Development and validation of a TaqMan-MGB real-time RT-PCR assay for simultaneous detection and characterization of infectious bursal disease virus

Journal of Virological Methods 185 (2012) 101–107

Contents lists available at SciVerse ScienceDirect

Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet

Development and validation of a TaqMan-MGB real-time RT-PCR assay for simultaneous detection and characterization of infectious bursal disease virus Gonzalo Tomás a , Martín Hernández a , Ana Marandino a , Yanina Panzera a , Leticia Maya a , Diego Hernández a , Ariel Pereda b , Alejandro Banda c , Pedro Villegas d , Sebastián Aguirre e , Ruben Pérez a,∗ a

Sección Genética Evolutiva, Instituto de Biología, Facultad de Ciencias, Universidad de la República, Iguá 4225, 11400 Montevideo, Uruguay Instituto de Virología, CICVyA, INTA-Castelar, CC 25 (1712) Castelar, Buenos Aires, Argentina c Poultry Research and Diagnostic Laboratory, College of Veterinary Medicine, Mississippi State University, P.O. Box 97813, Pearl, MS 39288, USA d College of Veterinary Medicine, Poultry Diagnostic and Research Center, The University of Georgia, 953 College Station Road, Athens, GA 30602-4875, USA e Centro de Virología Animal, Instituto de Ciencia y Tecnología Dr. César Milstein, CONICET, Saladillo 2468, (1440) Buenos Aires, Argentina b

a b s t r a c t Article history: Received 9 February 2012 Received in revised form 26 May 2012 Accepted 13 June 2012 Available online 21 June 2012 Keywords: IBDV Real-time PCR Diagnosis Infectious bursal disease (Gumboro) Strain characterization

Rapid and reliable detection and classification of infectious bursal disease viruses (IBDVs) is of crucial importance for disease surveillance and control. This study presents the development and validation of a real-time RT-PCR assay to detect and discriminate very virulent (vv) from non-vv (classic and variant) IBDV strains. The assay uses two fluorogenic, minor groove-binding (MGB) TaqMan probes targeted to a single nucleotide polymorphism (SNP) embedded in a highly conserved genomic region. The analytical sensitivity of the assay was determined using serial dilutions of in vitro-transcribed RNA. The assay demonstrated a wide dynamic range between 102 and 108 standard RNA copies per reaction. Good reproducibility was also detected, with intra- and inter-assay coefficients of variation ranging from 0.13% to 2.23% and 0.26% to 1.92%, respectively. The assay detected successfully all the assessed vv, classical, and variant field and vaccine strains and correctly discriminated all vvIBDV strains from non-vvIBDV strains. Other common avian RNA viruses tested negative, indicating high specificity of the assay. The high sensitivity, rapidity, reproducibility, and specificity of the real-time RT-PCR assay make this method suitable for general and genotype-specific detection and quantitation. © 2012 Elsevier B.V. All rights reserved.

1. Introduction Infectious bursal disease (IBD) is a globally distributed avian viral infection that has affected commercial poultry production for almost 50 years. The IBD virus (IBDV) belongs to the Birnaviridae family, Avibirnavirus genus, which is composed of non-enveloped icosahedral viruses with a double-stranded RNA genome with two segments (Dobos, 1979; Müller et al., 1979). The major segment A (3.3 kb) encodes the main capsid protein VP2 (Da Costa et al., 2002), the viral protease VP4, and the inner capsid nucleoprotein VP3 (Lejal et al., 2000; Sanchez and Rodriguez, 1999). Segment A also encodes a non-structural protein (VP5) in a second 5 -terminal overlapping open reading frame (Mundt et al., 1995). Genomic segment B (2.9 kb) encodes only one protein, the RNA-dependent RNA polymerase VP1 (Spies et al., 1987). IBDV replicates rapidly in developing B lymphocytes in the bursa of Fabricius (Hirai et al., 1981), causing lymphocytolysis

∗ Corresponding author. Tel.: +598 2525 86 19x141; fax: +598 2525 86 17/31. E-mail addresses: [email protected], [email protected] (R. Pérez). 0166-0934/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jviromet.2012.06.012

and immunodepression (Kaufer and Weiss, 1980). The severity of IBD outbreaks can be influenced by multiple factors such as environmental and management issues, passive immunity levels, and intercurrent primary and secondary pathogens (Jackwood, 2011). Particularly important in the clinical manifestation is the pathogenicity of the involved strain (van den Berg et al., 2004). Pathogenic IBDV viruses are classified as very virulent (vv), classic (c), and variant (va) strains. The vvIBDV strains can induce clinical disease with pathological manifestations that may lead to high levels of morbidity and mortality (van den Berg, 2000). The nonvvIBDV strains (cIBDV and vaIBDV) generally produce subclinical infections that increase the susceptibility to other pathogens and induce a poor immune response to vaccines (Rosenberger and Gelb, 1978). Genetic relatedness is currently widely used to characterize IBDV strains (Hernández et al., 2006; Hosseini et al., 2004; Lojkic et al., 2008; Wu et al., 2007), providing the basis for developing new techniques for IBDV detection and characterization. Most assays use conventional reverse transcription polymerase chain reaction (RT-PCR) plus diverse genotyping techniques, particularly nucleotide sequencing and restriction fragment length

102

G. Tomás et al. / Journal of Virological Methods 185 (2012) 101–107

Table 1 Primers and probes used in this study. Primer/probe

Sequence 5 → 3

Polarity

Positiona

Amplicon size

F36 R594 F178 R272 PV PN

GGGACAGGCCGTCAAGGC ATTTTGTCGTTGATGTTGGCTGTTG GAGCCTTCTGATGCCAACAAC TCAAATTGTAGGTCGAGGTCTCTGA FAM-ACACCCTAGAGAAGC-MGB VIC-ACACCCTGGAGAAGC-MGB

+ – + – + +

36–53 594–570 178–198 272–248 222–236 222–236

559

a

95

Oligonucleotide position according to vvIBDV strain D6948 segment A sequence (AF240686).

polymorphism (RFLP) (Banda et al., 2004; Hernández et al., 2011; Jackwood and Sommer, 1997; Ture et al., 1998). Real-time RT-PCR has been incorporated more recently into IBDV analysis and is quickly becoming one of the most promising methods for improving control and epidemiological surveillance programs (Wu et al., 2007). Although several real-time RT-PCR assays have been developed for IBDV (Jackwood et al., 2003; Mickael and Jackwood, 2005; Moody et al., 2000), a limited number of them can simultaneously identify and characterize field strains using either fluorogenic probes (Peters et al., 2005) or non-specific dyes (Ghorashi et al., 2011; Kong et al., 2009). These assays require multiple-tube reactions with different probes, which increase cost and sample amount, or post-PCR melting curve analyses that must be performed by a qualified technician. For these reasons, simpler and more rapid assays for detection and classification of IBDV strains are necessary for monitoring strain spread and improving the control of this disease. This study presents the development and validation of a one-tube real-time RT-PCR assay to detect and discriminate the genogroup of the vvIBDVs from that of the non-vvIBDVs using allelic discrimination probes. This assay improves the current diagnostic capability and can be easily implemented for screening a large number of samples in a rapid, sensitive, and reproducible way. 2. Materials and methods 2.1. Sequence analysis and primer/probe design Multiple sequence alignments were carried out with the VP5/VP2 overlapping region of segment A available in the GenBank database using the clustalW algorithm implemented in MEGA 4.0 (Kumar et al., 2008). After identification of a nucleotide polymorphism that distinguishes the vvIBDV genogroup from non-vvIBDV strains, primers and TaqMan minor groove-binding (TaqMan-MGB) probes were designed and synthesized by Applied Biosystems (Foster City, CA, USA) (Table 1). 2.2. Samples 2.2.1. IBDV samples for analytical testing A vvIBDV field strain (Uy-5) and a classical vaccine strain, Nobilis Gumboro D78 (Intervet, Boxmeer, Holland), were used to standardize and test the analytical performance of the developed real-time RT-PCR assay (Table 2). 2.2.2. Avian viruses for specificity testing The following viruses were isolated from commercial vaccines: infectious bronchitis virus (IBV, Bronchitis Vaccine, Mass Type, from Fort Dodge Vaccines, Fort Dodge, IA, USA), avian reovirus (ARV; ChickVac Tenosynovitis Vaccine, from Fort Dodge Vaccines), and Newcastle diseases virus (NDV; Nobilis ND Hitchner, from Intervet).

2.2.3. IBDV samples for clinical sensitivity testing The vvIBDV genogroup was represented by 5 isolates collected from field outbreaks from Uruguay and Argentina. The non-vvIBDVs included 20 Uruguayan and Argentinean classical field isolates, as well as variant strains (Del-E) from the United States (Table 2). All field samples were obtained from infected bursae and were previously diagnosed and genotyped with RTPCR/RFLP and sequencing (Hernández et al., 2006, 2011). 2.3. RNA extraction from field samples and vaccine virus A small portion (approximately 50 mg) of an internal fold of a bursa of Fabricius was minced in 200 ␮l 5% sodium dodecyl sulfate and digested with 1 mg/ml proteinase K (Gibco BRL, Gaithersburg, MD, USA) at 60 ◦ C for 30 min. Total RNA was extracted using TRIzol® Reagent (Invitrogen, Carlsbad, CA, USA). RNA from vaccines was extracted using 200 ␮l of a PBS resuspension of lyophilized vaccine powder with the High Pure Viral RNA kit (Roche, Mannheim, Germany). The extracted RNA was resuspended in 30 ␮l nucleasefree water. 2.4. Reverse transcription and real-time PCR assay For the RT step, the RevertAidTM H Minus First Strand cDNA Synthesis kit (Fermentas Life Sciences Inc., Hanover, MD, USA) was used in a 20 ␮l final volume reaction. Total RNA (10 ␮l) was first Table 2 IBDV field samples and vaccine strain used in this study. Isolate

Strain

Origin

D78 M43 M06/10A M06/10B M07/10A M07/10B M07/10C M07/10D 421101 421102 421103 E27 A0010 28d A0010 34d A116 (2) A0094 (9) 1355 2566A 2567 1470 1472 GB4 A0013 IBDVvv Uy-5 M10 M102

Classical vaccine Classical Classical Classical Classical Classical Classical Classical Classical Classical Classical Classical Classical Classical Classical Classical Variant (Del-E) Variant (Del-E) Variant (Del-E) Variant (Del-E) Variant (Del-E) Very virulent Very virulent Very virulent Very virulent Very virulent Very virulent

USA Uruguay Uruguay Uruguay Uruguay Uruguay Uruguay Uruguay Uruguay Uruguay Uruguay Argentina Argentina Argentina Argentina Argentina USA USA USA USA USA Argentina Argentina Argentina Uruguay Uruguay Uruguay

G. Tomás et al. / Journal of Virological Methods 185 (2012) 101–107

mixed with 5 ␮M random hexamers, denatured for 5 min at 98 ◦ C, and chilled on ice. Then, 1× reaction buffer, 20 U RiboLock RNase Inhibitor, and 1 mM dNTPs were added, and the mixture was incubated for 5 min at 25 ◦ C. The reaction was completed by adding 200 U RevertAidTM H Minus M-MuLV Reverse Transcriptase, and the cDNA synthesis was carried out for 60 min at 42 ◦ C. The reaction was stopped by incubating at 70 ◦ C for 10 min. Real-time PCR was carried out in a 25 ␮l reaction containing 1× TaqMan Genotyping Master Mix (Applied Biosystems), 1× Custom TaqMan SNP Genotyping Assay (0.9 ␮M each primer and 0.2 ␮M each probe), and 1 ␮l cDNA. Thermocycling was performed on an ABI Prism 7500 (Applied Biosystems) and consisted of a 5 min incubation at 50 ◦ C, denaturation for 10 min at 95 ◦ C, followed by 40 cycles of 15 s at 95 ◦ C and 1 min at 60 ◦ C, and a final step of 5 min at 70 ◦ C. Fluorescence measurements from specific reporter fluorophores were collected at the 5 min initial incubation stage, at the 60 ◦ C step of each cycle, and at the end of the run. 2.5. Generation of standard RNA for analytical testing To obtain a template for in vitro transcription, a 559 bp genomic fragment encompassing the real-time PCR amplicon was amplified from vvIBDV and non-vvIBDV strains using the specific primers F36 and R594 (Table 1). PCR was performed using 1 ␮l template cDNA in a 15 ␮l amplification reaction containing 1× PCR reaction buffer, 2.5 mM MgCl2 , 0.25 mM dNTP mix, 0.5 ␮M each primer, and 1.5 U Taq DNA polymerase (Fermentas Life Sciences Inc.). A 96well Gradient Palm-Cycler (Corbett Life Science, Sydney, Australia) was used for amplification with the following cycling conditions: initial denaturation for 5 min at 95 ◦ C, followed by 30 cycles of denaturation for 30 s at 95 ◦ C, annealing for 1 min at 61 ◦ C, and extension for 45 s at 72 ◦ C. Amplicons were purified from agarose gels using the illustra GFXTM PCR DNA and Gel Band Purification kit (GE Healthcare, Uppsala, Sweden) and individually cloned into a pJET1.2 vector (Fermentas Life Sciences Inc.). Plasmids were recovered using the PureLinkTM Quick Plasmid Miniprep kit (Invitrogen) and sequenced to confirm the presence and orientation of the insert. The NcoI restriction enzyme (Fermentas Life Sciences Inc.) was used to linearize plasmids for in vitro transcription with the TranscriptAidTM T7 High Yield Transcription kit (Fermentas Life Sciences Inc.). Transcribed RNA was treated with RNase-free DNase and purified with phenol:chloroform. RNA concentration and purity were determined by spectrophotometry using a NanoDrop 1000 (Thermo Scientific, Waltham, MA, USA) by determining the average concentration from five measurements. Integrity of the transcribed RNA was assessed with a 2100 BioAnalyzer (Agilent Technologies, Santa Clara, CA, USA). RNA copy number was determined by the following formula: Y (RNA copies/␮l) = [X (g/␮l) RNA/(nt transcript length × 340)] × 6.022 × 1023 . RNA transcripts were diluted to obtain a stock solution of 109 copies/␮l and stored at −80 ◦ C until use.

103

linear regression line (Ginzinger, 2002; Pfaffl, 2001). An efficiency of 1 corresponds to 100% amplification efficiency. The coefficient of determination (R2 ) was also assessed and was considered to be suitable when it was higher than 0.980 in a single run (Buh Gasparic et al., 2008; Bustin, 2004). The coefficients of variation (CVs) of Ct values were assessed separately for each standard RNA dilution by analyzing three replicates of the same analytical run (intra-assay) and three repeated analyses from different analytical runs (inter-assay). 2.7. Specificity testing A BLAST search was performed to predict in silico primer and probe sequence specificity and to evaluate the occurrence of non-specific homology with other IBDV genome regions or with the chicken genome. Previously confirmed IBDV-negative samples were also processed. Cross-reaction between template DNA with both specific TaqMan-MGB probes and with other common RNA viruses (IBV, NDV and ARV) was evaluated. 2.8. Clinical sensitivity testing Twenty-five IBDV field samples were used as templates to evaluate the genotyping capacity of the real-time RT-PCR assay (Table 2). Samples were tested at least three times in different real-time PCR runs. TaqMan Genotyper Software (Applied Biosystems) was used to call vvIBDV and non-vvIBDV genotypes automatically, and the genotypes were then verified manually by analyzing amplification plots. 3. Results 3.1. Identification of informative nucleotide polymorphisms and assay design To identify nucleotide polymorphisms in the IBDV genome that could distinguish between vvIBDV and non-vvIBDV strains, an exhaustive analysis was performed for the VP5/VP2 overlapping region of the segment A sequences of most isolates (around 80 sequences) published in GenBank. Only four single nucleotide polymorphisms (SNPs) were detected that could be used to distinguish IBDV strains. The A229G SNP was selected for its high consistency to discriminate the vvIBDV genogroup from non-vvIBDV (cIBDV and vaIBDV) strains (Fig. 1), and because the A/G change maximizes differences in the Tm between allele-specific probes. A set of primers was designed to target the SNP-containing region and to amplify a 95 bp sequence (Table 1). To discriminate and quantify vvIBDV and non-vvIBDV genotypes separately, two TaqMan-MGB probes were designed and named PV , which was labeled with the fluorescent dye FAM and is specific for vvIBDV strains, and PN , which is labeled with the fluorescent dye VIC and is specific for non-vvIBDV strains.

2.6. Standard curve generation for analytical testing 3.2. Analytical performance of the assay To generate external standard curves for vvIBDV and nonvvIBDV probes, total RNA extracts (750 ng/␮l) from IBDV-negative bursae were spiked with 10-fold serial dilutions containing 100 –108 RNA copies and analyzed in three independent runs with real-time RT-PCR. The log dilution series of IBDV RNA and negative controls containing nuclease-free water were tested in duplicate along with the test samples in each run. Standard curves for each probe were generated by plotting threshold cycle (Ct) values per three replicates per standard dilution versus the logarithm of the RNA copy number to determine analytical sensitivity and efficiency of the assays. The amplification efficiency was calculated with the equation E = (10(−1/k) ) − 1, where (k) is the slope of the

The performance of the PV and PN probes was determined with separate assays. Two standard curves were generated using 10-fold serial dilutions of RNA standards from 100 to 108 RNA copies/reaction. The PV probe showed a linear dynamic range of 102 –108 RNA copies/reaction, with an average R2 of 0.9941 and an efficiency of 92%. The PN probe showed a linear dynamic range between 101 and 108 RNA copies/reaction, with an average R2 of 0.9981 and an efficiency of 95% (Fig. 2). The assay reproducibility was assessed by obtaining intra- and inter-assay CVs for each standard RNA dilution of vvIBDV and non-vvIBDV strains (Table 3).

104

G. Tomás et al. / Journal of Virological Methods 185 (2012) 101–107

Fig. 1. Alignment of the TaqMan-MGB real-time RT-PCR amplified region. Various representative vvIBDV and non-vvIBDV isolates were included. Forward and reverse primers and the probe target site are indicated.

3.3. Specificity of the assay A nucleotide BLAST search of each primer and probe showed only homology with the expected IBDV genome regions. No significant cross-reaction between vvIBDV and non-vvIBDV strains with the non-specific TaqMan-MGB probe was observed (Fig. 3). IBDVnegative field samples and non-IBDV viruses (IBV, NDV, and ARV) showed no fluorescent signal in the assay (Fig. 3).

corresponding PV -specific TaqMan-MGB probe, whereas all 20 nonvvIBDV samples were successfully detected with the PN -specific probe (Fig. 3), thus demonstrating the genotyping capacity and effectiveness of the assay. Genotyping was performed by direct visualization of the increase in fluorescence and by introducing data for one or several runs into the automated genotype-calling software. 4. Discussion

3.4. Clinical sensitivity of the assay A total of 25 previously characterized IBDV field samples were analyzed with the real-time RT-PCR assay to test its genotyping capacity. All 5 vvIBDV samples were correctly detected with the

IBDV constitutes a major threat to the poultry industry worldwide despite intensive efforts including improved biosafety practices and vaccination (Lukert and Saif, 2003). Global surveillance programs require rapid and reliable assays for diagnosis of

Table 3 Intra- and inter-assay variability of vvIBDV and non-vvIBDV TaqMan-MGB probes. RNA copies/reaction

1 × 101 1 × 102 1 × 103 1 × 104 1 × 105 1 × 106

vvIBDV

non-vvIBDV

Intra-assay variations

Inter-assay variations

Intra-assay variations

Inter-assay variations

Mean Ct

Mean Ct

CV

Mean Ct

Mean Ct

CV

– 34.93 32.83 29.01 25.14 21.32

– 1.92 0.36 0.85 0.73 0.84

35.22 32.94 29.31 25.81 22.78 18.77

35.44 33.07 29.22 25.84 22.77 18.73

1.46 1.28 0.84 0.26 0.47 0.58

–a 35.15 32.77 29.03 25.06 21.31

CV, coefficient of variation of Ct values [%]. a Ct value out of dynamic range.

CV – 1.84–2.23 0.13–0.37 0.82–1.06 0.68–0.75 0.29–1.29

CV 1.33–1.55 0.83–1.71 0.53–1.26 0.24–0.30 0.24–0.70 0.56–0.61

G. Tomás et al. / Journal of Virological Methods 185 (2012) 101–107

Fig. 2. Standard curves of the developed TaqMan-MGB real-time RT-PCR assay using vvIBDV- (A) and non-vvIBDV-specific probes (B). The linear dynamic range was established between 102 and 108 RNA copies/reaction for vvIBDV strains, whereas the range was between 101 and 108 RNA copies/reaction for non-vvIBDV strains. Each point represents the mean Ct of nine different measurements (three independent reactions, three replicates each). The coefficient of determination (R2 ) and the efficiency (E) of each linear regression curve are indicated.

IBDV variants. To be applied widely, these methods must be simple to perform, economically feasible, and provide fast results. These requirements are fulfilled by real-time PCR assays that also offer the possibility of simultaneously detecting and genotyping field or

Fig. 3. TaqMan-MGB real-time RT-PCR allelic discrimination plot. The vvIBDV () and non-vvIBDV () isolates showed increased FAM or VIC fluorescent signal, respectively. IBV, NDV, and ARV vaccine strains and IBDV-negative bursae (䊉) displayed neither significant FAM nor VIC fluorescent signal.

105

vaccine strains. Strain genotyping is critical for controlling IBDV because prognosis and treatment depend on accurate strain classification (van den Berg et al., 2000). Previous real-time PCR assays for strain identification have mainly targeted the VP2 hypervariable sequence using non-specific dyes and hybridization probes (Ghorashi et al., 2011; Jackwood and Sommer, 2005; Li et al., 2007). The high intra- and interstrain variability of this region may produce important Tm changes in target amplicons that could confound melting curve analysis. The VP2 hypervariable region also lacks single and conserved nucleotides that could be consistently used to discriminate vvIBDV and non-vvIBDV strains with fluorescent probes. VP4 sequences have also been used for designing real-time assays (Kong et al., 2009; Peters et al., 2005), but this region is moderately conserved, and there are few available sequences in GenBank to guarantee that the assay can be used in genetically diverse strains. The real-time RT-PCR assay bases its discrimination capacity on the identification of a SNP (A229G) included in the VP5/VP2 overlapping region. Overlapping sequences are some of the most conserved regions in the genome of many RNA viruses (Hughes et al., 2001), including IBDV (Hernández et al., 2010). The A229G SNP is embedded in an almost invariable region that ensures its applicability in any IBDV type as it is expected to be conserved over a longer period of time (Fig. 1). The A229G SNP produces an amino acid change in VP5, from arginine in vvIBDV strains to glycine in non-vvIBDV strains. This change is one of the two strongest VP5 markers to differentiate between vvIBDV and non-vvIBDV strains (Chong et al., 2001; Hernández et al., 2010; Hosseini et al., 2004; Lojkic et al., 2008). The selected SNP is even more consistent than the A316T SNP, also located in the VP5/VP2 overlapping region, which was previously used to identify the vvIBDV genogroup by RFLP because it is recognized by a restriction enzyme (Hernández et al., 2011). In contrast to the RFLP discrimination systems, which depend on the existence of a specific restriction enzyme for SNP identification, any selected SNP is feasible for genotyping using real-time PCR. To detect the A229G SNP, the developed assay was designed using TaqMan-MGB probes. These types of probes had not been previously used for IBDV diagnosis, but they have been successfully applied to detect and characterize many different viral pathogens (Campsall et al., 2004; Chen et al., 2009; Decaro et al., 2008; Steyer et al., 2010). TaqMan-MGB probes form extremely stable duplexes with complementary DNA (Kumar et al., 1998), permitting the use of shorter probes in the assays. The shorter length is a desirable feature in RNA viruses that have few stretches of conserved regions and provides TaqMan-MGB probes with better sequence specificity and lower fluorescent background (Kutyavin et al., 2000). A single mismatch in the probe–target duplex will result in a high Tm difference that prevents cross-hybridization to the nonspecific probe. One of the overwhelming advantages of the designed TaqManMGB probes for IBDV diagnosis is that only a single-tube real-time PCR reaction is required for the simultaneous identification and characterization of all current circulating viral forms. This means that fewer than 3 h are required to set up and perform the assay, reducing the detection time and enabling early and appropriate interventions. The real-time RT-PCR assay was evaluated by testing its specificity, sensitivity, linearity of response, and reproducibility. Analytical tests indicated that the assay had an excellent specificity and absence of cross-reactivity with IBDV-negative samples or with other common avian viruses (Fig. 3). The excellent determination coefficients, PCR efficiencies, and relatively small intra- and inter-assay variability validated the use of these methods between 102 –108 and 101 –108 RNA copies/reaction for vvIBDV and nonvvIBDV strains, respectively (Fig. 2). The detection of such a small

106

G. Tomás et al. / Journal of Virological Methods 185 (2012) 101–107

number of virus particles ensures that changes in viral titers that occur during infection progression will be accurately assessed in flock samples. This method can be fully automated, and is suitable for assaying large numbers of samples. The software can be used to analyze the results of one or several PCR runs, and it outputs a simple discrimination plot that automatically identifies positive cases and classifies the samples as vvIBDV or non-vvIBDV strains (Fig. 3). As data analysis is not required, the assay can be easily interpreted by non-specialized technicians. Finally, it is important to consider that there is a strong association between strain pathogenicity and the genotypic classification. In most cases, the isolates that are pathotyped as “high-pathogenic IBDV strains” belong to the vvIBDV genogroup, although there are a few exceptions. Examples include vvIBDV-attenuated vaccines with intermediate virulence (e.g., IBDVMB) (Lazarus et al., 2008) and the reassortment viruses that have a non-vvIBDV segment B (Le Nouën et al., 2006). Although the present assay is exclusively for genotyping, it also provides useful information about the likely pathogenicity of an outbreak. In conclusion, the possibility of screening a large number of samples in a rapid, sensitive, and reproducible way makes this assay a suitable tool for routine testing in poultry diagnostic laboratories. As the assay detected IBDV strains from both commercial vaccines and clinical specimens, it can be used to characterize field samples or evaluate the efficacy of antiviral drugs and experimental vaccines. These attributes are expected to improve IBDV surveillance worldwide and directly impact our understanding of the molecular epidemiology and the control of IBDV. Conflict of interest There are no conflicts of interest with this paper. Acknowledgments This study was supported by grants from the Instituto Nacional de Investigación Agropecuaria under project number 264 of the Fondo de Promoción de Tecnología Agropecuaria, the Comisión Sectorial de Investigación Científica, Programa de Desarrollo de las Ciencias Básicas, and the Agencia Nacional de Investigación e Innovación. We thank Granjas Hepa Ltda., the Asociación Colombiana de Médicos Veterinarios y Zootecnistas Especialistas en Avicultura, and the Poultry Diagnostic and Research Center of the University of Georgia for collaboration. Real-time equipment and capacitation were provided in part by the Programa de apoyo al desarrollo de las biotecnologías en el Mercosur – Biotech No. ALA/2005/017/350. References Banda, A., Villegas, P., El-Attrache, J., 2004. Heteroduplex mobility assay for genotyping infectious bursal disease virus. Avian Diseases 48, 851–862. Buh Gasparic, M., Cankar, K., Zel, J., Gruden, K., 2008. Comparison of different real-time chemistries and their suitability for detection and quantification of genetically modified organisms. BMC Biotechnology 8, 26. Bustin, S.A., 2004. Data analysis and interpretation. In: Bustin, S.A. (Ed.), A–Z of Quantitative PCR. International University Line, California, pp. 439–492. Campsall, P.A., Au, N.H., Prendiville, J.S., Speert, D.P., Tan, R., Thomas, E.E., 2004. Detection and genotyping of varicella-zoster virus by TaqMan allelic discrimination real-time PCR. Journal of Clinical Microbiology 42, 1409–1413. Chen, N.H., Chen, X.Z., Hu, D.M., Yu, X.L., Wang, L.L., Han, W., Wu, J.J., Cao, Z., Wang, C.B., Zhang, Q., Wang, B.Y., Tian, K.G., 2009. Rapid differential detection of classical and highly pathogenic North American Porcine Reproductive and Respiratory Syndrome virus in China by a duplex real-time RT-PCR. Journal of Virological Methods 161, 192–198. Chong, L.K., Omar, A.R., Yusoff, K., Hair-Bejo, M., Aini, I., 2001. Nucleotide sequence and phylogenetic analysis of a segment of a highly virulent strain of infectious bursal disease virus. Acta Virologica 45, 217–226. Da Costa, B., Chevalier, C., Henry, C., Huet, J.C., Petit, S., Lepault, J., Boot, H., Delmas, B., 2002. The capsid of infectious bursal disease virus contains several small

peptides arising from the maturation process of pVP2. Journal of Virology 76, 2393–2402. Decaro, N., Desario, C., Lucente, M.S., Amorisco, F., Campolo, M., Elia, G., Cavalli, A., Martella, V., Buonavoglia, C., 2008. Specific identification of feline panleukopenia virus and its rapid differentiation from canine parvoviruses using minor groove binder probes. Journal of Virological Methods 147, 67–71. Dobos, P., 1979. Peptide map comparison of the proteins of infectious bursal disease virus. Journal of Virology 32, 1047–1050. Ghorashi, S.A., O’Rourke, D., Ignjatovic, J., Noormohammadi, A.H., 2011. Differentiation of infectious bursal disease virus strains using real-time RT-PCR and high resolution melt curve analysis. Journal of Virological Methods 171, 264–271. Ginzinger, D.G., 2002. Gene quantification using real-time quantitative PCR: an emerging technology hits the mainstream. Experimental Hematology 30, 503–512. Hernández, M., Banda, A., Hernández, D., Panzera, F., Pérez, R., 2006. Detection of very virulent strains of infectious bursal disease virus (vvIBDV) in commercial broilers from Uruguay. Avian Diseases 50, 624–631. Hernández, M., Tomás, G., Hernández, D., Villegas, P., Banda, A., Maya, L., Panzera, Y., Pérez, R., 2011. Novel multiplex RT-PCR/RFLP diagnostic test to differentiate low- from high-pathogenic strains and to detect reassortant infectious bursal disease virus. Avian Diseases 55, 368–374. Hernández, M., Villegas, P., Hernández, D., Banda, A., Maya, L., Romero, V., Tomás, G., Pérez, R., 2010. Sequence variability and evolution of the terminal overlapping VP5 gene of the infectious bursal disease virus. Virus Genes 41, 59–66. Hirai, K., Funakoshi, T., Nakai, T., Shimakura, S., 1981. Sequential changes in the number of surface immunoglobulin-bearing B lymphocytes in infectious bursal disease virus-infected chickens. Avian Diseases 25, 484–496. Hosseini, S.D., Omar, A.R., Aini, I., 2004. Molecular characterization of an infectious bursal disease virus isolate from Iran. Acta Virologica 48, 79–83. Hughes, A.L., Westover, K., da Silva, J., O’Connor, D.H., Watkins, D.I., 2001. Simultaneous positive and purifying selection on overlapping reading frames of the tat and vpr genes of simian immunodeficiency vírus. Journal of Virology 75, 7966–7972. Jackwood, D.J., 2011. Viral competition and maternal immunity influence the clinical disease caused by very virulent infectious bursal disease virus. Avian Diseases 55, 398–406. Jackwood, D.J., Sommer, S.E., 1997. Restriction fragment length polymorphisms in the VP2 gene of infectious bursal disease viruses. Avian Diseases 41, 627–637. Jackwood, D.J., Sommer, S.E., 2005. Molecular studies on suspect very virulent infectious bursal disease virus genomic RNA samples. Avian Diseases 49, 246–251. Jackwood, D.J., Spalding, B.D., Sommer, S.E., 2003. Real-time reverse transcriptasepolymerase chain reaction detection and analysis of nucleotide sequences coding for a neutralizing epitope on infectious bursal disease virus. Avian Diseases 47, 738–744. Kaufer, I., Weiss, E., 1980. Significance of bursa of fabricius as target organ in infectious bursal disease of chickens. Infection and Immunity 27, 364–367. Kong, L.L., Omar, A.R., Hair-Bejo, M., Ideris, A., Tan, S.W., 2009. Development of SYBR green I based one-step real-time RT-PCR assay for the detection and differentiation of very virulent and classical strains of infectious bursal disease virus. Journal of Virological Methods 161, 271–279. Kumar, S., Nei, M., Dudley, J., Tamura, K., 2008. MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences. Briefings in Bioinformatics 9, 299–306. Kumar, S., Reed, M.W., Gamper Jr., H.B., Gorn, V.V., Lukhtanov, E.A., Foti, M., West Jr., J., Meyer, R.B., Schweitzer, B.I., 1998. Solution structure of a highly stable DNA duplex conjugated to a minor groove binder. Nucleic Acids Research 26, 831–838. Kutyavin, I.V., Afonina, I.A., Mills, A., Gorn, V.V., Lukhtanov, E.A., Belousov, E.S., Singer, M.J., Walburger, D.K., Lokhov, S.G., Gall, A.A., Dempcy, R., Reed, M.W., Meyer, R.B., Hedgpeth, J., 2000. 3 -Minor groove binder-DNA probes increase sequence specificity at PCR extension temperatures. Nucleic Acids Research 28, 655–661. Lazarus, D., Pasmanik-Chor, M., Gutter, B., Gallili, G., Barbakov, M., Krispel, S., Pitcovski, J., 2008. Attenuation of very virulent infectious bursal disease virus and comparison of full sequences of virulent and attenuated strains. Avian Pathology 37, 151–159. Le Nouën, C., Rivallan, G., Toquin, D., Darlu, P., Morin, Y., Beven, V., de Boisseson, C., Cazaban, C., Comte, S., Gardin, Y., Eterradossi, N., 2006. Very virulent infectious bursal disease virus: reduced pathogenicity in a rare natural segmentB-reassorted isolate. Journal of General Virology 87, 209–216. Lejal, N., Da Costa, B., Huet, J.C., Delmas, B., 2000. Role of Ser-652 and Lys-692 in the protease activity of infectious bursal disease virus VP4 and identification of its substrate cleaving site. Journal of General Virology 81, 983–992. Li, Y.P., Handberg, K.J., Kabell, S., Kusk, M., Zhang, M.F., Jørgensen, P.H., 2007. Relative quantification and detection of different types of infectious bursal disease virus in bursa of Fabricius and cloacal swabs using real-time RT-PCR SYBR green technology. Research in Veterinary Science 82, 126–133. Lojkic, I., Bidin, Z., Pokric, B., 2008. Sequence analysis of both genome segments of three Croatian infectious bursal disease field viruses. Avian Diseases 52, 513–519. Lukert, P.D., Saif, Y.M., 2003. Infectious bursal disease. In: Saif, Y.M. (Ed.), Diseases of Poultry. , 11th ed. Iowa State University Press, Iowa, pp. 161–179. Mickael, C.S., Jackwood, D.J., 2005. Real-time RT-PCR analysis of two epitope regions encoded by the VP2 gene of infectious bursal disease viruses. Journal of Virological Methods 128, 37–46. Moody, A., Sellers, S., Bumstead, N., 2000. Measuring infectious bursal disease virus RNA in blood by multiplex real-time quantitative RT-PCR. Journal of Virological Methods 85, 55–64.

G. Tomás et al. / Journal of Virological Methods 185 (2012) 101–107 Müller, H., Scholtissek, C., Becht, H., 1979. The genome of infectious bursal disease virus consists of two segments of double-stranded RNA. Journal of Virology 31, 584–589. Mundt, E., Beyer, J., Müller, H., 1995. Identification of a novel viral protein in infectious bursal disease virus-infected cells. Journal of General Virology 76, 437–443. Peters, M.A., Lin, T.L., Wu, C.C., 2005. Real-time RT-PCR differentiation and quantitation of infectious bursal disease virus strains using dual-labeled fluorescent probes. Journal of Virological Methods 127, 87–95. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29, e45. Rosenberger, J.K., Gelb Jr., J., 1978. Response to several avian respiratory viruses as affected by infectious bursal disease virus. Avian Diseases 22, 95–105. Sanchez, A.B., Rodriguez, J.F., 1999. Proteolytic processing in infectious bursal disease virus: identification of the polyprotein cleavage sites by site-directed mutagenesis. Virology 262, 190–199. Spies, U., Müller, H., Becht, H., 1987. Properties of RNA polymerase activity associated with infectious bursal disease virus and characterization of its reaction products. Virus Research 8, 127–140.

107

Steyer, A.F., Rojs, O.Z., Krapez, U., Slavec, B., Barlic-Maganja, D., 2010. A diagnostic method based on MGB probes for rapid detection and simultaneous differentiation between virulent and vaccine strains of avian paramyxovirus type 1. Journal of Virological Methods 166, 28–36. Ture, O., Saif, Y.M., Jackwood, D.J., 1998. Restriction fragment length polymorphism analysis of highly virulent strains of infectious bursal disease virus from Holland, Turkey, and Taiwan. Avian Diseases 42, 470–479. van den Berg, T.P., 2000. Acute infectious bursal disease in poultry: a review. Avian Pathology 29, 175–194. van den Berg, T.P., Eterradossi, N., Toquin, D., Meulemans, G., 2000. Infectious bursal disease (Gumboro disease). Revue Scientifique et Technique 19, 509–543. van den Berg, T.P., Morales, D., Eterradossi, N., Rivallan, G., Toquin, D., Raue, R., Zierenberg, K., Zhang, M.F., Zhu, Y.P., Wang, C.Q., Zheng, H.J., Wang, X., Chen, G.C., Lim, B.L., Müller, H., 2004. Assessment of genetic, antigenic and pathotypic criteria for the characterization of IBDV strains. Avian Pathology 33, 470–476. Wu, C.C., Rubinelli, P., Lin, T.L., 2007. Molecular detection and differentiation of infectious bursal disease virus. Avian Diseases 51, 515–526.