- Email: [email protected]
Development of a pan-rickettsial molecular diagnostic test based on recombinase polymerase amplification assay
Analytical Biochemistry 544 (2018) 29–33
Contents lists available at ScienceDirect
Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio
Development of a pan-rickettsial molecular diagnostic test based on recombinase polymerase amplification assay
T
Jonas Kissenköttera, Sören Hansena, Susanne Böhlken-Faschera, Olusegun George Ademowob, Oladapo Elijah Oyinloyeb, Adeleye Solomon Bakareyb, Gerhard Doblerc, Dennis Tapped, Pranav Patele, Claus-Peter Czernya, Ahmed Abd El Waheda,f,∗ a
Microbiology and Animal Hygiene, University of Goettingen, Germany Institute for Advanced Medical Research and Training, College of Medicine, University of Ibadan, Ibadan, Nigeria c Bundeswehr Institute of Microbiology, DZIF Partner Site Munich, Munich, Germany d Bernhard Nocht Institute for Tropical Medicine, Hamburg, Germany e TIB MOLBIOL Syntheselabor GmbH, Berlin, Germany f Unit of Infection Models, German Primate Center, Goettingen, Germany b
A R T I C L E I N F O
A B S T R A C T
Keywords: Recombinase polymerase amplification assay Rickettsia Mobile suitcase Point of need Rapid detection system
Rickettsioses are zoonotic vector-transmitted bacterial infections leading to flu-like symptoms and can progress to severe illness in humans. The gold standard for diagnosis of rickettsial infections is the indirect immunofluorescence assay, a serological method which is not suitable for pathogen identification during the acute phase of the disease. Therefore, several real-time PCR assays were developed. These assays are very sensitive, but require high-equipped laboratories and well-trained personnel. Hence, in this study, a rapid point-of-need detection method was developed to detect all Rickettsia species. The 23S and 16S rRNA genes were targeted to develop a recombinase polymerase amplification (RPA) assay. Both 23S and 16S_RPA assays required between seven to ten minutes to amplify and detect one or ten DNA molecules/reaction, respectively. The 16S_RPA assay detected all tested species, whereas the 23S_RPA assay identified only species of the spotted fever and transitional rickettsial groups. All results were compared with real-time PCR assays directed against the same rickettsial genes. The RPA assays are easy to handle and produced quicker results in comparison to real-time PCRs. Both RPA assays were implemented in a mobile suitcase laboratory to ease the use in rural areas. This method can help to provide rapid management of rickettsial infections.
Introduction Rickettsia spp. are nonmotile, pleomorphic and obligate intracellular Gram-negative bacteria that are transmitted by various vectors, such as ticks, fleas, body lice and mites [1]. Rodents, opossums, cats, dogs, deer and, as in the case of R. prowazekii, also humans act as reservoirs [2]. Serologically, the genus Rickettsia is divided into three groups, while by genome sequencing into four: spotted fever, typhus, ancestral and transitional groups [3]. Initially, Rickettsia tsutsugamushi (now Orientia tsutsugamushi) was placed in a fifth group (“scrub typhus group”), but was later on removed and now forms its own genus [4]. Rickettsial infections in humans are characterized by non-specific flu-like symptoms with high fever, headache and sometimes rash. In infections with spotted fever group rickettsiae, an eschar is located at the site of the arthropod bite. Despite the good treatment responses with doxycycline [1,5], typhus group rickettsiae and R. rickettsii can ∗
cause severe illness and fatal complications when misdiagnosed [6]. Moreover, the Center for Disease Control and Prevention (CDC) lists Rickettsia prowazekii, a member of the typhus group, as a bioterrorism agent. The indirect immunofluorescence assay (IFA) is applied to detect anti-rickettsia antibodies [7], but it is not suitable to recognize early acute cases as seroconversion is delayed. Alternatively, many real-time PCR assays were established to specifically identify the genome of different rickettsial species [8]. However, real-time PCR can only be used in highly equipped laboratories and performed by trained personnel. Thus, a simple molecular diagnostic test is needed to identify infected cases at point of need, especially in low resource settings, where most human cases emerge. Many isothermal amplification methods have been developed to allow DNA amplification and detection using unsophisticated devices. One of these methods is the recombinase polymerase amplification
Corresponding author. Microbiology and Animal Hygiene, University of Goettingen, Germany. E-mail address: [email protected] (A. Abd El Wahed).
https://doi.org/10.1016/j.ab.2017.12.018 Received 15 September 2017; Received in revised form 11 December 2017; Accepted 12 December 2017 Available online 16 December 2017 0003-2697/ © 2017 Elsevier Inc. All rights reserved.
Analytical Biochemistry 544 (2018) 29–33
J. Kissenkötter et al.
Table 1 List of microorganism DNA tested in the RPA assays and real-time PCR. ID
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 16 17 18 19 20 21 22 23 24 25
Name of Microorganism
Nocardia asteroids (43757) Streptococcus agalactiae (2134) Enterococcus faecalis (20478) Listeria monocytogenes (15675) Clostridium perfringens (756) Escherichia coli (30083) Staphylococcus aureus (1104) Pseudomonas aeruginosa (939) Leishmania infantum Leishmania tropica Dengue virus Yellow fever virus Zika virus Chikungunya virus Plasmodium falciparum Leptospira ballum R. rickettsii R. conorii R. africae R. felis R. prowazekii R. typhi Orientia tsutsugamushi R. slovaca R. helvetica R. monacensis
Number of samples
1 1 1 1 1 1 1 1 1 1 1 1 1 1 13 1 1 1 5 1 1 2 1 1 1 1
Provider
German Collection of Microorganisms and Cell Cultures (DSMZ)
American Type Culture Collection, Manassas, USA Institut Pasteur of Dakar, Senegal
University of Ibadan, Nigeria Bayerisches Landesamt für Gesundheit und Lebensmittelsicherheit, Germany Bernhard Nocht Institute Hamburg, Germany
Bundeswehr Institute of Microbiology, Munich, Germany
Real-time PCR
RPA
16S
23S
16S
23S
– – – – – – – – – – – – – – – – + + + + + + – + + –
– – – – – – – – – – – – – – – – + + + + + + + + + +
– – – – – – – – – – – – – – – – + + + + + + + + + +
– – – – – – – – – – – – – – – – + + + + – – – + + +
For the cross reactivity study, non-rickettsial species DNA samples contain more than 107 DNA molecules/reaction. While rickettsial standard DNA samples have 105-104 DNA molecules/ reaction. The concentration of DNA in the Rickettsial clinical samples were around 102 DNA molecules/reaction.
RPA assay conditions
(RPA) assay, which provides results within 15 min. The recombinase, the single strand binding protein and the strand displacing DNA polymerase are the key factors in the amplification phase of the RPA. Specific detection of the amplicons is guaranteed via the exo-probe, which slice at the mimic basic site upon binding to the complementary sequence. The emitted fluorescence signal can be measured in real-time using a portable reader [9]. This study, therefore, describes the development of a point of need detection system for Rickettsia spp. based on RPA assay technology.
The TwistAmp exo or exo-RT kit (TwistDx Ltd, Cambridge, UK) were used. For one reaction mix, 29.5 μl rehydration buffer, 10.7 μl H2O, 2.1 μl of each primer (10 μM) and 0.6 μl of 10 μM exoprobe were added into the reaction tube containing the freeze-dried pellet. The 2.5 μl of 280 nM magnesium acetate and 1 μl of extracted DNA or RNA were pipetted into the lid of the tubes of exo or exo-RT kits, respectively. After brief mixing and centrifugation, the strips were placed immediately into the tube scanner ESEQuant (QIAGEN Lake Constance GmbH, Stockach, Germany). The reaction was then incubated at 42 °C for 15 min. A mixing and centrifugation step was conducted after 230 s. The FAM channel signal was measured using tube scanner ESEQuant and analysed with the Tubescanner studio software (version 2.07.06, QIAGEN Lake Constance GmbH, Stockach, Germany), which determines the threshold and first derivative.
Material and methods Molecular rickettsial DNA standard and pathogen nucleic acid The molecular rickettsial DNA standard containing both 16S and 23S genes (nt 893603–893406 and 939869–940110 on GenBank accession number CP001612.1) was synthesized by GENEART GmbH (Regensburg, Germany) and a serial tenfold dilution (106-100 DNA molecules/μl) was prepared as previously described [10]. DNA from various rickettsial species, other pathogens and clinical samples that were used in the assays are listed in Table 1. Clinical rickettsia positive sample were obtained from whole blood (1x R. typhi) and skin lesions (1x R. slovaca and 4x of R. africae).
Analytical sensitivity and specificity The best primer combination for each RPA assay was determined by using a DNA molecular standard at a concentration of 105 DNA molecules/μl. A dilution range from 106 to 100 molecules/μl of the rickettsial standard DNA was applied to test the analytical sensitivity or limit of detection of each RPA assay. The cross-reactivity was tested using pathogen nucleic acids listed in Table 1, and human genome provide by the University of Ibadan, Nigeria.
RPA oligonucleotides Statistical analysis
For the development of the rickettsial RPA assay, 16S and 23S rRNA gene regions were selected for primer and probe design. In total, five forward and five reverse primers and two exo-probes were designed and tested to select the best combination, which produces the highest RPA assay sensitivity and specificity (Fig. S1). All oligonucleotides were purchased from TIB MOLBIOL (Berlin, Germany).
A semi-logarithmic regression of the data set of the eight RPA runs on 106-100 DNA molecular standard was calculated with GraphPad PRISM 7 software (GraphPad Software Inc., San Diego, California) and probit regression analyses was performed using STATISTICA software (StatSoft, Hamburg, Germany) to calculate the limit of detection in 95% of the cases. 30
Analytical Biochemistry 544 (2018) 29–33
J. Kissenkötter et al.
RPA assay runs were performed and the data set was analysed. Both 23 and 16S_RPA assays required between seven to ten minutes to amplify and detect one or ten DNA molecules/μl, respectively (Figs. 1 and 2). Furthermore, by applying the probit regression analysis, the limit of detection in 95% of the cases for the 23S and 16S RPA assays were 2 and 30 DNA molecules, respectively (Fig. 3).
Real-time PCR as a reference method For comparison, two established real-time PCR assays, one for each targeted gene, were used as reference method [11,12]. The LightCycler DNA-Master HybProbe kit (Roche, Mannheim, Germany) was used, and the reaction was performed on a LightCycler 480 (Roche, Mannheim, Germany). The mastermix was prepared as follow: 2 μl 10 × buffer, 4 μl MgCl2 (25 mM), 10.6 μl H2O, 1 μl of both the forward and reverse primers (both with a concentration of 10 μM), 0.4 μl of the probe (10 μM) and 1 μl DNA template. The LightCycler program for this real-time PCR assay started with activation of 95 °C for 10 min, followed by 45 cycles for the PCR with 95 °C/10 s, 60 °C/30 s and 72 °C/25 s and ended with a cooling period with 40 °C for 30 s. For the 16S rRNA gene, two differing forward primers were required, and therefore 0.5 μl were used from each of these forward primers (Rsp-F1: 5′- CGCAACCCTCATTCTTATT TGC-3′, Rsp-F2: 5′- CGCAACCCTTATTCTTATTTGC-3′); reverse primer, Rsp-R: 5′- CCTCTGTAAACACCATTGTAGCA-3´; the probe Rsp-P, 5′-FAM-TAAGAAAACTGCCGGTGATAAGCCGGAG-BBQ-3. For the 23S rRNA gene, the following primers and probe were used: PanR8_F (5′AGCTTGCTTTTGGATCATTTGG-3′), PanR8_R (5′- TTCCTTGCCTTTTC ATACATCTAGT-3′) and PanR8_P (5′-FAM-CCTGCTTCTATTTGTCTTGC AGTAACACGCCA-BBQ-3′).
Testing of Rickettsia spp. To determine the potential of each assay to detect all or specific rickettsial species or groups, the Rickettsia species listed in Table 1 were tested (Fig. S3). The 16S_RPA assay detected all tested Rickettsia species, and also O. tsutsugamushi, whereas the 23S_RPA assay identified only species of the spotted fever and the transitional groups. Discussion Fast diagnosis of rickettsial infections is crucial in order to select the ideal treatment, since the clinical picture is similar to other highly febrile infectious diseases (e.g. malaria). The only recommended treatment for all rickettsial species and O. tsutsugamushi is doxycycline from the class of tetracyclines [13]. Therefore, an assay for the detection of all rickettsial species without differentiation is primarily necessary. Two RPA assays were formerly developed by another group [5] to detect either R. typhi or O. tsutsugamushi. While our 16S_RPA assay developed here is able to detect all rickettsial species and O. tsutsugamushi, the second developed assay, for the 23S rRNA gene, only amplifies members of the spotted fever and the transitional rickettsial groups. The presence of mismatches in the binding regions of the primers played an important role during the strand invasion. Between 5 and 11 mismatches did not influence the binding of the RPA oligonucleotides as shown by other studies [14–16]. Up to five mismatches were identified in the forward and reverse primers of the 16S rRNA gene without affecting the assay specificity. Thus, the 16S_assay identified all tested rickettsial species, while the 23S_assay turned out to be group-specific due to the existence of 9–16 mismatches (Fig. S4). We did not observe any changes in the amplicon 2D structure, which might influence the binding of the RPA primers (data not shown). In real-time PCR, the scenario is different as the PCR primer (20 nt in length) is shorter than the RPA primers (30–35 nt); therefore, the PCR primers can be placed on the short conserved region in a particular gene to amplify all pathogen species or genotypes. So far, the gold standard for the diagnosis of rickettsial infection is the IFA. However, as patient antibodies can only be detected after seven days post infection [17], the IFA is not suitable for diagnosis in the acute phase of the disease, when early treatment could prevent complications [11]. Nucleic acid amplifications give a greater advantage with high sensitivity and specificity in the acute phase of rickettsial infection. The two real-time PCR assays used here showed a comparable sensitivity to the developed RPA assays, and no cross-reactivity with the tested non-rickettsial microorganisms (Table 1). In comparison, the RPA assays need only 15 min for detection,
Results Selection of RPA primers and probe Primers and probes were designed for two gene regions (16S and 23S rRNA genes, Fig. S1). In order to select sensitive RPA oligonucleotides, all possible primer combinations for each gene region were screened using a rickettsial DNA molecular standard at a concentration of 105 molecules/μl (Fig. S2). As a result, two primer combinations (FP2+RP3 and FP2+RP2) produced the best amplification curves in the 16S rRNA gene, and one combination (FP2+RP2) in the 23S rRNA gene. These combinations were then selected for further assay validation. Cross-reactivity To determine the cross-reactivity of the primer combinations mentioned above, nucleic acids of the 15 non-rickettsial pathogens listed in Table 1 were tested. Positive signals were recorded with many of the tested microorganisms with the FP2+RP3 of the 16S rRNA gene, while the other primer combinations detected only the rickettsial DNA. For further analyses, the 16S_RPA and 23S_RPA assays used the combination FP1+RP1 and FP2+RP2 (Table 2), which producing an amplicon with a length of 161 and 199 nt, respectively. Analytical sensitivity To determine the analytical sensitivity or limit of detection of the assays, a molecular rickettsial DNA standard was synthesized and tenfold serial dilution (106-100 DNA molecules/μl) was prepared. Eight
Table 2 The sequence of RPA primers and exo-probe combinations yielding the highest analytical sensitivity in the Rickettsia 16S and 23S RPA assays. QTF are sites of the quencher and fluorophore in the following order: BHQ1-dt (Q), Tetrahydrofuran (T) and FAM-dT (F). Name
Sequence (5′ to 3′)
Rick Rick Rick Rick Rick Rick
ATGCCGGGAACTATAAGAAAACTGCCGGQTFAAGCCGGAGGAAGGT GTCCCGCAACGAGCGCAACCCTCATTCTTAT CTCTGTAAACACCATTGTAGCACGCGTGTAGC CTATAGATGGTTGGCQTFTACTGCAAGACAAATAGAAGCAGGAAGAAAAGC AGAAACGGGAACATCCGGAAAAATGCGAATC TAGAAAAGCTCATAAGGGTAGGGTTGCTTCAATAG
16S_RPA P 16S_RPA FP1 16S_RPA RP2 23S_RPA2 P 23S_RPA2 FP2 23S_RPA2 RP2
31
Analytical Biochemistry 544 (2018) 29–33
J. Kissenkötter et al.
Fig. 1. The analytic sensitivity of Rickettsia 16S_RPA (A) and 23S_RPA assays (B). The primer combination FP1+RP2 and FP2+RP2 were used for 16S_RPA and 23S_RPA assay, respectively. A dilution range of molecular DNA standard from 106 down to 100 molecules/μl were applied to test the RPA assay limit of detection. The 16S_RPA assay detected down to 10 DNA molecules/reaction, while the 23S_RPA assay identified one DNA molecule/reaction. After 4 minutes, the tubes were mixed and centrifugated, therefore, a gap appears in the graphs.
Fig. 2. The repeatability of two Rickettsia RP assays. Using Prism Software, a semi-logarithmic regression of the data from the eight runs of the Rickettsia RPA 16S_assays (B) on a dilution range of the molecular standard (106-100 DNA molecules/reaction) were performed. In the 16S_RPA assay, 106-102 DNA molecules were detected in 8, 101 in one out of 8 RPA runs. In the 23S_RPA assay, 106-101 DNA molecules were detected in 8 and 100 in 6 out of 8 RPA runs. These data was applied for the profit regression analysis showed in Fig. 3.
whereas the real-time PCR needs at least 60 min. While the real-time PCR can only be conducted in a highly equipped laboratory, the RPA assays can, however, be deployed at low resource settings using the mobile suitcase laboratory as it contains all equipment and reagents needed for the detection of the pathogens. Moreover, RPA reagents are freeze-dried and stable under different environmental conditions (temperatures above 30 °C and up to 45 °C) [15]. This is a huge advantage in areas where highly equipped laboratories are not available, but rapid diagnostics like in the case of rickettsial infections are needed to treat promptly with the appropriate antibacterial therapy and decrease mortality [18]. Nevertheless, the health care worker do require one-day of training in order to be able to apply efficiently the RPA for the diagnosis of infected cases. In case of samples of low pathogen load in blood and skin samples, a precise mixing via vortex and pipetting are crucial. Other isothermal diagnostic methods using loop-mediated isothermal amplification for spotted fever rickettsiae [19], R. typhi [20] and O. tsutsugamushi [21] have been established by others. At least 60–120 min were needed to detect between 5 and 40 DNA copies/reaction. The detection of amplicon in LAMP relies on the turbidity index upon amplification, with at least a set of three primer pairs. However, the two RPA assays developed here yield a result much faster (in 15 min) with the same limit of detection as LAMP. Furthermore, the detection in RPA depends on an exo-probe, which provides better assay
Fig. 3. Probit regression analysis of Rickettsia 16S_RPA (black) and 23S_RPA assays (red) using STATISTICA software on the data sets of the eight RPA runs of the molecular DNA standard in dilution range 106-100 molecules/reaction. The limit of detection at 95% probability were 30 and 2 DNA molecules/reaction in 16S_RP and 23S_RPAassay, respectively.
32
Analytical Biochemistry 544 (2018) 29–33
J. Kissenkötter et al.
specificity. In conclusion, 16S_RPA and 23S_RPA assays were developed for the rapid and highly sensitive detection of rickettsial infections, advantageous at point-of-need and in poor resource settings.
Rickettsia typhi, J. Clin. Microbiol. 6 (1977) 101–110. [8] D.M. Kim, G. Park, H.S. Kim, J.Y. Lee, G.P. Neupane, S. Graves, J. Stenos, Comparison of conventional, nested, and real-time quantitative PCR for diagnosis of scrub typhus, J. Clin. Microbiol. 49 (2011) 607–612. [9] O. Piepenburg, C.H. Williams, D.L. Stemple, N.A. Armes, DNA detection using recombination proteins, PLoS Biol. 4 (2006) e204. [10] S. Hansen, J. Schafer, K. Fechner, C.P. Czerny, A. Abd El Wahed, Development of a recombinase polymerase amplification assay for rapid detection of the Mycobacterium avium subsp. Paratuberculosis, PLoS One 11 (2016) e0168733. [11] S. Giulieri, K. Jaton, A. Cometta, L.T. Trellu, G. Greub, Development of a duplex real-time PCR for the detection of Rickettsia spp. and typhus group rickettsia in clinical samples, FEMS Immunol. Med. Microbiol. 64 (2012) 92–97. [12] C.Y. Kato, I.H. Chung, L.K. Robinson, A.L. Austin, G.A. Dasch, R.F. Massung, Assessment of real-time PCR assay for detection of Rickettsia spp. and Rickettsia rickettsii in banked clinical samples, J. Clin. Microbiol. 51 (2013) 314–317. [13] M. Jensenius, P.E. Fournier, D. Raoult, Rickettsioses and the international traveler, Clin. Infect. Dis. 39 (2004) 1493–1499. [14] P. Patel, A. Abd El Wahed, O. Faye, P. Pruger, M. Kaiser, S. Thaloengsok, S. Ubol, A. Sakuntabhai, I. Leparc-Goffart, F.T. Hufert, A.A. Sall, M. Weidmann, M. Niedrig, A field-deployable reverse transcription recombinase polymerase amplification assay for rapid detection of the Chikungunya virus, PLoS Neglected Trop. Dis. 10 (2016) e0004953. [15] A. Abd El Wahed, A. El-Deeb, M. El-Tholoth, H. Abd El Kader, A. Ahmed, S. Hassan, B. Hoffmann, B. Haas, M.A. Shalaby, F.T. Hufert, M. Weidmann, A portable reverse transcription recombinase polymerase amplification assay for rapid detection of foot-and-mouth disease virus, PLoS One 8 (2013) e71642. [16] D.S. Boyle, D.A. Lehman, L. Lillis, D. Peterson, M. Singhal, N. Armes, M. Parker, O. Piepenburg, J. Overbaugh, Rapid detection of HIV-1 proviral DNA for early infant diagnosis using recombinase polymerase amplification, MBio 4 (2013). [17] D.H. Paris, J.S. Dumler, State of the art of diagnosis of rickettsial diseases: the use of blood specimens for diagnosis of scrub typhus, spotted fever group rickettsiosis, and murine typhus, Curr. Opin. Infect. Dis. 29 (2016) 433–439. [18] D. Raoult, V. Roux, Rickettsioses as paradigms of new or emerging infectious diseases, Clin. Microbiol. Rev. 10 (1997) 694–719. [19] L. Pan, L. Zhang, G. Wang, Q. Liu, Rapid, simple, and sensitive detection of the ompB gene of spotted fever group rickettsiae by loop-mediated isothermal amplification, BMC Infect. Dis. 12 (2012) 254. [20] S. Dittrich, J. Castonguay-Vanier, C.E. Moore, N. Thongyoo, P.N. Newton, D.H. Paris, Loop-mediated isothermal amplification for Rickettsia typhi (the causal agent of murine typhus): problems with diagnosis at the limit of detection, J. Clin. Microbiol. 52 (2014) 832–838. [21] D.H. Paris, S.D. Blacksell, P. Nawtaisong, K. Jenjaroen, A. Teeraratkul, W. Chierakul, V. Wuthiekanun, P. Kantipong, N.P. Day, Diagnostic accuracy of a loop-mediated isothermal PCR assay for detection of Orientia tsutsugamushi during acute Scrub Typhus infection, PLoS Neglected Trop. Dis. 5 (2011) e1307.
Acknowledgment The study was funded by Alexander von Humboldt Foundation (3.4IP-DEU/1138809). The funders had no role in design of the study, data collection and analysis, decision to publish, or preparation of the manuscript. Appendix A. Supplementary data Supplementary data related to this article can be found at http://dx. doi.org/10.1016/j.ab.2017.12.018. References [1] M. Rahi, M.D. Gupte, A. Bhargava, G.M. Varghese, R. Arora, DHR-ICMR Guidelines for diagnosis & management of Rickettsial diseases in India, Indian J. Med. Res. 141 (2015) 417–422. [2] A.F. Azad, C.B. Beard, Rickettsial pathogens and their arthropod vectors, Emerg. Infect. Dis. 4 (1998) 179–186. [3] J.J. Gillespie, M.S. Beier, M.S. Rahman, N.C. Ammerman, J.M. Shallom, A. Purkayastha, B.S. Sobral, A.F. Azad, Plasmids and rickettsial evolution: insight from Rickettsia felis, PLoS One 2 (2007) e266. [4] G. Watt, P. Parola, Scrub typhus and tropical rickettsioses, Curr. Opin. Infect. Dis. 16 (2003) 429–436. [5] C.C. Chao, T. Belinskaya, Z. Zhang, W.M. Ching, Development of recombinase polymerase amplification assays for detection of Orientia tsutsugamushi or Rickettsia typhi, PLoS Neglected Trop. Dis. 9 (2015) e0003884. [6] H.M. Biggs, C.B. Behravesh, K.K. Bradley, F.S. Dahlgren, N.A. Drexler, J.S. Dumler, S.M. Folk, C.Y. Kato, R.R. Lash, M.L. Levin, R.F. Massung, R.B. Nadelman, W.L. Nicholson, C.D. Paddock, B.S. Pritt, M.S. Traeger, Diagnosis and management of tickborne rickettsial diseases: rocky mountain spotted fever and other spotted fever group rickettsioses, Ehrlichioses, and Anaplasmosis - United States, MMWR Recomm. Rep. (Morb. Mortal. Wkly. Rep.) 65 (2016) 1–44. [7] S. Halle, G.A. Dasch, E. Weiss, Sensitive enzyme-linked immunosorbent assay for detection of antibodies against typhus rickettsiae, Rickettsia prowazekii and
33
Contents lists available at ScienceDirect
Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio
Development of a pan-rickettsial molecular diagnostic test based on recombinase polymerase amplification assay
T
Jonas Kissenköttera, Sören Hansena, Susanne Böhlken-Faschera, Olusegun George Ademowob, Oladapo Elijah Oyinloyeb, Adeleye Solomon Bakareyb, Gerhard Doblerc, Dennis Tapped, Pranav Patele, Claus-Peter Czernya, Ahmed Abd El Waheda,f,∗ a
Microbiology and Animal Hygiene, University of Goettingen, Germany Institute for Advanced Medical Research and Training, College of Medicine, University of Ibadan, Ibadan, Nigeria c Bundeswehr Institute of Microbiology, DZIF Partner Site Munich, Munich, Germany d Bernhard Nocht Institute for Tropical Medicine, Hamburg, Germany e TIB MOLBIOL Syntheselabor GmbH, Berlin, Germany f Unit of Infection Models, German Primate Center, Goettingen, Germany b
A R T I C L E I N F O
A B S T R A C T
Keywords: Recombinase polymerase amplification assay Rickettsia Mobile suitcase Point of need Rapid detection system
Rickettsioses are zoonotic vector-transmitted bacterial infections leading to flu-like symptoms and can progress to severe illness in humans. The gold standard for diagnosis of rickettsial infections is the indirect immunofluorescence assay, a serological method which is not suitable for pathogen identification during the acute phase of the disease. Therefore, several real-time PCR assays were developed. These assays are very sensitive, but require high-equipped laboratories and well-trained personnel. Hence, in this study, a rapid point-of-need detection method was developed to detect all Rickettsia species. The 23S and 16S rRNA genes were targeted to develop a recombinase polymerase amplification (RPA) assay. Both 23S and 16S_RPA assays required between seven to ten minutes to amplify and detect one or ten DNA molecules/reaction, respectively. The 16S_RPA assay detected all tested species, whereas the 23S_RPA assay identified only species of the spotted fever and transitional rickettsial groups. All results were compared with real-time PCR assays directed against the same rickettsial genes. The RPA assays are easy to handle and produced quicker results in comparison to real-time PCRs. Both RPA assays were implemented in a mobile suitcase laboratory to ease the use in rural areas. This method can help to provide rapid management of rickettsial infections.
Introduction Rickettsia spp. are nonmotile, pleomorphic and obligate intracellular Gram-negative bacteria that are transmitted by various vectors, such as ticks, fleas, body lice and mites [1]. Rodents, opossums, cats, dogs, deer and, as in the case of R. prowazekii, also humans act as reservoirs [2]. Serologically, the genus Rickettsia is divided into three groups, while by genome sequencing into four: spotted fever, typhus, ancestral and transitional groups [3]. Initially, Rickettsia tsutsugamushi (now Orientia tsutsugamushi) was placed in a fifth group (“scrub typhus group”), but was later on removed and now forms its own genus [4]. Rickettsial infections in humans are characterized by non-specific flu-like symptoms with high fever, headache and sometimes rash. In infections with spotted fever group rickettsiae, an eschar is located at the site of the arthropod bite. Despite the good treatment responses with doxycycline [1,5], typhus group rickettsiae and R. rickettsii can ∗
cause severe illness and fatal complications when misdiagnosed [6]. Moreover, the Center for Disease Control and Prevention (CDC) lists Rickettsia prowazekii, a member of the typhus group, as a bioterrorism agent. The indirect immunofluorescence assay (IFA) is applied to detect anti-rickettsia antibodies [7], but it is not suitable to recognize early acute cases as seroconversion is delayed. Alternatively, many real-time PCR assays were established to specifically identify the genome of different rickettsial species [8]. However, real-time PCR can only be used in highly equipped laboratories and performed by trained personnel. Thus, a simple molecular diagnostic test is needed to identify infected cases at point of need, especially in low resource settings, where most human cases emerge. Many isothermal amplification methods have been developed to allow DNA amplification and detection using unsophisticated devices. One of these methods is the recombinase polymerase amplification
Corresponding author. Microbiology and Animal Hygiene, University of Goettingen, Germany. E-mail address: [email protected] (A. Abd El Wahed).
https://doi.org/10.1016/j.ab.2017.12.018 Received 15 September 2017; Received in revised form 11 December 2017; Accepted 12 December 2017 Available online 16 December 2017 0003-2697/ © 2017 Elsevier Inc. All rights reserved.
Analytical Biochemistry 544 (2018) 29–33
J. Kissenkötter et al.
Table 1 List of microorganism DNA tested in the RPA assays and real-time PCR. ID
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 16 17 18 19 20 21 22 23 24 25
Name of Microorganism
Nocardia asteroids (43757) Streptococcus agalactiae (2134) Enterococcus faecalis (20478) Listeria monocytogenes (15675) Clostridium perfringens (756) Escherichia coli (30083) Staphylococcus aureus (1104) Pseudomonas aeruginosa (939) Leishmania infantum Leishmania tropica Dengue virus Yellow fever virus Zika virus Chikungunya virus Plasmodium falciparum Leptospira ballum R. rickettsii R. conorii R. africae R. felis R. prowazekii R. typhi Orientia tsutsugamushi R. slovaca R. helvetica R. monacensis
Number of samples
1 1 1 1 1 1 1 1 1 1 1 1 1 1 13 1 1 1 5 1 1 2 1 1 1 1
Provider
German Collection of Microorganisms and Cell Cultures (DSMZ)
American Type Culture Collection, Manassas, USA Institut Pasteur of Dakar, Senegal
University of Ibadan, Nigeria Bayerisches Landesamt für Gesundheit und Lebensmittelsicherheit, Germany Bernhard Nocht Institute Hamburg, Germany
Bundeswehr Institute of Microbiology, Munich, Germany
Real-time PCR
RPA
16S
23S
16S
23S
– – – – – – – – – – – – – – – – + + + + + + – + + –
– – – – – – – – – – – – – – – – + + + + + + + + + +
– – – – – – – – – – – – – – – – + + + + + + + + + +
– – – – – – – – – – – – – – – – + + + + – – – + + +
For the cross reactivity study, non-rickettsial species DNA samples contain more than 107 DNA molecules/reaction. While rickettsial standard DNA samples have 105-104 DNA molecules/ reaction. The concentration of DNA in the Rickettsial clinical samples were around 102 DNA molecules/reaction.
RPA assay conditions
(RPA) assay, which provides results within 15 min. The recombinase, the single strand binding protein and the strand displacing DNA polymerase are the key factors in the amplification phase of the RPA. Specific detection of the amplicons is guaranteed via the exo-probe, which slice at the mimic basic site upon binding to the complementary sequence. The emitted fluorescence signal can be measured in real-time using a portable reader [9]. This study, therefore, describes the development of a point of need detection system for Rickettsia spp. based on RPA assay technology.
The TwistAmp exo or exo-RT kit (TwistDx Ltd, Cambridge, UK) were used. For one reaction mix, 29.5 μl rehydration buffer, 10.7 μl H2O, 2.1 μl of each primer (10 μM) and 0.6 μl of 10 μM exoprobe were added into the reaction tube containing the freeze-dried pellet. The 2.5 μl of 280 nM magnesium acetate and 1 μl of extracted DNA or RNA were pipetted into the lid of the tubes of exo or exo-RT kits, respectively. After brief mixing and centrifugation, the strips were placed immediately into the tube scanner ESEQuant (QIAGEN Lake Constance GmbH, Stockach, Germany). The reaction was then incubated at 42 °C for 15 min. A mixing and centrifugation step was conducted after 230 s. The FAM channel signal was measured using tube scanner ESEQuant and analysed with the Tubescanner studio software (version 2.07.06, QIAGEN Lake Constance GmbH, Stockach, Germany), which determines the threshold and first derivative.
Material and methods Molecular rickettsial DNA standard and pathogen nucleic acid The molecular rickettsial DNA standard containing both 16S and 23S genes (nt 893603–893406 and 939869–940110 on GenBank accession number CP001612.1) was synthesized by GENEART GmbH (Regensburg, Germany) and a serial tenfold dilution (106-100 DNA molecules/μl) was prepared as previously described [10]. DNA from various rickettsial species, other pathogens and clinical samples that were used in the assays are listed in Table 1. Clinical rickettsia positive sample were obtained from whole blood (1x R. typhi) and skin lesions (1x R. slovaca and 4x of R. africae).
Analytical sensitivity and specificity The best primer combination for each RPA assay was determined by using a DNA molecular standard at a concentration of 105 DNA molecules/μl. A dilution range from 106 to 100 molecules/μl of the rickettsial standard DNA was applied to test the analytical sensitivity or limit of detection of each RPA assay. The cross-reactivity was tested using pathogen nucleic acids listed in Table 1, and human genome provide by the University of Ibadan, Nigeria.
RPA oligonucleotides Statistical analysis
For the development of the rickettsial RPA assay, 16S and 23S rRNA gene regions were selected for primer and probe design. In total, five forward and five reverse primers and two exo-probes were designed and tested to select the best combination, which produces the highest RPA assay sensitivity and specificity (Fig. S1). All oligonucleotides were purchased from TIB MOLBIOL (Berlin, Germany).
A semi-logarithmic regression of the data set of the eight RPA runs on 106-100 DNA molecular standard was calculated with GraphPad PRISM 7 software (GraphPad Software Inc., San Diego, California) and probit regression analyses was performed using STATISTICA software (StatSoft, Hamburg, Germany) to calculate the limit of detection in 95% of the cases. 30
Analytical Biochemistry 544 (2018) 29–33
J. Kissenkötter et al.
RPA assay runs were performed and the data set was analysed. Both 23 and 16S_RPA assays required between seven to ten minutes to amplify and detect one or ten DNA molecules/μl, respectively (Figs. 1 and 2). Furthermore, by applying the probit regression analysis, the limit of detection in 95% of the cases for the 23S and 16S RPA assays were 2 and 30 DNA molecules, respectively (Fig. 3).
Real-time PCR as a reference method For comparison, two established real-time PCR assays, one for each targeted gene, were used as reference method [11,12]. The LightCycler DNA-Master HybProbe kit (Roche, Mannheim, Germany) was used, and the reaction was performed on a LightCycler 480 (Roche, Mannheim, Germany). The mastermix was prepared as follow: 2 μl 10 × buffer, 4 μl MgCl2 (25 mM), 10.6 μl H2O, 1 μl of both the forward and reverse primers (both with a concentration of 10 μM), 0.4 μl of the probe (10 μM) and 1 μl DNA template. The LightCycler program for this real-time PCR assay started with activation of 95 °C for 10 min, followed by 45 cycles for the PCR with 95 °C/10 s, 60 °C/30 s and 72 °C/25 s and ended with a cooling period with 40 °C for 30 s. For the 16S rRNA gene, two differing forward primers were required, and therefore 0.5 μl were used from each of these forward primers (Rsp-F1: 5′- CGCAACCCTCATTCTTATT TGC-3′, Rsp-F2: 5′- CGCAACCCTTATTCTTATTTGC-3′); reverse primer, Rsp-R: 5′- CCTCTGTAAACACCATTGTAGCA-3´; the probe Rsp-P, 5′-FAM-TAAGAAAACTGCCGGTGATAAGCCGGAG-BBQ-3. For the 23S rRNA gene, the following primers and probe were used: PanR8_F (5′AGCTTGCTTTTGGATCATTTGG-3′), PanR8_R (5′- TTCCTTGCCTTTTC ATACATCTAGT-3′) and PanR8_P (5′-FAM-CCTGCTTCTATTTGTCTTGC AGTAACACGCCA-BBQ-3′).
Testing of Rickettsia spp. To determine the potential of each assay to detect all or specific rickettsial species or groups, the Rickettsia species listed in Table 1 were tested (Fig. S3). The 16S_RPA assay detected all tested Rickettsia species, and also O. tsutsugamushi, whereas the 23S_RPA assay identified only species of the spotted fever and the transitional groups. Discussion Fast diagnosis of rickettsial infections is crucial in order to select the ideal treatment, since the clinical picture is similar to other highly febrile infectious diseases (e.g. malaria). The only recommended treatment for all rickettsial species and O. tsutsugamushi is doxycycline from the class of tetracyclines [13]. Therefore, an assay for the detection of all rickettsial species without differentiation is primarily necessary. Two RPA assays were formerly developed by another group [5] to detect either R. typhi or O. tsutsugamushi. While our 16S_RPA assay developed here is able to detect all rickettsial species and O. tsutsugamushi, the second developed assay, for the 23S rRNA gene, only amplifies members of the spotted fever and the transitional rickettsial groups. The presence of mismatches in the binding regions of the primers played an important role during the strand invasion. Between 5 and 11 mismatches did not influence the binding of the RPA oligonucleotides as shown by other studies [14–16]. Up to five mismatches were identified in the forward and reverse primers of the 16S rRNA gene without affecting the assay specificity. Thus, the 16S_assay identified all tested rickettsial species, while the 23S_assay turned out to be group-specific due to the existence of 9–16 mismatches (Fig. S4). We did not observe any changes in the amplicon 2D structure, which might influence the binding of the RPA primers (data not shown). In real-time PCR, the scenario is different as the PCR primer (20 nt in length) is shorter than the RPA primers (30–35 nt); therefore, the PCR primers can be placed on the short conserved region in a particular gene to amplify all pathogen species or genotypes. So far, the gold standard for the diagnosis of rickettsial infection is the IFA. However, as patient antibodies can only be detected after seven days post infection [17], the IFA is not suitable for diagnosis in the acute phase of the disease, when early treatment could prevent complications [11]. Nucleic acid amplifications give a greater advantage with high sensitivity and specificity in the acute phase of rickettsial infection. The two real-time PCR assays used here showed a comparable sensitivity to the developed RPA assays, and no cross-reactivity with the tested non-rickettsial microorganisms (Table 1). In comparison, the RPA assays need only 15 min for detection,
Results Selection of RPA primers and probe Primers and probes were designed for two gene regions (16S and 23S rRNA genes, Fig. S1). In order to select sensitive RPA oligonucleotides, all possible primer combinations for each gene region were screened using a rickettsial DNA molecular standard at a concentration of 105 molecules/μl (Fig. S2). As a result, two primer combinations (FP2+RP3 and FP2+RP2) produced the best amplification curves in the 16S rRNA gene, and one combination (FP2+RP2) in the 23S rRNA gene. These combinations were then selected for further assay validation. Cross-reactivity To determine the cross-reactivity of the primer combinations mentioned above, nucleic acids of the 15 non-rickettsial pathogens listed in Table 1 were tested. Positive signals were recorded with many of the tested microorganisms with the FP2+RP3 of the 16S rRNA gene, while the other primer combinations detected only the rickettsial DNA. For further analyses, the 16S_RPA and 23S_RPA assays used the combination FP1+RP1 and FP2+RP2 (Table 2), which producing an amplicon with a length of 161 and 199 nt, respectively. Analytical sensitivity To determine the analytical sensitivity or limit of detection of the assays, a molecular rickettsial DNA standard was synthesized and tenfold serial dilution (106-100 DNA molecules/μl) was prepared. Eight
Table 2 The sequence of RPA primers and exo-probe combinations yielding the highest analytical sensitivity in the Rickettsia 16S and 23S RPA assays. QTF are sites of the quencher and fluorophore in the following order: BHQ1-dt (Q), Tetrahydrofuran (T) and FAM-dT (F). Name
Sequence (5′ to 3′)
Rick Rick Rick Rick Rick Rick
ATGCCGGGAACTATAAGAAAACTGCCGGQTFAAGCCGGAGGAAGGT GTCCCGCAACGAGCGCAACCCTCATTCTTAT CTCTGTAAACACCATTGTAGCACGCGTGTAGC CTATAGATGGTTGGCQTFTACTGCAAGACAAATAGAAGCAGGAAGAAAAGC AGAAACGGGAACATCCGGAAAAATGCGAATC TAGAAAAGCTCATAAGGGTAGGGTTGCTTCAATAG
16S_RPA P 16S_RPA FP1 16S_RPA RP2 23S_RPA2 P 23S_RPA2 FP2 23S_RPA2 RP2
31
Analytical Biochemistry 544 (2018) 29–33
J. Kissenkötter et al.
Fig. 1. The analytic sensitivity of Rickettsia 16S_RPA (A) and 23S_RPA assays (B). The primer combination FP1+RP2 and FP2+RP2 were used for 16S_RPA and 23S_RPA assay, respectively. A dilution range of molecular DNA standard from 106 down to 100 molecules/μl were applied to test the RPA assay limit of detection. The 16S_RPA assay detected down to 10 DNA molecules/reaction, while the 23S_RPA assay identified one DNA molecule/reaction. After 4 minutes, the tubes were mixed and centrifugated, therefore, a gap appears in the graphs.
Fig. 2. The repeatability of two Rickettsia RP assays. Using Prism Software, a semi-logarithmic regression of the data from the eight runs of the Rickettsia RPA 16S_assays (B) on a dilution range of the molecular standard (106-100 DNA molecules/reaction) were performed. In the 16S_RPA assay, 106-102 DNA molecules were detected in 8, 101 in one out of 8 RPA runs. In the 23S_RPA assay, 106-101 DNA molecules were detected in 8 and 100 in 6 out of 8 RPA runs. These data was applied for the profit regression analysis showed in Fig. 3.
whereas the real-time PCR needs at least 60 min. While the real-time PCR can only be conducted in a highly equipped laboratory, the RPA assays can, however, be deployed at low resource settings using the mobile suitcase laboratory as it contains all equipment and reagents needed for the detection of the pathogens. Moreover, RPA reagents are freeze-dried and stable under different environmental conditions (temperatures above 30 °C and up to 45 °C) [15]. This is a huge advantage in areas where highly equipped laboratories are not available, but rapid diagnostics like in the case of rickettsial infections are needed to treat promptly with the appropriate antibacterial therapy and decrease mortality [18]. Nevertheless, the health care worker do require one-day of training in order to be able to apply efficiently the RPA for the diagnosis of infected cases. In case of samples of low pathogen load in blood and skin samples, a precise mixing via vortex and pipetting are crucial. Other isothermal diagnostic methods using loop-mediated isothermal amplification for spotted fever rickettsiae [19], R. typhi [20] and O. tsutsugamushi [21] have been established by others. At least 60–120 min were needed to detect between 5 and 40 DNA copies/reaction. The detection of amplicon in LAMP relies on the turbidity index upon amplification, with at least a set of three primer pairs. However, the two RPA assays developed here yield a result much faster (in 15 min) with the same limit of detection as LAMP. Furthermore, the detection in RPA depends on an exo-probe, which provides better assay
Fig. 3. Probit regression analysis of Rickettsia 16S_RPA (black) and 23S_RPA assays (red) using STATISTICA software on the data sets of the eight RPA runs of the molecular DNA standard in dilution range 106-100 molecules/reaction. The limit of detection at 95% probability were 30 and 2 DNA molecules/reaction in 16S_RP and 23S_RPAassay, respectively.
32
Analytical Biochemistry 544 (2018) 29–33
J. Kissenkötter et al.
specificity. In conclusion, 16S_RPA and 23S_RPA assays were developed for the rapid and highly sensitive detection of rickettsial infections, advantageous at point-of-need and in poor resource settings.
Rickettsia typhi, J. Clin. Microbiol. 6 (1977) 101–110. [8] D.M. Kim, G. Park, H.S. Kim, J.Y. Lee, G.P. Neupane, S. Graves, J. Stenos, Comparison of conventional, nested, and real-time quantitative PCR for diagnosis of scrub typhus, J. Clin. Microbiol. 49 (2011) 607–612. [9] O. Piepenburg, C.H. Williams, D.L. Stemple, N.A. Armes, DNA detection using recombination proteins, PLoS Biol. 4 (2006) e204. [10] S. Hansen, J. Schafer, K. Fechner, C.P. Czerny, A. Abd El Wahed, Development of a recombinase polymerase amplification assay for rapid detection of the Mycobacterium avium subsp. Paratuberculosis, PLoS One 11 (2016) e0168733. [11] S. Giulieri, K. Jaton, A. Cometta, L.T. Trellu, G. Greub, Development of a duplex real-time PCR for the detection of Rickettsia spp. and typhus group rickettsia in clinical samples, FEMS Immunol. Med. Microbiol. 64 (2012) 92–97. [12] C.Y. Kato, I.H. Chung, L.K. Robinson, A.L. Austin, G.A. Dasch, R.F. Massung, Assessment of real-time PCR assay for detection of Rickettsia spp. and Rickettsia rickettsii in banked clinical samples, J. Clin. Microbiol. 51 (2013) 314–317. [13] M. Jensenius, P.E. Fournier, D. Raoult, Rickettsioses and the international traveler, Clin. Infect. Dis. 39 (2004) 1493–1499. [14] P. Patel, A. Abd El Wahed, O. Faye, P. Pruger, M. Kaiser, S. Thaloengsok, S. Ubol, A. Sakuntabhai, I. Leparc-Goffart, F.T. Hufert, A.A. Sall, M. Weidmann, M. Niedrig, A field-deployable reverse transcription recombinase polymerase amplification assay for rapid detection of the Chikungunya virus, PLoS Neglected Trop. Dis. 10 (2016) e0004953. [15] A. Abd El Wahed, A. El-Deeb, M. El-Tholoth, H. Abd El Kader, A. Ahmed, S. Hassan, B. Hoffmann, B. Haas, M.A. Shalaby, F.T. Hufert, M. Weidmann, A portable reverse transcription recombinase polymerase amplification assay for rapid detection of foot-and-mouth disease virus, PLoS One 8 (2013) e71642. [16] D.S. Boyle, D.A. Lehman, L. Lillis, D. Peterson, M. Singhal, N. Armes, M. Parker, O. Piepenburg, J. Overbaugh, Rapid detection of HIV-1 proviral DNA for early infant diagnosis using recombinase polymerase amplification, MBio 4 (2013). [17] D.H. Paris, J.S. Dumler, State of the art of diagnosis of rickettsial diseases: the use of blood specimens for diagnosis of scrub typhus, spotted fever group rickettsiosis, and murine typhus, Curr. Opin. Infect. Dis. 29 (2016) 433–439. [18] D. Raoult, V. Roux, Rickettsioses as paradigms of new or emerging infectious diseases, Clin. Microbiol. Rev. 10 (1997) 694–719. [19] L. Pan, L. Zhang, G. Wang, Q. Liu, Rapid, simple, and sensitive detection of the ompB gene of spotted fever group rickettsiae by loop-mediated isothermal amplification, BMC Infect. Dis. 12 (2012) 254. [20] S. Dittrich, J. Castonguay-Vanier, C.E. Moore, N. Thongyoo, P.N. Newton, D.H. Paris, Loop-mediated isothermal amplification for Rickettsia typhi (the causal agent of murine typhus): problems with diagnosis at the limit of detection, J. Clin. Microbiol. 52 (2014) 832–838. [21] D.H. Paris, S.D. Blacksell, P. Nawtaisong, K. Jenjaroen, A. Teeraratkul, W. Chierakul, V. Wuthiekanun, P. Kantipong, N.P. Day, Diagnostic accuracy of a loop-mediated isothermal PCR assay for detection of Orientia tsutsugamushi during acute Scrub Typhus infection, PLoS Neglected Trop. Dis. 5 (2011) e1307.
Acknowledgment The study was funded by Alexander von Humboldt Foundation (3.4IP-DEU/1138809). The funders had no role in design of the study, data collection and analysis, decision to publish, or preparation of the manuscript. Appendix A. Supplementary data Supplementary data related to this article can be found at http://dx. doi.org/10.1016/j.ab.2017.12.018. References [1] M. Rahi, M.D. Gupte, A. Bhargava, G.M. Varghese, R. Arora, DHR-ICMR Guidelines for diagnosis & management of Rickettsial diseases in India, Indian J. Med. Res. 141 (2015) 417–422. [2] A.F. Azad, C.B. Beard, Rickettsial pathogens and their arthropod vectors, Emerg. Infect. Dis. 4 (1998) 179–186. [3] J.J. Gillespie, M.S. Beier, M.S. Rahman, N.C. Ammerman, J.M. Shallom, A. Purkayastha, B.S. Sobral, A.F. Azad, Plasmids and rickettsial evolution: insight from Rickettsia felis, PLoS One 2 (2007) e266. [4] G. Watt, P. Parola, Scrub typhus and tropical rickettsioses, Curr. Opin. Infect. Dis. 16 (2003) 429–436. [5] C.C. Chao, T. Belinskaya, Z. Zhang, W.M. Ching, Development of recombinase polymerase amplification assays for detection of Orientia tsutsugamushi or Rickettsia typhi, PLoS Neglected Trop. Dis. 9 (2015) e0003884. [6] H.M. Biggs, C.B. Behravesh, K.K. Bradley, F.S. Dahlgren, N.A. Drexler, J.S. Dumler, S.M. Folk, C.Y. Kato, R.R. Lash, M.L. Levin, R.F. Massung, R.B. Nadelman, W.L. Nicholson, C.D. Paddock, B.S. Pritt, M.S. Traeger, Diagnosis and management of tickborne rickettsial diseases: rocky mountain spotted fever and other spotted fever group rickettsioses, Ehrlichioses, and Anaplasmosis - United States, MMWR Recomm. Rep. (Morb. Mortal. Wkly. Rep.) 65 (2016) 1–44. [7] S. Halle, G.A. Dasch, E. Weiss, Sensitive enzyme-linked immunosorbent assay for detection of antibodies against typhus rickettsiae, Rickettsia prowazekii and
33