4 mM of each primer. Cycling conditions were as follows: denaturation at 94  C for 5 min; 35 cycles at 94  C for 1 min, 58  C for 1 min and 72  C for 90 s; followed by 10 min at 72  C. PCR products were separated by size on a 1.0% agarose gel and the appropriately sized band was recovered (TIANGEN) and cloned into the pEASY-T1 vector. Recombinant clones were sequenced by TaKaRa Biotechnology Company (Dalian, China). 2.3. Total RNA extraction and first-strand cDNA synthesis Total RNA was extracted with a Plant RNA Kit (OMEGA, USA) according to the manufacturer’s instructions. The quality and concentration of RNA were measured by electrophoresis and a spectrophotometer. First-strand cDNA synthesis was performed using a SMARTerÔ RACE cDNA Amplification Kit (Clontech, Palo Alto, California, USA) and an M-MLV transcriptase according to the manufacturer’s instructions. 2.4. RACE From the DNA fragment obtained above, two gene-specific primers, GSP1 for 50 -RACE, and GSP2 for 30 -RACE, were designed (Table 2). The 30 -cDNA ends and 50 -cDNA ends were amplified using a SMARTerÔ RACE cDNA Amplification Kit following the user manual (Clontech, Palo Alto, California, USA). The amplification profile was as follows: denaturation at 94  C for 5 min; 5 cycles at 94  C for 30 s and 72  C for 3 min; 5 cycles at 94  C for 30 s, 70  C for 30 s and 72  C for 3 min; 27 cycles at 94  C for 30 s, 60  C for 30 s and 72  C for 3 min; and 10 min at 72  C. For 50 -RACE and 30 -RACE, the PCR products were smeared, so two anchor primers, GSP1-2 for 50 -RACE and GSP2-2 and 30 -RACE, were designed for nested PCR. This approach used the smear products as a template to amplify the 50 -cDNA ends and 30 -cDNA ends. The PCR products were purified by gel extraction and cloned into the pMD-18T vector. Recombinant clones were sequenced by TaKaRa Biotechnology Company (Dalian, China). 2.5. Full-length cDNA amplification of PnAG3 By comparing and aligning internal DNA fragments of the 50 RACE and 30 -RACE product sequences with BIOXM software (ver.2.6) package, the full-length cDNA was deduced and obtained through RT-PCR amplification, which was performed with genespecified primers PRAG3 and PFAG3 (Table 2), and named PnAG3.

72

C.-j. Li et al. / Physiological and Molecular Plant Pathology 84 (2013) 70e75

2.6. Bioinformatics analysis Database searches for similarity were performed using BLASTN and BLASTX algorithms against the GenBank database. The sequences were translated to suitable open reading frames using the ORF Finder in the NCBI database (http://www.ncbi.nlm.nih.gov/ gorf/gorf.html). Multiple alignments of deduced amino acid sequences and the phylogenetic tree were performed using DNAMAN. 2.7. Functional analysis of PnAG3 gene with real-time fluorescence quantitative PCR Real-time fluorescence quantitative PCR was used to investigate PnAG3 expression profiles in various tissues of peanut before and after A. flavus infection. Total RNA was extracted separately from tissues including seed coat, kernel and pericarp of two types of peanut species and quantified with electrophoresis and a spectrophotometer. Reverse transcription PCR was performed with a PrimeScriptÔ RT reagent Kit (Perfect Real Time) (TaKaRa). The system volume was 10 mL and contained 2 mL of 5 PrimeScriptÔ Buffer (for Real Time), 0.5 mL PrimeScriptÔ RT Enzyme Mix 1, 0.5 mL of Oligo dT primer (50 mmol/L), 0.5 mL of random 6-mers (100 mmol/L) and 500 ng of total RNA as a template. The reverse transcription was programmed at 37  C for 15 min and 85  C for 5 s. Real-time fluorescence quantitative PCR analysis was performed by SYBRÒ Premix Ex TaqÔ (Perfect Real Time) (TaKaRa) with the cDNA products obtained as the templates. The 25 mL of reaction system solution consisted of 12.5 mL of SYBR Premix Ex Taq, 0.5 mL each of the forward and reverse primers, 4 mL of cDNA template and 7.5 mL of sterilized water. Each sample was amplified three times. PCR was carried out using a LightCycler480 Real-time PCR System with an initial heat activation step at 94  C for 2 min and for fluorescence collection, amplifications were conducted for 45 cycles at 94  C for 15 s, 62  C for 15 s and 72  C for 20 s. A final extension reaction was performed by increasing the mixture by

0.2  C from 62  C to 94  C to construct a melting curve. The mixture was then cooled to 40  C over 30 s. 2.7.1. Standard curve Total RNA was extracted from the seed coat of J11. Reverse transcription PCR and real-time PCR were performed as described above. The PCR products of PnAG3 and DF-actin genes were purified by gel extraction and cloned into the pMD-18T vector and transformed into E. coli DH5a-competent cells. Recombinant clones were identified by colony PCR and sequencing. Then, plasmid was extracted with a plasmid extraction kit. The plasmid was diluted 50 times to determinate its concentration. Plasmid that was diluted 10-fold was used as the template for real-time fluorescence quantitative PCR. According to CP values and the logarithm of gene copy number, standard curves of the PnAG3 gene and DF-actin gene were mapped. 2.7.2. Relative quantification of the PnAG3 gene Total RNA from different peanut species and different times was prepared as described above. According to the sequence of PnAG3, two primers, AG3-F and AG3-R (Table 2), were designed to amplify a product of 202 bp. A constitutively expressed gene, DF-Actin, was used as an internal control to verify the quantitative real-time PCR reaction. Two primers, DF-F and DF-R, were used to amplify a 106 bp fragment of the peanut DF-Actin gene cDNA (Table 2). Realtime fluorescence quantitative PCR was carried out as previously described. Each sample was repeated 3 times. The treatment CP value is 3 times the mean value. Different treatment data were normalized to the internal reference gene. The hyperbolic method DC/A was used to calculate the F value (F ¼ 10DC/A T.TT T,RR). LightCycler Software 2.0 (Roche, CA) was used to analyze the amplification curves, the melting curves and the dissolution curves after the reaction. Real-time fluorescence quantitative PCR products were detected by electrophoresis on a 1% agarose gel. LightCycler 2.0 and SPSS software were used for statistical analysis.

Fig. 1. The conserved domain comparison between the deduced amino acid sequence of the PnAG3 gene and 8 known disease resistance proteins. Note: Sequences were aligned using the CLUSTAL W program. Gaps have been introduced to optimize the alignment. Identical and conserved amino acids are shaded in blue and pink, respectively. The sources of the proteins and GenBank accession numbers are as follows: rga3 (AAP45181.2) from Solanum bulbocastanum, B149 (AAR29073.1) from Solanum bulbocastanum, RGA2 (XP_002513098.1) from Ricinus communis, protein-like (AAU89637.1) from Poncirus trifoliata, C8_V_253 (AAN85399.1) from Arachis cardenasii, cc-nbs-lrr (XP_002297751.1) from Populus trichocarpa, leucine-rich_rep (XP_002513078.1) from Ricinus communis and Rpi-bt1 (ACI16480.1) from Solanum bulbocastanum. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

C.-j. Li et al. / Physiological and Molecular Plant Pathology 84 (2013) 70e75

73

domains at the N-terminus of their products. The first group comprises genes encoding a conserved leucine-zipper-like pattern (nonTIR). The second group contains genes whose products contain a structure homologous to human interleukin-1 and Drosophila Toll-like receptor regions (TIR). The last amino acid of kinase-2 of TIR can be any amino acid but is usually aspartic acid (D). However, the last amino acid of kinase-2 of nonTIR and PnAG3 was tryptophan (W). PnAG3 had a typical structure of nonTIR-NBS-LRR genes with RNBS-A-nonTIR (FnLxAWVCvSQxF) domains. The deduced amino acid sequence for the ORF of the PnAG3 gene showed 15.81, 15.52, 12.55, 17.12, 48.01, 15.93, 15.40 and 15.77% similarity with rga3 (AAP45181.2) from Solanum bulbocastanum, B149 (AAR29073.1) from S. bulbocastanum, RGA2 (XP_002513098.1) from Ricinus communis, protein-like (AAU89637.1) from Poncirus trifoliata, C8_V_253 (AAN85399.1) from Arachis cardenasii, cc-nbs-lrr (XP_002297751.1) from Populus trichocarpa, leucine-rich_rep (XP_002513078.1) from R. communis and Rpi-bt1 (ACI16480.1) from S. bulbocastanum, respectively. Phylogenetic analysis showed that the PnAG3 gene from peanut was more similar to C8_V_253 from A. cardenasii (Fig. 2).

Fig. 2. Phylogenetic tree of the deduced amino acid sequence of the PnAG3 gene.

3. Results 3.1. Cloning of the PnAG3 internal DNA fragment A PnAG3 DNA fragment of 539 bp was amplified by PCR with the two degenerate primers Pf1 and Pr1 (data not shown). Sequence analysis showed that the PnAG3 DNA fragment contained a single uninterrupted open reading frame (ORF). The deduced amino acid sequence showed internal motifs characteristic of the NBS-LRR gene class. The BLASTX analysis indicated that the amplified sequence shared high similarity with other known species with an NBS-type resistance protein. 3.2. Isolation and characterization of the full-length cDNA of PnAG3 Based on the PnAG3 fragment, two gene specific primers (GSP1 and GSP2) were synthesized for the amplification of the PnAG3 cDNA 50 -end and 30 -end. The 50 -RACE and 30 -RACE products were smeared, so other anchor primers, GSP1-2 for 50 -RACE nest PCR and GSP1-1 for 30 -RACE nest PCR, were designed, which resulted in a fragment of approximately 750 bp for 50 -RACE and 800 bp for 30 RACE (data not shown). By comparing and aligning the sequences of the internal fragments of the 30 RACE and 50 RACE products, the full-length cDNA of PnAG3 was obtained. The full-length cDNA of PnAG3 was 1876 bp, which was predicted to have an ATG initiation codon at position 47 bp and a TGA stop codon at position 1381 bp according to the ORF Finder in the NCBI database (http://www.ncbi.nlm.nih.gov/ gorf/gorf.html) (data not shown). The cDNA sequence contained a 1335 bp open reading frame (ORF) encoding a protein of 444 amino acid residues with a polyadenylation tail, an isoelectric point (pI) of 5.46 and calculated molecular weight of approximately 50.36 kDa. 3.3. Sequence analysis Sequence analysis showed the protein translated from the PnAG3 gene contained conserved NBS motifs such as P-loop, kinase2, kinase-3a, GLPL and RNBS-C (YEVxxLSDEEAWELFCKxAF) motifs (Fig. 1). According to previous work by Meyers, NBS-LRR genes are further subdivided into two categories based on conserved

3.4. Expression analysis of the PnAG3 gene in peanut 3.4.1. Standard curve of fluorescence quantitative PCR Standard curves of both the internal control and the target gene had a wide linear range, and dilutions of the cDNA template to 101, 102, 103, 104 and 105 of the initial concentration were within the linear range (Tables 3 and 4). The Ct value and the logarithm of the template concentration were well correlated (R2 larger than 0.99). The standard curves for amplification were in accordance with the PCR exponential amplification and had no undesirable components (Figs. 3 and 4). These results showed that the PCR reaction had good specificity and no primer dimers or nonspecific amplifications were generated. The agarose gel electrophoresis validated the specificity. Furthermore, the 3 replicates for amplification produced identical results in each sample, indicating the repeatability and the reliability of the experimental procedure. 3.4.2. Expression analysis of PnAG3 in response to A. flavus infection To evaluate the contribution of PnAG3 to resistance against A. flavus infection, real-time fluorescence quantitative PCR was performed with AG3-F and AG3-R to detect the transcripts of the PnAG3 gene from the seed coat, kernel and pericarp of two types of peanut species after A. flavus infection. Fig. 4 As shown in Table 5, the PnAG3 gene could be expressed in different parts of a variety of peanuts. Cp values from fluorescent quantization of real-time fluorescence quantitative PCR were computed by the LightCycler 2.0 software and based on the standard curve, and it could be concluded that the expression of PnAG3 increased in different parts and different peanut varieties after A. flavus infection. The resistance towards A. flavus increased with expression of the PnAG3 gene, with different plant parts and peanut types expressing the gene more highly than others. Compared to the A. flavus-sensitive species JH1012, A. flavus-resistant species J11 had a relatively higher expression of PnAG3 in the seed coat, kernel and pericarp. After A. flavus infection, the expression of PnAG3 in J11 increased by 16.68, 11.16 and 25.96 in the seed coat, kernel and pericarp, respectively. In contrast, it only increased 2e3 times in

Table 3 Copy numbers of the DF-actin gene. Dilution

101

102

103

104

105

106

Copy number

9.58  1011

9.58  1010

9.58  109

9.58  108

9.58  107

9.58  106

74

C.-j. Li et al. / Physiological and Molecular Plant Pathology 84 (2013) 70e75

Table 4 Copy numbers of the PnAG3 gene. Dilution

101

102

103

104

105

106

Copy number

5.38  1012

5.38  1011

5.38  1010

5.38  109

5.38  108

5.38  107

JH1012. From these results, we can speculate that the function of PnAG3 is positively correlated with resistance to A. flavus infection or that expression of PnAG3 is induced by A. flavus infection. 4. Discussion The study of R genes is one of the key subjects of plant science. Cloning and characterization of R genes not only facilitate the understanding of molecular mechanisms of the interaction between host and pathogens but also provide opportunities for breeding of disease-resistant crops [22,23]. Since the first plant R gene Hm1 was cloned in 1992 [14], people have used position cloning, transposon tagging and homology cloning technology to label more than 70 plant R genes and their analogs from many varieties of plants [15]. Analysis of these amino acid sequences encoded by these cloned genes revealed that they are highly conserved in some segments and that most of them were NBS-LRR disease resistance proteins. This makes homology cloning technology interesting to researchers. The peanut is one of the crops vulnerable to A. flavus, and currently there is no effective A. flavus-resistant peanut species. Therefore, cloning of R genes from the peanut is the focus of ongoing research. The homology cloning method is simple and has a high success rate; using this technique, we used an NBS-LRR-conserved region to design a pair of degenerate primers. Combined with RACE technology, we successfully cloned an NBS-LRR R gene (PnAG3) from peanut. The gene ORF is 1335 bp and encodes 444 amino acids. The deduced amino acid sequence for the ORF of PnAG3 gene showed 15.81%, 15.52%, 12.55%, 17.12%, 48.01%, 15.93%, 15.40% and 15.77% homology with rga3 (AAP45181.2) from S. bulbocastanum, B149 (AAR29073.1) from S. bulbocastanum, RGA2 (XP_002513098.1) from R. communis, protein-like (AAU89637.1) from Poncirus trifoliata, C8_V_253 (AAN85399.1) from A. cardenasii, cc-nbs-lrr (XP_002297751.1) from P. trichocarpa, leucine-rich_rep (XP_002513078.1) from R. communis and Rpi-bt1 (ACI16480.1) from S. bulbocastanum, respectively. Phylogenetic analysis showed PnAG3 gene is most similar to

Fig. 3. The amplification curves of the DF-actin gene by RT-PCR.

C8_V_253 from A. cardenasii. The peptide encoded by PnAG3 not only has an NBS-LRR conserved sequence P-loop and GLPL but also contains the kinase-2, kinase-3a (GSRVLVTTR) and RNBS-C (YEVxxLSDEEAWELFCKxAF) sequences. Therefore, it can be confirmed that PnAG3 is an NBS-LRR gene. The NBS domains are characteristic of various proteins with ATP/GTP binding activity and comprise the P-loop, kinase 2a, kinase 3a and GLPL motifs [21], while LRR domains play roles in proteine protein interactions [24]. These proteins have an important role in cell growth and differentiation, cytoskeleton formation, vesicle transport, and defense reaction [16]. I-2 and Mi-1 are two CC-NBSLRR R proteins in tomato. I-2 confers resistance to blight, and Mi-1 confers resistance to root-knot nematodes and potato aphids. They all have the ability to bind ATP, which is facilitated by the P-loop [17]. In tobacco [18] and Arabidopsis thaliana PR5 [19], a similar conclusion was reached. The NBS region of resistance proteins has three characteristic conserved regions. The P-loop takes part in phosphate and Mg2þ binding [20] and kinase-3 combines with purines or ribose [21]. The NBS domains of highly conserved disease R gene products indicate that nucleoside triphosphate is necessary for the functionality of these proteins. Yuksel et al. had isolated 234 resistance gene analogs (RGAs) by using primers designed from conserved regions of different classes of resistance genes including the NBS-LRR and LRR-TM classes. They identified 250 putative resistance gene loci, and the BACs isolated here could help to improve our understanding of the evolution and organization of these genes in the peanut genome [25]. The mechanism by which NBS domains confer disease resistance to plants is not clear but may be related to the binding of the NBS domain to a nucleotide triphosphate, which changes the interaction between the disease resistance protein and its defense signals. Changes in the external environment can cause related changes in gene expression. In this study, the expression changes of PnAG3 were different in different peanut species infected by A. flavus. After A. flavus infection, the expression of PnAG3 in A. flavus-resistant species J11 exceeded that of A. flavus-sensitive species JH1012. After A. flavus infection, the expression quantity of PnAG3 in J11 increased by 16.68, 11.16 and 25.96 in the seed coat, kernel and pericarp, respectively. On the other hand, it only increased 2e3 times in JH1012. From the results, we can speculate that the function of

Fig. 4. The amplification curves of the PnAG3 gene by RT-PCR.

C.-j. Li et al. / Physiological and Molecular Plant Pathology 84 (2013) 70e75 Table 5 The relative quantitative expression of the PnAG3 gene in different species and plant parts. Parts

Varieties

CK

Seed coat Kernel

J11 JH1012 J11 JH1012 J11 JH1012

1.07 1.59 26.2 23.94 2.78 1.98

Pericarp

Infection      

0.042 0.069 1.092 0.873 0.092 0.732

17.85 3.58 292.48 166.17 72.16 6.52

     

0.815 0.117 12.043 6.026 2.351 0.395

Significance

Fold increase

* * * * * *

16.68 2.25 11.16 6.94 25.96 3.29

Note: Each value is the mean of three replicates with the standard deviation. *indicates a significant difference between control and Aspergillus flavus infection at the 95% confidence level.

PnAG3 is positively correlated with peanut resistance to A. flavus infection. As PnAG3 belongs to the NBS-LRR class of genes and shows higher expression in A. flavus-resistant peanuts after A. flavus infection, we speculate that PnAG3 contributes to the resistance to A. flavus in J11.

[7] [8] [9]

[10]

[11]

[12]

[13]

[14] [15]

[16]

Acknowledgments [17]

Financial support came from the National Natural Science Foundation of China (30771361), the Modern Agro-industry Technology Research System (CARS-14), the Agro-industry Technology Research System of Shandong Province and the Bio-resource Innovation and Research Project of Shandong Province. References

[18] [19]

[20] [21]

[1] Bertioli DJ, Leal-Bertioli SCM, Lion MB, Santos VL, Pappas Jr G, Cannon SB. A large scale analysis of resistance gene homologues in Arachis. Molecular Genetics and Genomics 2003;270:34e45. [2] Ellis J, Dodds P, Pryor T. The generation of plant disease resistance gene specificities. Trends in Plant Science 2000;5:373e9. [3] Flor HH. Inheritance of pathogenicity in Melampsora lini. Phytopathology 1942;32:653e69. [4] Holub EB. The arms race is ancient history in Arabidopsis, the wildflower. Nature Reviews Genetics 2001;2:516e27. [5] Ellis J, Jones D. Structure and function of proteins controlling stain-specific pathogen resistance in plants. Current Opinion in Plant Biology 1998;1:288e93. [6] Meyers BC, Dickerman AW, Michelmore RW, Sivaramakrishnan S, Sobral BW, Young ND. Plant disease resistance genes encode members of an ancient and

[22]

[23]

[24] [25]

75

diverse protein family within the nucleotide-binding superfamily. The Plant Journal 1999;20:317e32. Hammond-Kosack KE, Jonathan DGJ. Plant disease resistance genes. Annual Review of Plant Physiology and Plant Molecular Biology 1997;48:575e607. Williamson VM. Plant nematode resistance genes. Current Opinion in Plant Biology 1999;2:327e31. Wang JM, Jiang HY, Zhao Y, Xiang Y, Zhu XW, Cheng BJ. Genome-wide analysis of NBS-encoding disease resistance genes in maize inbred line B73. Acta Agromonica Sinica 2009;35:566e70. Huang DQ, Wang P, Lv LX. Isolation of NBS-LRR class resistance gene analogs from stigma cDNA of pomelo (Citrus grandis cv. guanxi). Scientia Agricultura Sinica 2004;37:1580e4. Wang SQ, Zhang DC, Li P, Wang XD, Li SG, Zhu LH, et al. Cloning and analysis of a new NBS LRR resistance gene family in rice. Acta Genetica Sinica 2005;32: 704e11. Wang HY, Liu DQ, Yang WX, Li ZF, Zhang LR, Zhang N. Identification and cloning of a NBS resistance gene homology cDNA sequence from wheat. Acta Phytopathological Sinica 2009;39:507e13. Chen GS, Zhou YF, Lin S, Pan DR. Isolation and sequence analysis of NBS-type resistance gene analogues in sweet potato (Ipomoea batatas (L.)Lam.). Journal of Tropical and Subtropical Botany 2006;14:359e65. Johal GS, Briggs SP. Reductase activity encoded by the HM1 disease resistance gene in maize. Science 1992;258:985e7. Liu J, Liu X, Dai L, Wang G. Recent progress in elucidating the structure, function and evolution of disease resistance genes in plants. Journal of Genetics and Genomics 2007;34:765e76. He CY, Zhang ZY, Chen AY. Isolation and characterization of NBS resistance gene analogs from soybean. Chinese Science Bulletin 2001;46:1017e21. Tameling WI, Elzinga SD, Darmin PS, Vossen JH, Takken FL, Haring MA, et al. The tomato R gene products I-2 and MI-1 are functional ATP binding proteins with ATPase activity. The Plant Cell Online 2002;14:2929e39. Mestre P, Baulcombe DC. Elicitor-mediated oligomerization of the tobacco N disease resistance protein. Plant Cell 2006;18:491e501. Ade J, DeYoung BJ, Golstein C, Roger WI. Indirect activation of a plant nucleotide binding site-leucine-rich repeat protein by a bacterial protease. Proceedings of the National Academy of Sciences of the United States of America 2007;104:2531e6. Saraste M, Sibbald PR, Wittinghofer A. The P-loop e a common motif in ATPand GTP-binding proteins. Trends in Biochemical Sciences 1990;15:430e4. Traut TW. The function and consensus motifs of nine types of peptide segments that form different types of nucleotide-binding sites. European Journal of Biochemistry 1994;222:9e19. Wang BJ, Wang YJ, Wang Q, Luo GZ, Zhang ZG, He CY, et al. Characterization of an NBS-LRR resistance gene homologue from soybean. Journal of Plant Physiology 2004;161:815e22. Wang BJ, Zhang ZG, Li XG, Wang YJ, He CY, Zhang JS, et al. Cloning and analysis of a disease resistance gene homolog from soybean. Acta Botanica Sinica 2003;45:864e70. Kobe B, Deisenhofer J. The leucine-rich repeat: a versatile binding motif. Trends in Biochemical Sciences 1994;19:415e21. Yuksel B, Estill JC, Schulze SR, Paterson AH. Organization and evolution of resistance gene analogs in peanut. Molecular Genetics and Genomics 2005;274:248e63.