Development of a real-time recombinase polymerase amplification assay for rapid detection of Salmonella in powdered infant formula

Journal Pre-proof Development of a real-time recombinase polymerase amplification (RPA) assay for rapid detection of Salmonella in powdered infant formula Hanlu Hong, Chongzhen Sun, Shuang Wei, Xia Sun, Anthony Mutukumira, Xiyang Wu PII:

S0958-6946(19)30216-X

DOI:

https://doi.org/10.1016/j.idairyj.2019.104579

Reference:

INDA 104579

To appear in:

International Dairy Journal

Received Date: 25 July 2019 Revised Date:

26 September 2019

Accepted Date: 29 September 2019

Please cite this article as: Hong, H., Sun, C., Wei, S., Sun, X., Mutukumira, A., Wu, X., Development of a real-time recombinase polymerase amplification (RPA) assay for rapid detection of Salmonella in powdered infant formula, International Dairy Journal, https://doi.org/10.1016/j.idairyj.2019.104579. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier Ltd.

Development of a real-time recombinase polymerase amplification (RPA) assay for rapid detection of Salmonella in powdered infant formula

Hanlu Hong a, Chongzhen Sun a, Shuang Wei b, Xia Sun c, Anthony Mutukumira d, Xiyang Wu a,*

a

Department of Food Science and Engineering, Jinan University, Guangzhou, China

b

Guangdong Entry-Exit Inspection and Quarantine Bureau, Guangzhou, China

c

Da Yuan Oasis Technologies, Guangzhou, China

d

Institute of Food Science and Technology, Massey University, Albany Campus, New Zealand

* Corresponding author. Tel.: E-mail address: [email protected] (X. Wu)

__________________________________________________________________________ ABSTRACT

Salmonella is a foodborne pathogen that may cause serious neonatal disease. In this study, an isothermal real-time recombinase polymerase amplification (RPA) was established to detect Salmonella at 37 °C within 20 min, with the detection sensitivity of 103 cfu mL-1 in pure culture. In food applications using powdered infant formula (PIF), the detection limit of Salmonella using this assay was 2 × 103 cfu mL-1 without a pre-enrichment procedure. When PIF was spiked with Salmonella at 0.1, 1 and 10 cfu mL-1 and enriched at 37 °C, results showed that this assay can detect Salmonella at initial inoculation level of 0.1 cfu mL-1 in PIF after 8 h pre-enrichment. This real-time RPA assay was considerably faster than qPCR and exhibited no losses in detection sensitivity and specificity, therefore it was suitable for on-site detection, especially in resource-poor environments. ______________________________________________________________________________________

1.

Introduction

Salmonella is a pathogen, the presence of which is easily overlooked in infant formula due to its low-level contamination (Cahill, Wachsmuth, Costarrica Mde, & Embarek, 2008). A major drawback is that the traditional culture-based methods to detect Salmonella are labour-intensive and it normally takes 2–3 days for the results to be known and up to 7–10 days for confirmation (Salam, Uludag, & Tothill, 2013). Nowadays, the real-time PCR technique is generally used for a quantitative detection of pathogenic bacteria (Cremonesi et al., 2014; Taminiau, Korsak, Lemaire, Delcenserie, & Daube, 2014; Wang, Zhu, Xu, & Zhou, 2012; Zhou et al., 2016). Yet, as valuable as PCR is, the requirement for a sophisticated thermocycler to provide the cyclic heating and cooling process has largely bound PCR to implementation within the walls of a laboratory, hindering its application in low-resource settings (Li, Macdonald, & von Stetten, 2019). The major isothermal amplification techniques currently utilised include loop-mediated isothermal amplification (LAMP), strand displacement amplification (SDA), rolling circle amplification (RCA), multiple displacement amplification (MDA) and helicase-dependent amplification (HDA) (Asiello & Baeumner, 2011; Craw & Balachandran, 2012; Gill & Ghaemi, 2008; Yan et al., 2014; Zhao, Chen, Li, Wang, & Fan, 2015). Of these, RPA, LAMP and HDA can be considered truly isothermal, as there is no requirement for a denaturation step to initiate amplification. Among the isothermal amplification methods, recombinase polymerase amplification (RPA) assay has advantages of amplification at a relatively low temperature (37 to 42 °C), within about 10–20 min (James & Macdonald, 2015). Reports have shown that RPA exhibited performance comparable with PCR in terms of tolerance to mismatches, inhibitors and background DNA (Rohrman & Richards-Kortum, 2015; Rosser, Rollinson, Forrest, &

Webster, 2015; Yamanaka, Tortajada-Genaro, & Maquieira, 2017). RPA has been successfully used in the detection of pathogenic bacteria and viruses in clinical and food samples (Boyle et al., 2013; Crannell, Rohrman, & Richards-Kortum, 2014; Glais & Jacquot, 2015; Gao et al., 2018; Kim & Lee, 2016; Teoh et al., 2015; Xia et al., 2015; Zhu et al., 2018). Moreover, realtime RPA assay was miniaturised into a standard diagnostic suitcase (Abd El Wahed, Weidmann, & Hufert, 2015), which contained all the reagents and equipment necessary for the real-time RPA assay. Therefore, it was beneficial for on-site detection. In this study, we aim to develop a real-time RPA to rapid detect Salmonella in powdered infant formula (PIF).

2.

Materials and methods

2.1.

Bacterial culture and DNA extraction

The bacterial strains used in this study are listed in Table 1. An overnight culture of each strain was prepared separately by inoculating a single colony grown on Luria Bertani (LB) agar into 5 mL of LB broth, followed by incubation at 37 °C in a shaker at 120 rpm. Bacterial genomic DNA was extracted using a DNA extraction Kit (Tiangen, Beijing, China) according to the manufacturer’s instruction.

2.2.

Primer and probe design for real-time RPA assay

The primers and probe were designed based on the Salmonella invasion protein coding gene, invA, via Primer-BLAST combined with Primer Premier 5.0 software, according to the TwistDx® instruction manual (TwistDx Inc. Cambridge, UK). As described in Table 2, the Salmonella primers were designed to amplify a 219 bp segment in this study

for real-time RPA (GenBank accession number: U43248.1), the primers for qPCR were acquired from the published paper (Malorny et al., 2004). All primers and probes were synthesised by Sangon (Sangon Biotech, Shanghai, China).

2.3.

Set up of real-time RPA assay and real-time PCR assay conditions

The real-time RPA reactions were performed in 50 µL using TwistAmp exo kit (TwistDX, Cambridge, UK). Other components included 420 nM each RPA primer, 120 nM exo probe, 14 mM magnesium acetate, and 2 µL of DNA template. The reaction tubes were then placed in a fluorescence analyser with a miniaturised optical detector (QT-RAA-F1620, Jiangsu Qitian Bio-Tech Co. Ltd., China) to start the reaction at 37 °C. Samples that produced an exponential amplification curve above the threshold of the negative control within 20 min were considered positive. The threshold time (TT) was calculated based on the “fluorescence increase above threshold” by the Genie Explorer software when the RPA reaction was completed. qPCR assay was composed 20 µL containing 10 µL SYBR premix DimerEraser (Takara Bio Inc, Dalian, China), 0.6 µL of each primer, 7.4 µL ddH2O and 1 µL of DNA template. The StepOne Plus software (Applied Biosystems) was set up for SYBR Green reagent-fast run protocol which consisted of a 95 °C initial denaturation for 30 s followed by 40 cycles of amplification, with each cycle consisting of denaturation at 95 °C for 5 s and a combined annealing/extension step at 60 °C for 30 s. The data were represented by “cycle threshold” (CT).

2.4.

Evaluation of the specificity for the real-time RPA assay

To verify the specificity of the primers, a large selection of bacterial strains were tested by real-time RPA, including 8 Salmonella strains in different serotype and 30 non-target strains. All the strains used in the experiment are shown in Table 1.

2.5.

Sensitivity in pure bacterial culture and artificially inoculated infant formula

A 1 mL of pure culture was centrifuged at 8000 × g for 10 min and the pellet was resuspended in an equal volume of sterile water. DNA templates were obtained using the DNA extraction Kit. To test the limit of detection (LOD), 10-fold serially diluted concentrations ranging from 108 to 102 cfu mL-1 of Salmonella typhimurium (ATCC 14028) were subjected to DNA extraction, followed by the real-time RPA assay and qPCR assay. Overnight cultures of S. typhimurium (ATCC 14028) were serially diluted (10-fold) with 9 ml of sterile water and 1 g PIF to achieve a final concentration of 2 × 108 to 2 × 102 cfu mL-1. The artificially inoculated infant formula samples were analysed using the real-time RPA and qPCR after DNA extraction.

2.6.

Sensitivity in PIF spiking with Salmonella after enrichment

PIF (Friso, Holland) was purchased from the local supermarket. It was free of Salmonella spp. after being tested according to the Chinese national standard (GB 4789.42016). Ten grams of the commercial PIF solid powder were add to 90 mL buffered peptone water (BPW). The PIF solution was then inoculated with ten-fold serial dilutions of an overnight culture to obtain final contaminations of S. typhimurium (ATCC 14028) at 10, 1 and 0.1 cfu mL-1, and incubated at 37 °C with shaking. The enrichment broth samples (1 mL) were collected at 4, 6 and 8 h for DNA extraction to perform real-time RPA assay and qPCR

assay.

2.7.

Statistical analysis and repeatability analysis

All experiments were replicated three times with triplicate measurements, and data were presented as means ± standard deviation (SD) of triplicate determinations. All data were analysed using analysis of variance (ANOVA). To verify the reproducibility of the real-time RPA assay, 20 replicates were performed using DNA templates of ten-fold serial dilutions from pure culture and PIF, respectively. All bacterial concentrations were log10 transformed, the probit regression was calculated using the Origin 9.0 (Origin Lab Corp., Northampton, Mass, USA).

3.

Results

3.1.

Analytical specificity of the real-time RPA

All 8 Salmonella strains showed positive signals and 30 non-target strains gave negative signals (as shown in Table 1). These results revealed that there was no crossreactivity among the different strains and the primers selected for this real-time RPA assay exhibited 100% specificity.

3.2.

The LOD in pure culture and artificially inoculated infant formula

Standard curves created by serial dilution showed a linear relationship between log cfu mL-1 and TT values or log cfu mL-1 and CT values. The LOD of real-time RPA assay and

qPCR assay were comparable, detecting 103 cfu mL-1 of Salmonella in pure culture (Fig. 1). The TT values required for real-time RPA to detect concentrations from 108 cfu mL-1 to 103 cfu mL-1 were approximately 1 to 12 min, while the CT values required for qPCR were between 13.40 and 32.54 (approximately 14–33 min). The LOD of real-time RPA in PIF was 2 × 103 cfu mL-1, which was consistent with the LOD of qPCR (Fig. 2). The TT values required for real-time RPA to detect concentrations from 2 × 108 cfu mL-1 to 2 × 103 cfu mL-1 were approximately 1.67 to 17 min, while the CT values required for qPCR were between 14.24 and 34.45 (approximately 15–35 min). The LOD in PIF was similar to LOD in pure culture. However, the TT values and CT values were higher than that of pure culture due to the influence of food matrix.

3.2.

Detection of Salmonella in artificially contaminated PIF after enrichment

Due to the low-level contamination of Salmonella in PIF, an enrichment step was usually essential for detection with the aim of increasing specificity and sensitivity. In this study, results detected by real-time RPA and qPCR were shown in Table 3. After enrichment for 6 h, real-time RPA obtained positive results within 13.67 min when PIF samples were contaminated with 10 cfu mL-1 of Salmonella, whereas qPCR with CT values at 30.29 required approximately 31 min. After 8 h of enrichment, real-time RPA obtained positive results within 16.67 min when PIF samples were contaminated with 0.1 cfu mL-1 of Salmonella, whereas qPCR with CT values at 34.26 required approximately 35 min. Therefore, real-time RPA assay was faster than qPCR, but still equally sensitive.

3.3.

Repeatability analysis of real-time RPA

To evaluate the repeatability of the real-time RPA assay, we extracted Salmonella DNA from pure culture and from spiked PIF, and then performed 20 replicates on ten-fold serial dilutions respectively. The detection probability of DNA concentration of 103 cfu mL-1 was 95% in pure culture. However, at 102 cfu mL-1, the detection probability was only 5%. The detection probability in spiked PIF was consistent with that in pure culture (Fig. 3). These results indicated that the real-time RPA assay had excellent repeatability.

4.

Discussion

The invA gene of S. typhimurium used in this study has been previously evaluated as a means of detecting a large number of different Salmonella serotypes (Rahn et al., 1992). The 8 different serotypes selected in this experiment represent the major foodborne Salmonella. To our knowledge, this is the first time that real-time RPA assay was applied for the detection of Salmonella in PIF. Previously, research has focused on RPA detection of Salmonella in other food samples such as eggs, shellfish and milk (Chen, Zhong, Luo, Zhang, & Huang, 2019; Gao et al., 2018; Kim & Lee, 2016). The real-time RPA had equal sensitivity as qPCR in this study. However, the reaction time of the RPA was much shorter. We believe that this might be due to different enzyme kinetics and reaction mechanism between these two assays. The efficiency of the RPA assay might be affected by different factors such as temperature, agitation, reaction volume, etc. (Kersting, Rausch, Bier, & von Nickisch-Rosenegk, 2014; Lillis et al., 2016; Moody, Newell, & Viljoen, 2016). We have tested the reaction temperature at a range from 37 to 42 °C and found that the TT value was delayed with increasing temperature, but had no effect on LOD (data not shown). In general, the operating temperature of real-time RPA is between 37 °C and 42 °C, but not more than 49 °C, which may destroy the activity of the enzyme. In the

comparison of reaction times, we have also found that the LOD was not affected even when reaction time was elongated to 30 min or 40 min (data not shown). To verify whether the presence of the food matrix would affect the sensitivity of the assay, we have tested the sensitivity in the pure culture and spiked PIF. The results showed that neither the real-time RPA assay nor the qPCR assay was significantly affected by the matrix. A previous study showed that an equal sensitivity of a qPCR assay to detect C. sakazakii in pure culture and in PIF (Li et al., 2016), which is consistent with our result. However, when the level of pathogens contamination was particularly low, a pre-enrichment step was necessary (Hyeon, Park, Choi, Holt, & Seo, 2010; Kim & Lee, 2017; Singh, Batish, & Grover, 2012; Wang, Zhu, Xu, & Zhou, 2012). RPA provides a convenient detection platform for the field, point of care (POC) or places with poor environmental resources, which is beyond the reach of PCR or traditional culture-based methods. To our knowledge, RPA was the first isothermal technology to demonstrate non-instrumentation requirements (body temperature), which is very important criteria for POC applications. In addition, RPA reagents did not require cold chain storage and were transported for short periods at temperatures up to 45 °C and would perform satisfactorily even if exposed to elevated temperatures for short periods of time (Lillis et al., 2016). These results provide further evidence for the potential of RPA-based analysis as a diagnostic tool in resource limited settings. RPA is more cost-effective based on the reduced time, labor and transportation/preparation. It was also worth noting that the real-time fluorometer for RPA testing was four times cheaper than the price of LAMP equipment and six times lower than the device for PCR (Teoh et al., 2015). In short, RPA is a promising molecular detection technology, which is worth further development in upcoming years.

5.

Conclusion

In summary, the present study has developed a rapid and sensitive real-time RPA for detecting Salmonella in PIF. The entire amplification and detection completed within 20 min at 37 °C, which undoubtedly improved the efficiency of on-site detection. Real-time RPA has an equal sensitivity to qPCR, but with the advantage of shorter reaction time. Among the isothermal amplification techniques, real-time RPA was significant for the prevention and control of Salmonella and other foodborne bacteria in on-site tests especially in low-resource settings.

Acknowledgements

This study was supported by Industry-University-Research Collaborative Innovation Project of Guangzhou (grant number 201704030096), the Science and Technology Project of Guangdong Province (grant number 2015A050502030) and National Key R&D Program of China (grant number 2018YFC1602500). The authors would like to thank the Guangdong Entry-Exit Inspection and Quarantine Bureau for providing reference strains.

References

Abd El Wahed, A., Weidmann, M., & Hufert, F. T. (2015). Diagnostics-in-a-suitcase: Development of a portable and rapid assay for the detection of the emerging avian influenza A (H7N9) virus. Journal of Clinical Virology, 69, 16–21. Asiello, P. J., & Baeumner, A. J. (2011). Miniaturized isothermal nucleic acid amplification: A review. Lab on A Chip, 11, 1420–1430. Boyle, D. S., Lehman, D. A., Lillis, L., Peterson, D., Singhal, M., Armes, N., et al. (2013).

Rapid detection of HIV-1 proviral DNA for early infant diagnosis using recombinase polymerase amplification. mBio, 4, Article 00135–13. Cahill, S. M., Wachsmuth, I. K., Costarrica Mde, L., & Embarek, B. (2008). Powdered infant formula as a source of Salmonella infection in infants. Clinical Infectious Disease, 46, 268–273. Chen, Z. G., Zhong, H. X., Luo, H., Zhang, R.Y., & Huang, J. R. (2019). Recombinase polymerase amplification combined with unmodified gold nanoparticles for Salmonella detection in milk. Food Analytical Methods, 12, 190–197. Crannell, Z. A., Rohrman, B., & Richards-Kortum, R. (2014). Quantification of HIV-1 DNA using real-time recombinase polymerase amplification. Analytical Chemistry, 86, 5615–5619. Craw, P., & Balachandran, P. (2012). Isothermal nucleic acid amplification technologies for point-of-care diagnostics: A critical review. Lab on A Chip, 12, 2469–2486. Cremonesi, P., Pisani, L. F., Lecchi, C., Ceciliani, F., Martino, F., Bonastre, A. S., et al. (2014). Development of 23 individual TaqMan (R) real-time PCR assays for identifying common foodborne pathogens using a single set of amplification conditions. Food Microbiology, 43, 35–40. Gao, W. F., Huang, H. L., Zhu, P., Yan, X. J., Fan, J. Z., Jiang, J. P., et al. (2018). Recombinase polymerase amplification combined with lateral flow dipstick for equipment-free detection of Salmonella in shellfish. Bioprocess and Biosystems Engineering, 41, 603–611. Gill, P., & Ghaemi, A. (2008). Nucleic acid isothermal amplification technologies - A review. Nucleosides Nucleotides & Nucleic Acids, 27, 224–243. Glais, L., & Jacquot, E. (2015). Detection and characterization of viral species/subspecies using isothermal recombinase polymerase amplification (RPA) assays. Methods in

Molecular Biology, 1302, 207–225. Hyeon, J. Y., Park, C., Choi, I. S., Holt, P. S., & Seo, K. H. (2010). Development of multiplex real-time PCR with internal amplification control for simultaneous detection of Salmonella and Cronobacter in powdered infant formula. International Journal of Food Microbiology, 144, 177–181. James, A., & Macdonald, J. (2015). Recombinase polymerase amplification: Emergence as a critical molecular technology for rapid, low-resource diagnostics. Expert Review of Molecular Diagnostics, 15, 1475–1489. Kersting, S., Rausch, V., Bier, F. F., & Nickisch-Rosenegk, M. (2014). Rapid detection of Plasmodium falciparum with isothermal recombinase polymerase amplification and lateral flow analysis. Malaria Journal, 13, Article 99. Kim, J. Y., & Lee, J. L. (2016). Rapid detection of Salmonella enterica serovar enteritidis from eggs and chicken meat by real-time recombinase polymerase amplification in comparison with the two-step real-time PCR. Journal of Food Safety, 36, 402–411. Kim, J. Y., & Lee, J. L. (2017). Development of a multiplex real-time recombinase polymerase amplification (RPA) assay for rapid quantitative detection of Campylobacter coli and jejuni from eggs and chicken products. Food Control, 73, 1247–1255. Li, Y. H., Chen, Q. M., Jiang, H., Jiao, Y., Lu, F. X., Bie, X. M., et al. (2016). Novel development of a qPCR assay based on the rpoB gene for rapid detection of Cronobacter spp. Current Microbiology, 72, 436–443. Lillis, L., Siverson, J., Lee, A., Cantera, J., Parker, M., Piepenburg, O., et al. (2016). Factors influencing recombinase polymerase amplification (RPA) assay outcomes at point of care. Molecular and Cellular Probes, 30, 74–78. Malorny, B., Paccassoni, E., Fach, P., Bunge, C., Martin, A., & Helmuth, R. (2004).

Diagnostic real-time PCR for detection of Salmonella in food. Applied and Environmental Microbiology, 70, 7046–7052. Moody, C., Newell, H., & Viljoen, H. (2016). A mathematical model of recombinase polymerase amplification under continuously stirred conditions. Biochemical Engineering Journal, 112, 193–201. Rahn, K., De Grandis, S. A., Clarke, R. C., McEwen, S. A., Galan, J. E., Ginocchio, C., et al. (1992). Amplification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella. Molecular and Cellular Probes, 6, 271–279. Rohrman, B., & Richards-Kortum, R. (2015). Inhibition of recombinase polymerase amplification by background DNA: A lateral flow-based method for enriching target DNA. Analytical Chemistry, 87, 1963–1967. Rosser, A., Rollinson, D., Forrest, M., & Webster, B. L. (2015). Isothermal recombinase polymerase amplification (RPA) of Schistosoma haematobium DNA and oligochromatographic lateral flow detection. Parasites & Vectors, 8, Article 446. Salam, F., Uludag, Y., & Tothill, I. E. (2013). Real-time and sensitive detection of Salmonella typhimurium using an automated quartz crystal microbalance (QCM) instrument with nanoparticles amplification. Talanta, 115, 761–767. Singh, J., Batish, V. K., & Grover, S. (2012). Simultaneous detection of Listeria monocytogenes and Salmonella spp. in dairy products using real time PCR-melt curve analysis. Journal of Food Science and Technology-Mysore, 49, 234–239. Taminiau, B., Korsak, N., Lemaire, C., Delcenserie, V., & Daube, G. (2014). Validation of real-time PCR for detection of six major pathogens in seafood products. Food Control, 44, 130–137. Teoh, B. T., Sam, S. S., Tan, K. K., Danlami, M. B., Shu, M. H., Johari, J., et al. (2015). Early

detection of dengue virus by use of reverse transcription-recombinase polymerase amplification. Journal of Clinical Microbiology, 53, 830–837. Wang, X., Zhu, C. Q., Xu, X. L., & Zhou, G. H. (2012). Real-time PCR with internal amplification control for the detection of Cronobacter spp. (Enterobacter sakazakii) in food samples. Food Control, 25, 144–149. Xia, X. M., Yu, Y. X., Hu, L. H., Weidmann, M., Pan, Y. J., Yan, S. L., et al. (2015). Rapid detection of infectious hypodermal and hematopoietic necrosis virus (IHHNV) by real-time, isothermal recombinase polymerase amplification assay. Archives of Virology, 160, 987–994. Yamanaka, E. S., Tortajada-Genaro, L. A., & Maquieira, A. (2017). Low-cost genotyping method based on allele-specific recombinase polymerase amplification and colorimetric microarray detection. Microchimica Acta, 184, 1453–1462. Yan, L., Zhou, J., Zheng, Y., Gamson, A. S., Roembke, B. T., Nakayama, S., et al. (2014). Isothermal amplified detection of DNA and RNA. Molecular Biosystems, 10, 970– 1003. Zhao, Y. X., Chen, F., Li, Q., Wang, L. H., & Fan, C. H. (2015). Isothermal amplification of nucleic acids. Chemistry Reviews, 115, 12491–12545. Zhou, B. Q., Chen, B. L., Wu, X., Li, F., Yu, P., Aguilar, Z. P., et al. (2016). A new application of a sodium deoxycholate-propidium monoazide-quantitative PCR assay for rapid and sensitive detection of viable Cronobacter sakazakii in powdered infant formula. Journal of Dairy Science, 99, 9550–9559. Zhu, P., Gao, W. F., Huang, H. L., Jiang, J. P., Chen, X. F., Fan, J. Z., et al. (2018). Rapid detection of Vibrio parahaemolyticus in shellfish by real-time recombinase polymerase amplification. Food Analytical Methods, 11, 2076–2084.

1

Figure legends

2 3

Fig. 1. Amplification curve (A) of using a dilution range of 108 to 103 cfu mL-1 by

4

real-time RPA (NCT, no-template control); standard curves (B) generated from the

5

threshold time (min) of ten-fold serial dilutions of Salmonella in pure culture (8 to 3

6

log cfu mL-1) by real-time RPA; amplification curve (C) of using a dilution range of

7

108 to 103 cfu mL-1 by qPCR (NCT, no-template control); standard curves (D)

8

generated from the threshold cycle numbers of ten-fold serial dilutions of Salmonella

9

in pure culture (8 to 3 log cfu mL-1) by qPCR.

10 11

Fig. 2. Standard curves generated by (A) real-time RPA from the threshold time (min)

12

and (B) qPCR from the threshold cycle numbers of ten-fold serial dilutions of

13

Salmonella in PIF (8.30 to 3.30 log cfu mL-1).

14 15

Fig. 3. The probit regression analysis in (A) pure culture (the LOD of the real-time

16

RPA was 103 cfu mL-1 in 95% of cases) and (B) PIF (the LOD of the real-time RPA

17

was 2 × 103 cfu mL-1 in 95% of cases).

1

Table 1 Bacterial strains used for the specificity and sensitivity test in this study. a Bacterial strains

Source

Rt RPA

Bacterial strains

Source

Rt RPA

S. typhimurium

ATCC 14028

+

Staphylococcus epidermidis

ATCC 14990

-

S. tennessee

GEIQB

+

Yersinia enterocolitica

ATCC 9610

-

S. anatum

GEIQB

+

Proteus mirabilis

ATCC 29906

-

S. agona

GEIQB

+

Shigella flexneri

CICC 21678

-

S. enteritidis

ATCC 13076

+

Shigella boydii

ATCC 12028

-

S. virchow

GEIQB

+

Shigella sonnei

ATCC 29930

-

S. london

GEIQB

+

Klebsiella pneumoniae

ATCC 4352

-

S. ealing

GEIQB

+

Vibrio parahaemolyticus

ATCC 17802

-

Enterobacter cloacae

ATCC 13047

-

Pseudomonas aeruginosa

CMCC 10104

-

Non-Salmonella strains (n = 30; continued)

Salmonella strains (n = 8)

Non-Salmonella strains (n = 30) Escherichia coli

ATCC 29522

-

Pseudomonas fluorescens

ATCC 13525

-

Escherichia coli O157:H7

CMCC 44828

-

Serratia marcescens

ATCC 14040

-

Campylobacter jejuni

ATCC 33291

-

Streptococcus haemolyticus

ATCC 19194

-

Clostridium perfringens

ATCC 13124

-

Streptococcus thermophilus

CICC 6063

-

Bacillus cereus

CMCC 63301

-

Cronobacter sakazakii (n = 4)

ATCC 29544

-

Enterobacter aerogene

ATCC 13048

-

ATCC 12868

-

Listeria monocytogenes (n = 2)

ATCC 19112

-

ATCC 29004

-

ATCC 13932

-

ATCC 25944

-

Staphylococcus pyogenes

CMCC 26103

-

Cronobacter muytjensii

ATCC 51329

-

Staphylococcus aureus

ATCC 6538

-

Citrobacter freundii

ATCC 10787

-

a

Abbreviations are: Rt RPA, real-time recombinase polymerase amplification; ATCC,

American Type Culture Collection; CMCC, China Centre for Medical Culture Collection; CICC, China Centre of Industrial Culture Collection; GEIQB, Guangdong Entry-Exit Inspection and Quarantine Bureau; +, positive; –, negative.

Table 2 Primers and probes used in this study. Assay type

Primer/

Sequence (5’-3’)

probe

Amplicon

References

size (bp)

name Real-time RPA

invA-F

CTCTATTGTCACCGTGGTCCAGTTTATCGT

invA-R

TTCATCGCACCGTCAAAGGAACCGTAAAGCATCCG

invA-P

CATCAATAATACCGGCCTTCAAA-(HEX-dT)CG-THF-

219

This study

95

Malorny et al. (2004)

CA-(BHQ2-dT)-CAATACTCATCTG-SpacerC3 Real-time PCR

ttr-F

CTCACCAGGAGATTACAACATGG

ttr-R

AGCTCAGACCAAAAGTGACCATC

Table 3 Comparison of reaction time of real-time recombinase polymerase amplification and qPCR for Salmonella detection in contaminated PIF. a Inoculation level

Enrichment time

Real-time RPA

qPCR

Viable cell counts

(cfu mL )

(h)

(TT ± SD)

(CT ± SD)

(cfu mL-1)

10

4

ND

ND

1.5 × 102

6

13.67 ± 0.26

30.09 ± 0.22

2.3 × 104

8

6.33 ± 0.29

22.22 ± 0.26

2.4 × 106

4

ND

ND

UC

6

ND

ND

1.7 × 102

8

13.33 ± 0.25

29.18 ± 0.23

2.6 × 104

-1

1

0.1

a

4

ND

ND

UC

6

ND

ND

UC

8

16.67 ± 0.28

34.26 ± 0.24

2.3×103

Abbreviations are: ND, not detected; UC, uncountable.

B

Fluorescence (mV)

A

Time (min)

D

∆Rn

C

Cycle

Figure 1

1

A

B

Figure 2

2

A

B

Figure 3

3