Comparative Analysis of the Whole Set of rRNA Operons Between an Enterohemorrhagic Escherichia coli O157:H7 Sakai Strain and an Escherichia coli K-12 Strain MG1655

System. Appl. Microbiol. 23, 315-324 (2000) © Urban & Fischer Verlag _htt-,--p:_Ilw_w_w_.ur_ba_nf_is_ch_er_ .de-'./jo_u_rna_ls_/s_am_ _ _ _ _ _ _ _ _ _ _ _

SYSTEI\t\4T1C AND APPLIED MICROBIOLOGY

Comparative Analysis of the Whole Set of rRNA Operons Between an Enterohemorrhagic Escherichia coli 0157:H7 Sakai Strain and an Escherichia coli K-12 Strain MG1655 MAKOTO OHNISHI!, TAKAHIRO MURATAl, KEISUKE NAKAYAMA!, SATORU KUHARA 2, MASAHIRO HATTORI 3,6, KEN KUROKAWA\ TERUO YASUNAGA\ K ATSUSHI YOKOYAMAS, Kozo MAKINOS, HIDEO SHINAGAWA 5, and TETSUYA HAYASHI!

Department of Bacteriology, Shinshu University School of Medicine, Matsumoto, Nagano, Japan Graduate School of Genetic Resources Technology, Kyushu University, Higashi-ku, Fukuoka, japan 3 Human Genome Research Group, RIKEN Genomic Sciences Center, c/o Kitasato University, Sagamihara, Kanagawa, Japan 4 Genome Information research Center, Osaka University, Suita, Osaka, Japan 5 Department of Molecular Microbiology, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka, japan 6 Human Genomic Center, Institute of Medical Science, The University of Tokyo, Minato-ku, Tokyo, Japan 1

2

Received July 14,2000

Summary Two primer sets for direct sequence determination of all seven rRNA operons (rrn) of Escherichia coli have been developed; one is for specific-amplification of each rrn operon and the other is for direct sequencing of the amplified operons. Using these primer sets, we determined the nucleotide sequences of seven rrn operons, including promoter and terminator regions, of an enterohemorrhagic E. coli (EHEC) 0 157:H7 Sakai strain. To elucidate the intercistronic or intraspecific variation of rrn operons, their sequences were compared with those for the K-12 rrn operons. The rrn genes and the internal transcribed spacer regions showed a higher similarity to each other in each strain than between the corresponding operons of th e two strains. However, the degree of intercistronic homogeneity was much higher in the EHEC strain than in K-12 . In contrast, promoter and terminator regions in each operons were conserved between the corresponding operons of the two strains, which exceeded intercistronic similarity. Key words: rrn operon - direct sequencing - enterohemorrhagic E. coli 0157:H7 - E. coli K-12 - intraspecific variation - intercistronic variation

Introduction In Echerichia coli, seven copies of rrn operon exist (KENERLEY et aI., 1977; KISS et aI., 1977). Some nucleotide sequences within rrn operons, such as rrs genes, rrl genes, and rrs-rrl spacer regions, have been determined in several E. coli strains (CILIA et aI., 1996; ANT6N et al.,1998, 1999; MARTINEZ-MuRCIA et aI., 1999). Based on these data, polymorphic sites in the rrm operons of E. coli strains have been identified. The intercistronic variation of rrn operons was also found, though the concerted evolution of the rrn multigene family by homogenization has been proposed. Thus, for studying the evolution and variation of E. coli rRNA operons, it is important to know the nucleotide sequence information of the whole set of rrn operons of

E. coli strains. However, the nucleotide sequence of all rrn operons on a single genome has been fully determined only for the K-12 strain MG1655 (BLATTER et al. 1997). We, in this study, developed a set of peR primers for specific-amplification of each rrn operon of E. coli strains and a set of sequencing primers for direct sequencing of amplified rrn operons. By applying these primer sets, we determined the nucleotide sequences of all seven rrn operons, of an enterohemorrhagic E. coli (EHEC) 0157:H7 Sakai strain. To elucidate the intercisteronic or intraspecific sequence variation and evolution of rrn operons, the sequences were compared with those for the K-12 rrn operons. 0723-2020/00/23/03-315 $ 15 .00/0

316

M. OHNISHI et ai.

Materials and Methods

EMBUGenBank nucleotide sequence databases with the accession numbers AB035920 to AB035926.

Bacterial strains EHEC 0157:H7 (RIMD 0509952) was isolated from a typical patient during a large outbreak occurred in Sakai City, Osaka Prefecture, Japan, in 1996. E. coli K-12 MG1655 was kindly provided by Dr. H. MORI (Nara Institute of Science and Technology).

K-12 MG1655 sequence Sequences of K-12 MG1655 rrn operons were obtained from the DDBJINCBIIEMBO DNA sequence data base (accession no. U00096). To confirm differences in rrn operon sequences between K-12 and the EHEC strain, we re-sequenced all the rrn operons of K-12 MG1655, using the same strategy described above.

PCR amplification of each rrn operon and its flanking region Primers used for operon-specific amplification were designed based on the MG1655 sequence (BLAITNER et ai., 1997). Primer sequences and their positions on the MG1655 chromosome are presented in Table 1. PCR reactions were performed as described (OHNISHI et ai., 1999).

Results and Discussion Development of primer sets and sequence determination of seven rrn operons in the EHEC Sakai strain

Sequence determination All sequencing primers we prepared were based on MG1655 sequences. Each operon was sequenced using primers common to all operons. Upstream and downstream regions of the operons were sequenced, using primers specific for each operon. All the primer sequences are presented in Table 1. Sequencing was carried out, using PCR products by direct sequencing strategy (MAKINO et ai., 1998). DNA sequences were obtained, using the ABI 373A DNA sequencer (Perlin-Elmer). The nucleotide sequence data reported in this paper will appear in the DDBJI rrnA operon

tlf..H

hentG

~

•

K-12

ElIEC

rnA

~

In an earlier study, we identified seven rrn operons on the EHEC chromosome (OHNISHI et aI., 1999). Their relative location on the chromosome was found to be the same as that in K-12, and the gene organization upstream and downstream of each rrn operon was also suggested to be conserved. To know the structure and nucleotide sequence of each rrn operon, we developed two primer sets based on the reported K-12 MG1655 se-

ifer .,,,r

~

--

~.

~ h,m<;

~ .,-,A

lIeT III/itT

rriA

,.,fA

mobB mobA

rrrs

mUt"8

rrnBoperon ~

-.'~

ElIEC

~.

'''--. mlrl

rrnCoperon

~

",8

",(

K-12

'l-

~",

yieP

rrnDoperon

.,oE

,.d"

pdA

",c

rnD

~~+-

•

K-12

ElIEC

~,

.

+pd'

rrnEoperon EIIEC

rrf9

-

nf(

nrC rrpT

mUTe

~

•

K-12

ElIEC

.

y.1f

~

~,

..

""

,-."."

-

~

-

gltW

-+ )'''to

.. "10

~--.-, "fC rlpT .5pT yifA

(h,V ".fO rrfF

~~~

-

yhdZ

Inll

-

-

g/fW

;mVIt'~V

~

~ rnll

yMY

+--+'f4

""

nff

Yi~/I,

Yi~8

---

iftV "'3V

metA

~~+-+---t­

.. ....V..... nff

Yil'8

..

m!tA

"'G

.. ~

rrlG

k91P

"'G

rrfG

19tP

"'"

"'''

,~

-""'''~,.

V ~

-+

rUB

pJ5R

~~--~.-r..~

9'tV

",G

Y'""O

~

gfrv

~

. ,~~:.:.:~',~~~~~~',~~~~~'--..... dp"

yiff

}'ifA

--

~

mG

dp"

,

-,1,'

~

4

W~"'IIIU

"'f

p~H

rrnGoperon

.. --

leU "I..U

biT/!,

..

m8

gltU

~

~,.--.

'~''''''''''''''''

~

rnD

"'f

p~H

••

K-12

ElIEC

~ ~

girT

gltU

~

~

EHEC

K-12

niB

.~T

yit>P

yitO

........~

rmHoperon

V girT

rr$B

m~1

btilB

K-12

ytfAl

PJ~A

.. ~+r'-;-

Fig. 1. Gene organization of rrn operons ofEHEC and K-12. Gene organization of all seven rrn operons of the EHEC strain, including their flanking regions, is compared with that of K-12. Gene organization of K-12. rrn operons were depicted from the published whole genome sequence of the strain MG1655 (BLAITNER et a!., 1997). Regions indicated by broken lines were not determined regarding their nucleotide sequences. Arrowheads represent the primers used for amplification of each operon, Note that M G 16S S regions corresponding to the se-

quenced regions of the EHEC strain were re-sequenced in this study. The differences between the MG1655 sequences we obtained and the reported sequences are presented in Table 2.

rrn Operons of E. coli 0157:H7

quence, one is for specific-amplification of each rrn operon of E. coli and another is for direct sequencing of amplified rrn operons (Table 1). Both primer sets worked well and the nucleotide sequences of all the seven rrn

operons, including their flanking regions, of the EHEC strain were determined quickly by direct sequencing strategy (Fig. 1). Complete sequences of the seven rrn operons of MG1655 were also determined by ourselves

Table 1. Primers used in this study. peR primers U D U D U D U D U D U D U D

rrnA rrnA rrnB rrnB rrnC rrnC rrnD rrnD rrnE rrnE rrnG rrnG rrnH rrnH

CGCTCCCTCACGCCATCCTCTTT TGTTTGCGCCCCGTCTGGTGCA GCGGATTAAGGGCGTCGAGGCG CGGGCCTTGTTCCAGACGCCAG TGACCAGCACGCCGCCAAGAAC GAGATCCCATTACCACCCCCCG GTGCGAGGTGGATTACAGGCGCT GCGGTTAGAAGATGGACGCCTGC AACACGCTCGCCCCACTGACCG GCATCCCCTTCTTCCGTCTCTGCC CGCTAGTGGGGCTGGGGAAATCG GCCGGAAGGGTTGAAAGGCCGC GACTGCACCACCCATCGCGGAA GCCTCCCCCGATTATATTTCCCGC

317

(positions on the MG1655 chromosome) (4031099-4031121) (4040411-4040390) (4162564-4162675) (4171089-4171068) (3937761-3937782) (3946443-3946422) (3419708-3419730) (3428209-3428187) (4203989-4204010) (4212514-4212491) (2 7 21471-2 7 21493) (273510-2731489) (221121-221142) (230380-230357)

common sequencing primer

operon specific sequencing primers

F. 1 F. 2 F. 3 F. 4 F. 5 F. 6 F. 7 F. 8 F. 9 F.10 F.11 F .12 F .13 F.14 F.15 F.16

TGAACGCTGGCGGCAG GGGCGCAAGCCTGATG GGAGGAATACCGGTGG GTCGTCAGCTCGTGTTG CATGGGAGTGGGTTGC CTGCGGTTGGATCACC GCGACTAAGCGTACACG TGACAGCCCCGTACAC GAAACCCGGTGATCTAG AGTGGGAAACGATGTGG TAATCGGGGCAGGGTG ATGGTGCCGTAACTTCG ACTCGCTGTGAAGATGC TGACTGCGAGCGTGAC CTGGTGTTCGGGTTGTC CAGAACGCAGAAGCGG

AF.-1 AF. 0 AF.17 AR.16 AR.17

TGATTGCCAACATGCTG TTTCGCCCGAGAAATCG AACATGCCTGTCTATCAC ATCGTTGCCAGCCAGC TTCACTGGCGGATTACC

BF.-1 BF. 0 BF.17 BR.16 BR.17

CCGTATGGCGAAAAAGC TATTGCCCGTTTTACAGC CTACTCCAATGCCTGGC CTCCGGCTCCTACATG ATAAGCCAACCTGCTGC

CF.-1 CF. 0 CF.17 CR.16 CR.17

ATAGCGAGGCGAATGAG CCAGGAAGTGTGATTACG ATCATCCTTAGCGAAAGC CATATGGCTGCAAAATAGC CCTCACGCAATAACGAG

R.-2 R.-1 R. 0 R. 1 R. 2 R. 3 R. 4 R. 5 R. 6 R. 7 R. 8 R. 9 R.10 R.11 R.12 R.13 R.14 R.15

GGAGGCGCATTATAGGG TGGCGCATTATAGGGAG CAATCTGAGCCATGATC GTATTAGCTACCGTTTCC CTGGCACGGAGTTAGC GGCGGTCGACTTAACG AGCCCTGGTCGTAAGG GGTGATCCAACCGCAG CGCAGATTAGCACGTCC CCTTGGAGGATGGTCC CCCCCAGCCACAAGTC ACATCTTCCGCGCAGG CGCCCGGCCAACATAG GCTGGTATCTTCGACTG CCTCCCACCTATCCTAC CTCTTGGGCGGTATCAG CTCGGGGCAAGTTTCG CCGCTTCTGCGTTCTG

DF.-1 DF. 0 DF . 17 DR.16 DR.17

GCTGGGTCTGGTTACC CTTTGGGGGCATTATTGG AGGCTCAGTCGGAAGGC CCCGGCGGATTTGTCC GCGGGTGAGAATTGCC

EF.-1 EF. 0 EF . 17 ER.16 ER.17

TCTCAACCGCATCTTCC GTGGATAACTCTGTGCG CCGCCTGCTCATTTTGC GTCGCGGTTAATGAACG AGCAGGCGCAGAAACTG

GF.-1 GF. 0 GF.17 GR.16 GR.17

GTCCGTATTCCGTCATC TTCGGGGCTCGTTTTTG TAACCATTTTCCTGCTAAC GCGACGAGTATCACTAC GTCTTCCATGGTGTGTTG

HF.-1 HF. 0 HF.17 HR.16 HR.17

TAAGGCATCCAGACGTC CCTGAAGCAGAAAACGC GCCCATAATCACCTCAG GCGCGATAACCAAGTTC TAACCTTCCCCCATAGC

318

M.

OHNISHI

et al.

Table 2. Differences between the reported MG1655 sequences (U0096) and those obtained in the present study. Position rrsG 16S-23S ITS (rrnE) 16S-23S ITS(rrnA) rriG rriD rriC rriC rriD rriD rriC rrfF

585-92 281-285 404-420 405-409 1939-1943 2377-81 2442-2447 2537-2541 2546-2551 2796-5 57-61

UOOO96

Sequences obtained

gcggGttGg aataAT TCTGAAGT tgggAg gaaaAt aagcTa cggg-a tcccCa tatg-c ccttTaAGGGt aaacCg

gcgg-ttTg aata-t acgatgatgaatcgaaa tggg-g gaaa-t aagc-a cgggGa tccc-a tatgGc ccttGaGAg-t aaac-g

Captalletters indicate nucleotides where the differences were observed. Hyphens indicate missing nucleotides.

using the same primer sets. Unexpectedly, our sequences differed from reported one at 11 loci. Differences detected between the reported MG1655 sequences and the sequences we obtained are listed in Table 2.

Gene organization of seven rrn operons in the EHEC Sakai strain As shown in Fig. 1, the gene organization in the regions upstream and downstream of each rrn operon of the EHEC strain was much the same as that of K-12. The only difference was that the yjaA gene, which encodes a hypothetical protein, is present downstream of the rrnE operon in K-12, but is absent in the EHEC strain. Fundamental structures of each rrn operons, including numbers and kinds of the rrn operon-associated tRNA genes which existed within rrs-rrl spacer regions and downstream of rrf genes, were the same as those of corresponding operons of K-12 (Fig. 1). The GC content of the yiaA coding region was 45%, a value somewhat lower than that for the E. coli chromosome, and the codon adaptation index was of a moderate value of 0.31 (BLATINER et aI., 1997). The nucleotide sequences of the EHEC rrn operons also showed a significant intercistronic variation. A comparative analysis of these sequences with the rrn operons from K-12 revealed three outstanding features. First, the rrn genes and the spacer regions showed much higher similarity to each other in each strain than between the corresponding operons of the two strains. Second, the degree of intercistronic homogeneity was significantly higher in the EHEC strain than in K-12. Finally, promoter and terminator regions in each operon were conserved between corresponding operons of the two strains, which exceeded intercistronic similarities. Sections below describe details obtained by the comparative analysis of rrn operons of the two strains.

sites were present in K-12 (Fig. 2A). Most of the polymorphic sites in E. coli rrs genes have been reported to cluster in the two regions; stems VI and V6 (HUYSMANS and DE WACHTER, 1986). According to sequencing analysis of rrs genes from six E. coli strains, 8 types and 3 types of variations were demonstrated for the respective regions VI; I to VI, V6; I to III: nomenclature according to MARTINEZ-MuRCIA et aI., 1999). The stem VI region in every EHEC rrs gene was VI-I type, while three types of VI were present in K-12. Every stem V6 region of the EHEC strain was V6-11 type, except for the rrsG (V6-I). This ratio differs from that in K-12 where only rrsH is the V6-11 type with the remaining being V6-1 (Fig. 2A). In the rrl genes, 22 polymorphic sites were detected in the EHEC strains, while 34 sites in K-12 (Fig. 2B). The polymorphism at positions 646 and 1225 in the EHEC rrl genes was newly identified. Many of the polymorphic sites of E. coli rrl genes are located in the five secondarystructure loops, helix 25, 45, 63, 79, and 98 (ANT6N et aI., 1999; helix numbering by LARSEN, 1992). Polymorphism was found in every K-12 helix, but only in helix 25 in the EHEC strain (Fig. 2B). In the helix 25 of the E. coli rrl genes, a variation of three types (I, II, and III) was identified (ANT6N et aI., 1999). In the EHEC strain, helix 25 II and helix 25 III co-existed. Analysis of 72 E. coli strains from the ECOR collection, by PCR test using sequence-specific probes, revealed that 35 strains contain helix 25 II, and 10 strains helix 25 III (ANT6N et aI., 1999). It should be noted that the co-existence of helix 25 II and helix 25 III was found only in EHEC strain A8190, not in other E. coli strains. All the rrf sequences in the EHEC strain were identical, except for rr{F. In contrast, 5 polymorphic sites were present in the rrf genes of K-12 (Fig. 2C). It should be noted that sequences of rrfF genes in the two strains were identical.

Internal transcribed spacer regions (ITSs) rRNA-coding regions In the rrs genes, intercistronic variations were found in 10 sites in the EHEC strains, while 21 polymorphic

Intercistronic homogeneity of the two ITSs was also higher than the similarity observed between the corresponding operons of the EHEC strain and K-12. Degrees

rrn Operons of E. coli 0157:H7 Stem V1

Stem V6 1111111 11 11122222 000000

A

C

1 1191 32327

7889 9090

Fig. 2. Variable positions in the rrs, rrl and rrf genes of EHEC and K-12. A. Variable positions in rrs genes of the EHEC strain and K-12 are shown. Dots indicate the same nucleotide composition as the EHEC rrsA sequence. Number at the top indicate positions in the sequences reported by BROSIUS et al. (1981). B. Variable positions in rrl genes are shown. Dots indicate the same nucleotide composition as the EHEC rrlA sequence. The numbers at the top indicate positions in the sequences reported by BROSIUS et al. (1981). A and B represent the positions of insertions between positions 545 and 546, which were detected in four EHEC rrl genes. C and D represent positions of insertion between positions 1868 and 1869 and positions 1873-1874 detected in the K-12 rrlA, respectively. C. Variable positions in rrf genes are shown. Dots indicate the same nucleotide composition as the EHEC rrfA sequence. Numbers at the top indicate positions in the sequences reported by BROWNLEE et al. (1967).

EHEC EHEC EHEC EHEC EHEC EHEC EHEC

rrsA rrsB rrsC rrsD rrsE rrsG rrsH

K-12 K-12 K-12 K-12 K-12 K-12 K-12

rrsA rrsB rrsC rrsD rrsE rrsG rrsH

..... ....... . ..... .... A.. ·

'G

Helix 25

B 112233 346815

EHEC EHEC EHEC EHEC EHEC EHEC EHEC

rrlA rrlB rrlC rrlD rrlE rrlG rrlH

K-12 K-12 K-12 K-12 K-12 K-12 K-12

rrlA rrlB rrlC rrlD rrlE rrlG rrlH

of intercistronic homogeneity of ITSs were again higher in the EHEC strain than in K-12, as in the three rRNA gene regIOns. The rrs-rrl ITS is the region with the highest intercistronic heterogeneity in rrn operons, because tRNA genes are present (ANT6N et aI., 1998). The rrs-rrl spacer regions of E. coli can be categorized into two types; ISRI with tRNA(glu-2), and ISR2 with tRNA(ile-l) and tRNA(ala-lB) (ANT6N et aI., 1999; MORGAN et aI., 1988). As in many other E. coli strains (ANT6N et aI., 1999), rrnB, G, C, and E of the EHEC strain were ISRI type, and rrnA, D, and H were ISR2 (Fig. 1 and 3A). A comparative analysis of 52 operons from 13 strains, including K-12, revealed several variable regions in the ISRl; two regions with block substitution (positions 66-272 and 404-420), a stem-loop region where base changes are clustered (positions 281-320). In addition,

rrfA rrfB rrfC rrfD rrfE rrfF rrfG rrfH

EHEC EHEC EHEC EHEC EHEC EHEC EHEC EHEC

GATC

Helix 45

K12 K12 K12 K12 K12 K12 K12 K12

319

rrfA rrfB rrfC rrfD rrfE rrfF rrfG rrfH

Helix 63

CCTCG

TAG'A

'AGT' 'AG' . · 'G" · 'G" 'AG' . TAG'A · 'G" · 'G"

HelixHelix 79 98

5555AB55555 4444

TAC'" . · . GCT--T' GGC . . .. TACA'A · 'GCT--T'GGC' ... TAC'" . · 'GCT--T'GGC' .. TAC'" . · . GCT--T' GGC . . .. TAC'" . · . GCT--T' GGC . .. TA···· . 'TGCT--T'GGC' 'C'

.

.

15 polymorphic sites were identified in the ISRI regions (ANT6N et aI., 1998). In the region with block substitution, at positions 66-272, either the rsl sequence (106 bp) or the 20 mer sequence is present, and at positions 404-420, either 17 mer or 8 mer sequence is present. In the 17 mer sequence, polymorphic sites were identified at positions 413, 414, and 418. As for the stem-loop (positions 281-320), four types of secondary structures (I to IV) were demonstrated (ANT6N et aI., 1998). In these three regions of the EHEC operons of IRSI type, we found no intercistronic heterogeneity (Fig. 3A). Only three polymorphic sites were identified in other regions, indicating the ISRI sequence to be highly homogeneous in the EHEC strain. ISR2 also contains a region with block substitution from positions 404 to 420 (ANT6N et aI., 1998). This region was again homogeneous throughout the EHEC

320

M. OHNISHI et al.

A

2 11124445 6 - 7 12515675 6 2

22 2 78 8 20 1 AT

ISRl

EHEC EHEC EHEC EHEC K-12 K-12 K-12 K-12

rrnB rrnG rrnC rrnE rrnB rrnG rrnC rrnE

GCACAGAA 20-mer CT- - - - -- 20-mer 20-mer ........ 20-mer - - -T- - -- rsl - _. -GA-T rsl - -T- - -G- 20-mer - -T- - - -- 20-mer

ISR2

EHEC EHEC EHEC K-12 K-12 K-12

rrnA rrnD rrnH rrnA rrnD rrnH

CTC----GC-----GC-----GCA----GC-----GC------

........

B EHEC

EHEC EHEC EHEC EHEC EHEC EHEC EHEC

rrnA rrnB rrnC rrnD rrnE rrnG rrnH

K12

K-12 K-12 K-12 K-12 K-12 K-12 K-12

rrnA rrnB rrnC rrnD rrnE rrnG rrnH

GGC GG-

I I I I I II I I

3 2 0

333 4 677 0 816 4

-

4 2 0

444 111 348

CGG 17-mer AAA -A- 17-mer -A- 17-mer 17-mer 17-mer TA- 8-mer -A- 17-mer -AC 17-mer - -T CAG 17-mer AAA -CA 17-mer -CA 17-mer 17-mer 8-mer T- - 17-mer G-C

1248 3623 G-GA

-TAC-AC-AG C-A-TAC-ACTA-

Fig. 3_ Variable positions in ITS regions of EHEC and K-12. A_ Variable positions (or regions) in 16S-23S ITS regions of the EHEC strain and K-12 are shown. ITS regions of rrnB, C, E, and G are ofISR1 type (with tRNAGlu-2) and those of rrnA, D, and Hare ISR2 type (with tRNA'ie-1 and tRNAAla-2). Dots indicate the same nucleotide composition as the EHEC rrnB (ISR1 type) or rrnA (ISR2 type) sequence. The numbers at the top indicate positions in the sequence reported by ANT6N et al. (1998). sequences of 20-mer, rsl, 8-mer, and 17-mer regions are the same as reported ones (BROSIUS et al., 1981; ANT6N et al., 1998). B_ Variable positions in 23S-5S ITS regions are shown. Dots indicate the same nucleotide composition as the EHEC rrnA sequence. Nucleotide numbers indicated at the top are those of the 23S-5S ITS regions of K-12 rrnA.

operons of ISR2 type (Fig. 3A). Only 4 polymorphic sites were identified in other regions, which means that ISR2 sequences were also highly homogeneous in the EHEC strain. The polymorphism at position 370, which was detected in rrnD and H of the EHEC strains has heretofore not been reported_ Although positions 404-420 of ISR2 in the K-12 rrnA operon was reported to contain an 8 mer sequence (ANT6N et al., 1999; BLATTNER et al., 1997), a 17 mer sequence was identified instead in the K12 MG1655 strain which we analyzed. The rrl-rrfITS regions in K-12 include 3 polymorphic sites, while sequences in the EHEC strain were identical (Fig_ 3B) _

Promoter regions Sequences upstream of all the EHEC and K-12 rrn operons were analyzed by multiple alignment (Fig_ 4)_ In contrast to regions coding rRNAs, promoter regions of corresponding operons of the two strains showed a higher similarity to each other than to other operons_

In all the rrn operons of K-12, two promoters, PI and P2, have been identified (KEENER and NOMURA, 1996). Both promoter sequences were conserved in all the EHEC rrn operons. Operon-specific sequences, which lack clear intercistronic similarities, were found upstream of the spacer region of PI-35 and -10 hexamers. However, junctions between regions with intercistronic conservation and the operon-specific regions were identical in each corresponding operon of the two strains. Sequences of the operon-specific regions were highly conserved between the two strains, thus, transcriptional enhancing elements, an UP element and three Fis binding sites, which were identified in every operon in K-12, (KEENER and NOMURA, 1996), were assumed to be conserved in every EHEC operon (Fig. 4A). As shown in Fig. 4A, the 15 bp sequences encompassing from the PI-I0 hexamer to the transcription initiation site of the PI promoter were completely conserved in all the EHEC operons. This sequence is regarded as an essential region for the growth-rate dependent control in rRNA transcription (DICKSON et al., 1989). The 160 bp

0157 K-12 0157 K-12 0157 K-12 0157 K-12 0157 K-12 0157 K-12 0157 K-12

0157 K-12 0157 K-12 0157 K-12 0157 K-12 0157 K-12 0157 K-12 0157 K-12

rrnA rrnA rrnB rrnB rrnC rrnC rrnG rrnG rrnD rrnD rrnE rrnB rrnB rrnB

rrnA rrnA rrnB rrnB rrnC rrnC rrnG rrnG rrnD rrnD rrnB rrnB rrnH rrnH

I-

P1 - 10

PI -35

1'2 -lO

__~______ VR3

~

.•• •••• .••.••. ••••••..•• T •••.•. . •• .• ••. •••• • •• •• .•.•• •.• ...••••• ••• • •• •• • . •••• . ••••••••• AA.GAT •.• G. T •.• AT. T •.• T .G • ••.•••••••••••••••••••••••••••••••••••••••••••••• , •••••••••••• M.GAT •• • G. T •.• AT. T ..• T .G • •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• ••••••• AA.GA.C •• • AAAGTA ••• •• GCAAAAAATTGGGA •.•• .. ••••••• •. T •• GT ••• G ••. -- •• •• • • TG ••• ••• or ••••••• AA. GA. C •• • AAAATA ••••• GCAAAAAATTGGGA •••••••••••.••• T •• GT ••• G ••• __ •• •• .• TG •••••• or "'GTC. TT •• TC.GC •• T ••. T. TA ••• CGGCCTGCGGAGA ••••.•••••••••••. T .•• TC • • •.••. CGG. T-. TG • • T • .• T .TCAGTC.TT •• TC.GC •• T ••. T.TA ••. CGGCCTGCGGAGA ••••••••••••..•.• T •.. TC •••••• . CGG.T-.TG •. T ••• T ••• TGA . • T. AA. A. GC. TT ••••• GC ••••• TTC. T. AGCCG •.• .••••• . ••••••. T ••• TC •••.••• CGA. T- . TG •• T ••• or •• TGA • • T. M. A. GC. TT ••.•• GC ••••• TTC. T. AGCCG • ••••••••• •.. •••• T • .. TC ••••.•. CGG. T- . TG •• T ••. T

•••••• • •••••••••• ••• •• ••• T •• •• • ••• A ••••••••••• ••• •••••• • •••••••• • • •• •• •••• •• •• ••••••••• • •

rmA

.~~

Fis binding sites

Up element Promoter (P1) -35 -1 0

Promoter (P2) -35 -10

........ JIll"""'"

ITS

· ••.•.•.•..••••••••••••••• • . C •••••.••••• - •••.•• ----- • •.•.•••• • ••• • •. ••••.•• .• • • • G ••••• T •.• G.A. - ••• C •••• C.GC •••. -M ••••• GM . •. -- .• - • ••• .•.• • • ••.•.••.• •.•••• ..••.• •••••• •• . • • ..••..• - .••••• ----- ••.•.••••••••••••••••••..••••••••. T ••• G.A. - . •• C •••• C.GC •••. -M •• ..• GM •• • -- .• - .• •••••.• • .• •• .•• • • • •. • .•..••.•....•. C •. • •..••••. - .••.•• ----- •• .•... ••••••••••••••••••• • ••• ..•. T •.• G.A. - ••. C •••• C .GC •••• -M ••..• AAA ••• -- •• - •.••.•••• • ••••••••••••••••.••.••...•.••.•••.•.•.• - . •• ••. ----- ••. ••••.•••••.•.••••••••••••••. .•. TC .• G.A. - ••. C •.• • C.GC •••• -M ••••• GM •• . -- .• - •• ••. ••• • • .• •••••• G .•••••••• ••• •..••. C .. M- ••••.• A •••.•. ------- . G •••••••••...••••••••• - • • G • •••• T •.• G.A. - ••. C •.. • C .GC •••• -M ••••• GM ••. -- .• - ••••••••• .A.AA.A. --. GTC. TAA.A--AC- •.. -------- •..• A •• -- . • TCCTGG ••• TC .G.G •••.••••• A.AGA •••• . • •.•..• . ..••••••••..•.. •• . ..•• • •• •• • .•• -- •••••.•.•..•••••• .A. A •• A. --. GTC •. AA.A--AC- ••• -------- •..• A •• A- •• TCCTG •••• TC .G.G ••••••••. A.AGA • . •• .••. • ••••••• . •...•••••• • • • . •. ... •••••••• -- ••.••.•..•••..••• .A .ACAAA ••.• C- •••.• -GG. -T ••• -------- •... A. --- •• TCCTG •••• TC .G.G ••••••••• A.AGA ••••.••.•.•••• .• •• ••... .•••• •• •••• . .•..••••. -- ...•• • ••• •••••..• .A.ACAAA ••• • C- • • •.. -GG. -T • •• ---- ---- •••• A. --- •• TCCTG • ••• TC.G.G .••. • •••• A.AGA •••• . •• .• •••• ..•.•.. •..•.•••••••• C ••• - ••••• --- .•.••••..•••••••• .A.ACAAA • ••• C- ••••• -GG. -T ••• -------- •••• A •• -- •• TCCTG •••• TC .G.G • •••••••. A.AGA •••••••••.•• .•.•.•.. • .. ••••.••••••.•• • • ••• •• -- . • . •• ••.••.•. • ••• .A.ACAAA •••• C- ••••• -GG. -T ••• -------- •••• A. --- •• TCCTG •••• TC.G.G ••••••••• A.AGA . •••••••••• •.•••• ••••• . ••••..••.•••••••••••• -- • ••••. ••• ':":":"':":'

• ••• •• ••••••••••••••• •••••••• •• •• A ••• • •• - •• •• •• ----- •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• -- •• • ••• ••••••••• . •

CGCCGGGTCAGCGGGGTTCTCCTGAGAATTCCGGCAGAGA-AAGCM-----AAATAAATGCTTGACTCTGTAGCGGGAAAGCGTMTATACGCCACCTCGCGACAGTGAGCTGAAAGCC--GCGTCGCAA GCTCT"r • ••••••••••.•.•••.......••.• C • ••• •• ••.•• - •••••. ----- • •••.•..• • .••. •• •• •• • ••..•• • G • •• • • T ••• G.A. - •.. C •••• C.GC ••.• -AA •••.• GM •• • -- •• - .•..• ••••

VR1

P1 -35 • •••••• • •• •••••••• ••••••• T ••••••••••••••••••••••••••..••••••••••••••••••••••••••••••••••• ••• • G ••. • •••••.•• •• •. .•• • T • •.• •••• •• ••••• •• ••••• •••• • •• • ••• •••• •••••• •••• •••••••• • •• •• • •• ••••••• ••••• ••••••••••• •• T ••••••••••••••••••••••••••••••••••••••••••••.••••••••••••••••••

rmB Fig. 4. Structures of promoter regions of rmC rrn operons in EHEC and K-12. rmG A. Nucleotide sequences of the pro- rmD morer regions (from -416 to -137) of the rmE EHEC strain and K12 are aligned. posi- rmH 0 tions of an UP eleK ment, -35 and -10 VRl VR2 VR3 hexamers of PI and P2 promoters, and a variable region (VRI to VR3) are indicated at the top. Putative Fis binding sites are indicated by inverted characters. The nucleotides which do not coincide with the Fis consensus sequence (HUBNER and ARBER, 1989) are indicated by open boxes. Another Fis-binding site (binding site III) is located upstream of the Fis-binding site II in each operon (not shown in this figure). Sequences upstream of the Fis-binding site II are highly conserved between the corresponding operons of the two strains. Sequences following BoxA, which are required for antitermination, are highly homogeneous in all operons of the two strains. B. Schematic presentation of structures of promoter regions. The positions of Fis-binding sites, an UP element, and P1 and P2 promoters are indicated at the top. Closed boxes represent regions specific to each operon. Open boxes represent regions where intercistronic conservation in the nucleotide sequence were observed. Positions of three variable regions are indicated at the bottom, and the type of each variable region is indicated within the boxes.

B

A

o

tv

W

'-J

:r:

'-J

V,

>-'

"~ o

~

o .....,

en

::l

o'"'

(b

'0

:::!;:::

322

M.

OHNISHI

et al.

region following this conserved 15 bp sequence showed a certain degree of intercistronic heterogeneity, thus we will call it variable region (VR). Based on the degree of similarity and the pattern of variation, the region can be separated into three subregions; VR1 (55 bp), VR2 (55 bp), and VR3 (50 bp), where three (VR1-I to -III), two (VR2-I and -II), and two (VR3-I and -II) types of sequence variations were identified, respectively (Fig. 4). VR1 and VR2 regions of each corresponding operons of the EHEC and K-12 strains were of the same type. In contrast, VR3 regions of rrnA and rrnB of the EHEC strain were not the same as VR3-type II of rrnA and rrnB of K-12, but were the same as VR3-type I of rrnD, rrnE, and rrnH of EHEC and K-12. The role of these regions in the transcription of rrn operons, especially in the transcription from P2 promoter, is unknown. Regions downstream of VR3 were highly conserved in every operon of the two strains. As can be surmised from the intercistronic heterogeneity of the promoter regions, expression of the seven operons is not controlled in the same way, rather are differently regulated according to physiological conditions (CONDON et aI., 1992). In this consequence, it is of interest that the promoter and their surrounding sequences of

"nA "nB

Terminator regions

The rrn operons of K-12 are classified into two types, according to the presence of rRNA genes downstream of rrf genes; with tRNA gene (rrnC and H) or without (rrnA, B, E, D(F), and G) (MORGAN et aI., 1978; Fig. 1). This was also the case for the EHEC operons. An 18 bp sequence, which includes the 3' -terminal region of the rrf gene (13 bp), is conserved in every K-12 operon. This 18 mer sequence was conserved also in all the EHEC operons. Another copy of 18 mer is present in the rrnA, B, and D(F) of K-12 (Fig. 5). In these three operons, tl terminator is present between the two 18 mer regions, and t2 terminator is downstream of the second 18 mer (BROSIUS et aI., 1981). The region with 108 bp between the t1 terminator and the second 18 mer is also highly con-

EHEC'-.....' K·12 -1,.........-

...------------~=

EHEC-1·~--~====

K-12 - 1 1 1 - - - - - - - - - - - - - - - - -· EHEC~,.........-.-{====

"nE

each corresponding operons of the EHEC and K-12 strains was highly conserved. The differential regulation of the individual operon, under various physiological condition, may have some advantages for the cell, and if so, the sequence conservation in promoters and their flanking regions of each corresponding operons conserved among the E. coli strains could be resonable.

K-12

yjaA

-11-J__l5ce515i!!ZIl!Z!i5!---_ _ _ _---I111 - - -.........

EHEC-1j~'---

_ _ _~--------_c===

r----------====

"nD(F) K.12 -1j~' _ _ _ _ _ EHEC-1~--~====

"nG

K-12

-1.1-'__.... \RNA

\RNA

EHEC---1rl------~~~ ......~ none K.12---11 ~~~ tRNA

EHEC-11-1- - -- - -... ~ rrnH K-12---11 ~

~' ~

------~.

t1

-

l8mer tl

t2 ~4~------

[~:~~ ~~~ ~~~~~~~~:~~~~~~~~~~~~~~~~~~~~~ EBEC rrnF ........ ·A············ ·A··························· ·T······· K-12 rrnF .......• ·A············ ·A··························· ·T·······

t2

EHEC K-12 EBEC K-12 EBEC EHEC K-12 EHEC K-12

rrnA rrnA rrnB rrnB rrnE rrnF rrnF rrnG rrnG

- -..........~~~

~4~--­

AACTCCCAGGCA'l'CAAATAAAGCGAAAGGCCATCC-TGAC-GGATGGCC'l'TTT . . . . . . . . . . . . . . . . . 'T'" ·AG········· '-'" ._ ........... . . . . . . . . . . . . . . . . . . . T' ... AG' ..... CGG'l'CGGAAGACTG' ...... . ..........•...... 'T'" ·AG········· '-'" ._ ........... . . . . . . . . . . . . . . . . . . . A' ........•...... -' ... - ' .......... . ....••.. . A' ....... C' ......•........ -GAAA- ........... A ..•• . ... ·A······· ·C············ ··· ·-GAAA-············ . ... . . . . . . . . . . . . . . T' ..........•.... -GTCA-' ...•....... .•............... ·T··············· ' - ' " ._ ...•........

Fig. 5. Structures of terminator regions of rrn operons in EHEC and K-12. Structures of terminator regions of all the rrn operons in EHEC and K-12 are shown in the upper part. Conserved 18-mer sequences are indicated by thick lines. tl and t2 terminators are represented by gray and open boxes, respectively. A hatched box represents the terminator for K-12 rrnE. Striped boxes are terminators for rrnC or rrnH of the EHEC strain and K-12. Sequences between the tl terminator and the second 18 mer are highly conserved in rrnD(F) operons of the two strains and the EHEC rrnA and rrnB. Sequences between the 18 mer and tRNA are also highly conserved in rrnC and H operons of the two strains. In the lower part, sequences of tl and t2 terminators are aligned. Dots indicate the same nucleotide composition as the tl terminator of K-12 rrnA or the t2 terminator of EHEC rrnA. The 18-mer sequences are underlined.

rrn Operons of E. coli 0157:H7

served among these operons. When we examined the EHEC operons, this 18 mer-tl-l08 bp-18 mer-t2 structure was conserved only in rrnD(F). The rrnA and B of the EHEC strain lacked segments from t1 terminator to the second 18 mer, the result being that their t2 terminators were located immediately after each rr(. Both in K -12 and the EHEC strain, the two 18 bp sequence in rrnD(F) both differ from other 18 bp sequences by one base pair (Fig. 5). However, this GIA substitution at position 117 was accompanied by a CIT substitution at position 3 of rr(F, and these two substituted bases form base pairs. Accordingly, the secondary structure of 5S rRNA transcribed from rr(F genes was not affected. The terminator of K-12 rrnE is distinct from tl or t2 terminator. In contrast, the EHEC rrnE was followed immediately by the t2 terminator, as in rrnA, B, and C of the EHEC strain, and in rrnC of K-12. Furthermore, the yjaA gene located downstream of the K-12 rrnE is not present in the EHEC rrnE. These findings suggest that structure of the EHEC rrnE terminator region may be an original one, and that the terminator region of the K-12 rrnE may have been altered by insertion of a DNA segment encoding the yjaA gene. The intercistronic homogeneity observed in the regions following the t2 terminators is restricted to short segments (at most 42 bp in the EHEC rrnE, EHEC rrnA, and K-12 rrnA). Sequences following these short segments were specific to each operon, as was observed for the promoter regions. These operon-specific sequences were well conserved between the corresponding operons of the EHEC and K-12 strains, except for rrnE operons. As for rrnC and rrnH operons, right after which the tRNA genes follow, the rr(-tRNA spacer sequences (52 bp) were identical in the four operons of the two strains. The tRNA genes and the following terminator structures were operon-specific, and their sequences were well conserved between the corresponding operons of EHEC and K-12. Applicability of the primer sets developed for direct sequencing of the whole set of E. coli rrn operons

Two primer sets we developed in this study were designed based on the K-12 MG1655 sequence. However, both worked efficiently in nucleotide sequence determination of all seven rrn operons of the EHEC 0157:H7 Sakai strain. Since EHEC 0157:H7 strains were suggested to be phylogenetic ally most distant from K-12 (PuPo et aI., 1997), our primer sets are probably applicable to the sequence analyses of most rRNA operons from a wide range of E. coli strains. We are confident that these primer sets would be powerful tools for phylogenetic analysis of various E. coli strains based on nucleotide sequences of rrn operons, and for analyzing the evolution of rrn multigene family and the rrn skeletons of E. coli genomes. The sequence information on the whole sets of rrn operons of various E. coli strains may contribute to the molecular epidemiological analysis of pathogenic E. coli

323

strains, such as EHEC. From this point of view, some of the EHEC Sakai strain-specific variations detected in the present study (for examples, VR3 regions of the promoter region and newly identified polymorphic sites in rrl genes and rrs-rrl ITSs), would be appropriate molecular markers for the epidemiological analysis of EHEC 0157:H7 strains.

Acknowledgments We thank M. TAKAHASHI, S. SETSU, and K. SATO for technical assistance, K. YAMAMOTO, T. HONDA, and H. MORI for providing E. coli strains and their genomic DNAs, Y. TERAWAKI for encouragement, and M. OHARA and Y. HAYASHI for language assistance. This work was performed as a part of the genome sequencing project of the EHEC 0157:H7 Sakai strain which was supported by The Japan Society for the Promotion of Science, "Research for the Future" Program, 97LOOI0l and JSPS-RFTF 00L01411.

References ANT6N, A. L, MARTINEZ-MuRCIA, A. J., RODRIGUEZ-VALERA, E: Sequence diversity in the 16S-23S intergenic spacer region (ISR) of the rRNA operons in representatives of the Escherichia coli ECOR collection. J. Mol. Evol. 47, 62-72 (1998). ANT6N, A. L, MATINEZ-MuRCIA, A. J., RODRIGUEZ-VALERA, E: Intraspecific diversity of the 23S rRNA genes and spacer region downstream in Escherichia coli. J. Bacteriol. 181, 2703-2709 (1999). BLATTNER, E R., PLUNKETT III, G., BLOCH, C. A., PERNA, N. T., BURLAND, v., RILEY, M., COLLADO-VIDES, J., RODE, C. K., MAYHEW, G. E, GREGOR, J., DAVIS, N. W., KIRKPATRICK, H. A., GOEDE, M. A., ROSE, D. J., MAU, B., SHAO, Y.: The complete genome sequence of Escherichia coli. Science 277, 1453-1462 (1998). BROSIUS, J., DULL, T. J., SLEETER, D. D., NOLLER, H. E: Gene organization and primary structure of a ribosomal RNA operon from Escherichia coli. J. Mol. BioI. 148, 107-127 (1981). BROSIUS, J., PALMER, M. L., KENNEDY, P. J., NOLLER, H. E: Complete nucleotide sequence of a 16S ribosomal RNA gene from Escherichia col. Proc. Nat!. Acad. Sci. USA 75, 4801-4805 (1978). BROWNLEE, G. G., SANGER, F., BARRELL, B. G.: Nucleotide sequence of 5S-ribosomal RNA from Escherichia coli. Nature 215,735-736 (1967). CILIA, V., LAFAY, B., CHRISTEN, R.: Sequence heterogeneities among 16S ribosomal RNA sequences, and their effect on phylogenetic analyses at the species level. Mol. Bio!. Evo!. 13,451-461 (1996). CLAYTON, R. A., SUTTON, G., HINKLE, P. S., BULT, c., FIELDS, c.: Intraspecific variation in small-subunit rRNA sequences in GenBank: shy single sequences may not adequately represent prokaryotic taxa. Int. J. Syst. Bacterio!' 45, 595-599 (1995). CONDON, c., PHILIPS, J., Fu, Z.-Y., SQUIRES, C. SQUIRES, C. L.: Comparison of the expression of the seven ribosomal RNA operons in Escherichia coli. EMBO J. 11,4175-4185 (1992). DICKSON, R. R., GAAL, T., DE BOER, H. A., DE HASETH, P. L., GOURSE, R. L.: Identification of promoter mutants defective in growth-rate-dependent regulation of rRNA transcription in Escherichia coli. J. Bacteriol. 171,4862-4870 (1989). DOVER, G.: DNA turnover and the molecular clock. J. Mol. Evol. 26,47-58 (1987).

324

M. OHNISHI et al.

GUTELL, R. R., LARSEN, N., WOESE, C. R.: Lessons from an evolving rRNA. Microbiol. Rev. 58, 10-26 (1994). HUBNER, P., ARBER, W.: Mutational analysis of a prokaryotic recombinational enhancer element with two functions. EMBO J. 8,577-585 (1989). HUYSMANS, E., DE WACHTER, R.: Compilation of small ribosomal subunit RNA sequences. Nucleic Acids Res. 14, 73 (1986). KEENER, ]., NOMURA, M.: Regulation of ribosome synthesis, pp. 1417-1428. In: Escherichia coli and Salmonella typhimurium: cellular and molecular biology (NEIDHARDT, E c., CURTISS, R., III, INGRAHAM, J. L., LIN, E. C. c., Low, K. B., MAGASANIK, B., REZNIKOFF, W. S., RILEY, M., SCHAECHTER, M., UMBARGAR, H. E., eds.) 2nd Ed., Washington, D. c.: ASM Press, 1996. KENERLEY, M. E., MORGAN, E. A., POST, L., LINDAHL, L., NOMURA, M.: Characterization of hybrid plasmids carrying individual ribosomal ribonucleic acid transcription units of Escherichia coli. J. Bacteriol. 132, 931-949 (1997). KISS, A., SAIN, B., VENETIANER, P.: The number of rRNA genes in Escherichia coli. FEBS Lett. 79, 77-79 (1997). LARSEN, N.: Higher order interaction sin 23S rRNA. Proc. Natl. Acad. Sci. USA 89, 5044-5048 (1992). MAKINO, K., ISHII, K., YASUNAGA, T., HATTORI, M., YOKOYAMA, K., YUTSUDO, C. H., KUBOTA, Y., YAMAICHI, Y., IIDA, T., YAMAMOTO, K., HONDA, T., HAN, C., OHTSUBO, E., KASAMATSU, M., HAYASHI, T., KUHARA, S., SHINAGAWA, H.: Complete nucleotide sequences of 93-kb and 3.3-kb plasmids of an enterohemorrhagic Escherichia coli 0157:H7 derived from Sakai outbreak. DNA Res. 5, 1-9. MARTINEZ-MuRCIA, A. ]., ANT6N, A. 1., RODRIGUEZ-VALERA, E: Patterns of sequence variation in two regions of the 16S rRNA muitigene family of Escherichia coli. Int. J. Syst. Bacteriol. 49, 601-610 (1999).

MORGAN, E. A., IKEMURA, T., NOMURA, M.: Identification of spacer tRNA genes in individual ribosomal RNA transcription units of Escherichia coli. Proc. Nat!. Acad. Sci. USA 74, 2710-2714 (1977). MORGAN, E. A., IKEMURA, T., LiNDAHL, L., FALLON, A. M. and NOMURA, M.: Some rRNA operons in E. coli have tRNA genes at their distal ends. Cell 13, 335-344 (1978). OHNISHI, M., TANAKA, C., KUHARA, S., ISHI, K., HATTORI, M., KUROKAWA, K., YASUNAGA, T., MAKINO, K., SHINAGAWA, H., MURATA, T., NAKAYAMA, K., TERAWAKI, Y., HAYASHI, T.: Chromosome of the enterohemorrhagic Escherichia coli 0157:H7; comparative analysis with K-12 MG1655 revealed the acquisition of a large amount of foreign DNAs. DNA Res. 6, 361-368 (1999). OHTA, T.: Muitigene families and the evolution of complexity. J. Mol. Evol. 33, 34-41 (1991). OLSEN, G. J., WOESE, C. R., OVERBOOK, R.: The winds of (evolutionary) change: breathing new life into microbiology. J. Bacteriol. 176, 1-6 (1994). PuPo, G. M., KARAOLIS, D. K. R., LAN, R., REEVES, P. R.: Evolutionary relationships among pathogenic and nonpathogenic Escherichia coli strains inferred from multilocus enzyme electrophoresis and mdh sequence studies. Infect. Immun. 65, 2685-2692 (1997).

Corresponding author: TETSUYA HAYASHI, Department of Bacteriology, Shinshu University School of Medicine, 3-1-1 Asahi, Matsumoto, Nagano 3908621, Japan Tel.: +81-2 63-37-26 15, Fax: +81-2 63-37-26 16, e-mail: [email protected]