Differential DNA replication origin activities in human normal skin fibroblast and HeLa cell lines1

J. Mol. Biol. (1997) 273, 509±518

COMMUNICATION

Differential DNA Replication Origin Activities in Human Normal Skin Fibroblast and HeLa Cell Lines Liang Tao, Torsten Nielsen, Paula Friedlander Maria Zannis-Hadjopoulos and Gerald Price* McGill Cancer Centre, McGill University, Montreal, Quebec Canada, H3G 1Y6

A modi®cation of the extrusion method for the isolation of nascent DNA from mammalian cells and a PCR-based assay has been used in order to compare the in vivo activities of DNA replication origins in different cell lines. Conventional PCR was ®rstly applied to detect the chromosomal activities of several known (origins associated with c-myc, hsp70, b-globin, immunoglobulin m-chain enhancer) and putative DNA replication origins (autonomously replicating sequences obtained from enriched libraries of human origins of DNA replication from normal and transformed cells) in four human cell lines (HeLa, NSF, WI-38 and SK-MG-1). Then, in nascent DNA samples from normal skin ®broblast (NSF) and HeLa cells, abundance of DNA sequences in the regions of ®ve of these origins was determined by competitive PCR. Our results suggest that autonomously replicating sequences NOA3, S14, S3 and F15 are associated with functional chromosomal origins of replication. Quantitative comparison of origin activities demonstrates that origins associated with c-myc and NOA3 are approximately twice as active in HeLa cells as in NSF cells. The described approach can facilitate the identi®cation of origins which may be differentially active in normal cells and transformed cells or in different cell types. # 1997 Academic Press Limited

*Corresponding author

Keywords: DNA replication; origin; human; nascent DNA; PCR

Chromosomal DNA fragments are replicated in units, replicons, with an average size of 50 to 300 kb in animal cells during the S phase (Edenberg & Huberman, 1975; Huberman, 1995). There are estimated to be 104 to 106 replicons on chromosomes in an animal cell, with each of the replicons containing one functional origin (ori). This large number of origins are well-regulated spatially and temporally (Dif¯ey & Stillman, 1990; Coverley & Laskey, 1994). The activation of eukaryotic mammalian origins may be regulated at different levels. Firstly, speci®c sequences that act as replication origins in higher eukaryotic cells may have differential af®nities for the different protein components of the origin recognition complex (Dif¯ey & Stillman, 1990; Pearson et al., 1991; Dijkwel & Hamlin, 1996; Boulikas, 1996). Secondly, the concentration and conformation of initiator proteins may also affect the activation origins (Dif¯ey & Stillman, 1990; Huberman, 1995; Walter Abbreviations used: NSF, normal skin ®broblast; BrdUrd, bromodeoxyuridine. 0022±2836/97/430509±10 $25.00/0/mb971352

& Newport, 1997; Stillman, 1996; Chevalier & Blow, 1996). Thirdly, transcription factors may also play important roles in initiation of replication and replication timing for different cell types (DePamphilis, 1993b; Diller & Raghuraman, 1994; Ohba et al., 1996). Transcriptional activation of certain gene loci in cells has been associated with initiation of replication beginning earlier in S phase than in cells in which the same loci are not transcribed (Dhar et al., 1988; Hatton et al., 1988). Finally, chromatin structure and nuclear organization, essential for spatial positioning and interaction of origin sequences with replication proteins in order to initiate replication, also affect origin activation (Hozak et al., 1993; DePamphilis, 1993a; Lawlis et al., 1996; Newport & Yan, 1996). Cell transformation may also modify the regulation of origin activation, resulting in differential origin usage between normal and transformed cells. This is supported by previous studies, which have shown that the average size of replicons, as measured by DNA ®ber autoradiography, is decreased with malignant transformation (Martin # 1997 Academic Press Limited

510 & Oppenheim, 1977). Furthermore, there is a twoto tenfold increase of single-strand nuclease sensitive regions, consistent with more origins being activated (Collins et al., 1982). A polarity or position change of initiation for DNA replication may also be observed with malignant transformation (Itoh-Lindstrom & Leffak, 1994). Therefore, it is reasonable to propose that malignant cells employ more DNA replication origins than normal cells. If there are more origins activated in malignant cells than normal cells, then it is also reasonable to search for those which may be tumor-speci®c or tumor-activated replication origins. There is little information about the differential origin usage between normal and malignant cells, Therefore, identi®cation of tumor-speci®c origins should lead to a better understanding of mechanisms of replication origin activation in mammalian cells. Identi®cation and characterization of tumorspeci®c and differentially active origins may offer new approaches to control of the growth of human malignant cells. Here, a modi®cation of an extrusion method for isolation of nascent DNA (ZannisHadjopoulos et al., 1981) and a PCR-based approach for assay of DNA replication origin activities in differential cell lines have been used. This approach makes it feasible and easier to assess the activities of large numbers of eukaryotic DNA replication origins in different cell lines. Herein, we demonstrate that there are differential activities of origins in human normal skin ®broblast (NSF) and HeLa cell lines. We believe that this work demonstrates the ef®cacy of our methodology in the search for and characterization of differentially activated and tumor-speci®c DNA replication origins. To simplify the search for origins with differential activities, we harvested DNA from asynchronous, logarithmically growing cells, in order to increase the probability of isolation of nascent DNA from activated origins throughout the Sphase. We then prepared origin-enriched nascent DNA from four human cell sources: namely, primary normal skin ®broblasts, human lung embryo cell line (WI-38), HeLa cell line (ATTC CCL 2.2, cervix ca.), and malignant glioma cell line (SK-MG1, obtained from Memorial Sloan-Kettering Cancer Center; Pfreundschuh et al., 1978). We used a modi®cation of the nascent strand extrusion method known to enrich for DNA containing origins of replication (Zannis-Hadjopoulos et al., 1981, 1984; Kaufmann et al., 1985). The modi®ed method is brie¯y described in the legend to Figure 1. We employed a second size selection of nascent DNA samples by recovering nascent DNA of 0.3 to 1.3 kb in length after electrophoresis of the extruded DNA in agarose gel, thus reducing the extent of contamination with larger size DNA that would be obtained using only sucrose gradient centrifugation. In principle, the small nascent DNA samples should contain neither broken genomic parental DNA, nor large nascent DNA fragments, and

DNA Replication Origin Activities

therefore, no sequences located at a signi®cant distance from replication origins should be detected. Therefore, we expected that the use of small nas-

Figure 1. Isolation of nascent DNA by nascent strand extrusion and sucrose gradient fractionation. NSF cells, WI-38 cell line and transformed cell lines HeLa and SKMG-1 were grown in 5% CO2 ‡ air in 175 cm2 tissue culture ¯asks (20 to 30 ¯asks and alpha medium ‡ 10% (v/v) fetal calf serum. DNA was isolated when the cells were 30 to 50% con¯uent. The nascent strand extrusion method described previously (Zannis-Hadjopoulos et al., 1981, 1984; Kaufmann et al., 1985) was slightly modi®ed as follows. The cells in each ¯ask were washed three times in 10 ml ice-cold phosphate buffered saline (PBS) and lysed in 4 ml Hirt lysis buffer (Hirt, 1967) without vigorous shaking. The lysate was decanted in plastic tubes, 0.1 mg/ml proteinase K was added, and the mixture was incubated at 37 C overnight. An equal volume of 1:1 phenol/chloroform was added, mixed gently by inversion ®ve or six times, and the phases were separated with low-speed centrifugation. DNA was precipitated in ethanol, and collected by spooling onto a sterile glass rod. The spooled DNA was rinsed in ethanol and then dissolved in TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0). the DNA was incubated in a 50 C waterbath for 16 to 18 hours to allow extrusion of the nascent strands. The nascent DNAs were fractioned on a 5% to 30% (w/v) sucrose gradient (0.2 M NaCl, 10 mM TE (pH 8.0), 0.02% sodium azide) by centrifugation at 24,000 rpm in a SW27 rotor at 9 C for 16 to 18 hours. After centrifugation the fractions containing 0.3 to 2 kb nascent DNA were identi®ed by gel electrophoresis using a 100 bp ladder marker. The DNA (shown here was obtained from NSF cells; similar results were obtained with nascent DNA from WI-38, HeLa and SKMG-1) in fractions 5, 6, 7 and P (pooled fractions 10 ‡ 11 ‡ 12 ‡ 13) from the sucrose gradient tube was precipitated in ethanol and then dissolved in TE buffer. The quality of separation after centrifugation was assessed by electrophoresis in agarose gel. Since there seemed to be a signi®cant amount of larger DNA fragments in these fractions, DNA fraction 7 was further fractionated by 1% preparative gel electrophoresis, and DNA of length 0.3 to 1.3 kb was isolated using a Sephaglas2 Bandprep Kit (Pharmacia). Finally, the concentrations of nascent DNA (0.3 to 1.3 kb) from NSF, WI38, HeLa and SK-MG-1 cells were adjusted to certain dilutions suitable for use in a PCR-based assay.

DNA Replication Origin Activities

511

Figure 2. Assessments of the quality of nascent DNA samples. (a) The distribution of sequence abundance of nascent DNA from the region of an origin associated with lamin B2 (GenBank accession no. M94363) demonstrated that the DNA sample was a reliable source of newly replicated nascent DNA, suitable for mapping an origin of DNA replication in vivo. The primers for competitive PCR analyses for B48 (226 bp), SE10 (140 bp) and B13 (166 bp) were exactly the same as those used by Diviacco et al. (1992) and Biamonti et al. (1992); their location is indicated in the Figure by arrows. A single unique competitor construct was made according to the method of FoÈrster (1994) and was quanti®ed by spectrophotometry. The competitor construct was composed of a 99 bp fragment from the c-myc locus (GenBank accession no. J00120, 8201-8299) ¯anked by all three sets of primers and was designed so as to amplify products of 20 bp larger or smaller than the target nascent DNA fragments. The single competitor construct assured equivalency in quanti®cation of competitor molecules. (The relative positions of the 30 end of the lamin B2 gene, the mapped origin and another tandemly arranged small gene (ppv1) are also indicated.) The distribution of DNA in the 0.3 to 1.3 kb nascent DNA sample from HeLa peaked at 0.7 kb (see Figure 1). The 100 ml PCR reaction contained: 50 mM each dNTP, 1  PCR buffer, 2 units Taq polymerase (Taq pol., Pharmacia), 0.2 mM each of primers, 10 to 400 copies of competitors, and 5 ml of certain diluted nascent DNA. The PCR reaction mixture, except Taq pol., was preheated for two to ®ve minutes at 94 C; then two units Taq pol. was added. Cycles 1 to 40; 94 C for 30 seconds, 5 C below the melting points of primers for 30 seconds, and 72 C for 30 seconds. Cycle 41: 72 C for ®ve minutes. Cycle 42: soak at 4 C. To minimize the sample errors, the DNA templates and Taq pol. were diluted and then added in a 10 ml volume to the PCR reaction mixture. An aliquot of 15 ml of each ampli®cation mixture was analyzed by 2% (w/v) agarose gel electrophoresis. The gels were stained with 0.5 mg/ml ethidium bromide solution for 15 minutes and destained in water for ten minutes before obtaining a photograph. The results shown are the average of duplicate competitive PCR analyses. (b) The abundance of DNA sequences from the human c-myc locus at locations Bf-Br2, Ff-Fr and Ef-Er was determined by competitive PCR (location of exons 1 to 3 (Ex. 1 to 3) are indicated for the HindIII, EcoRI fragment at the c-myc locus). Primers Bf and Br2 were used to amplify the sequences close to human c-myc origin, primers Ff and Fr were used for ampli®cation of the sequence 4.5 kb away from ori c-myc, and primers Ef and Er for sequence 7 kb away from ori c-myc. Primer Bf is the closest to ori c-myc and is the same as that previously used to map the c-myc origin (Vassilev & Johnson, 1990). The primers, indicated by arrows, were chosen to be unique and to yield an ampli®cation product of 400 bp, thus avoiding the possibility that the products could be the result of ampli®cation of Okazaki fragments (average size of 250 bp). The sequences of the primers and sizes of ampli®ed products are: (GenBank accession no. J00120 & Locus: HUMMYCC): Bf, 947-966; Br2, 1398-1416, 470 bp and Ff, 5378-5397; Fr 57695787, 410 bp and Ef, 7848-7867; Er, 8280-8299, 452 bp. Competitors differed from the PCR products ampli®ed by the primers above in that 20 to 50 bp was deleted in the region between the two primers according to the method of FoÈrster (1994). The competitors were quanti®ed by spectrophotometry. The results shown are the average of triplicate competitive PCR analyses.

cent fragments would obviate the problem of the presence of sheared DNA (typically ranging from 25 to 50 kb in size) within nascent DNA samples. Of course, nascent DNA signi®cantly larger than 1.3 kb would also be excluded from the pool of nascent DNA fragments. Since a very sensitive PCR method, capable of detecting ten or more copies of a given sequence (Zimmerman & Mannhalter, 1996), was to be used for the detection of replication origins in vivo (Vassilev & Johnson, 1990; Giacca et al., 1994), we con®rmed the quality of the nascent DNA preparation in three different ways. First, we determined the abundance of the sequences in the prepared nascent DNA of the bidirectional origin associated with lamin B2 by

competitive PCR (Figure 2(a)). We used the same primers for competitive PCR as those previously described, which reported the mapping and characterization of this origin (Diviacco et al., 1992; Biamonti et al., 1992; Kumar et al., 1996). Our result in Figure 2(a) was similar to those published, showing a typical distribution of the abundance of the sequences in the origin region with the maximal abundance for the fragment designated B48 and lesser abundance for the most distal fragments SE10 and B13, approximately one-third of B48 abundance. Previous work indicated that the abundance of the more distal fragments SE10 and B13 in nascent DNA (average 1000 nt) from exponentially growing cells using anti-BrdUrd puri®ed nas-

512

DNA Replication Origin Activities

Table 1. A comparison of nascent DNA samples from HeLa cells for origin activity

Origin b-Globin c-myc

Without BrdUrd labeling Average Normalized copy no. to b-globin 290 130

With BrdUrd labeling Average Normalized copy no. to b-globin

1.000 0.448

270 120

1.000 0.444

With BrdUrd labeling and antiBrdUrd purification Average Normalized copy no. to b-globin 74 34

1.000 0.459

The activities of ori c-myc as deduced from nascent DNA samples without and with anti-BrdUrd labeling are almost identical. The nascent DNA sample without BrdUrd labeling was prepared in the same manner as described in the legend to Figure 1. For BrdUrd labeling, the cells were grown in the dark and in culture medium containing 20 mM BrdUrd for 15 minutes before isolation of nascent DNA. The procedure of isolation of nascent DNA was also the same as that described in the legend to Figure 1, but with minimal exposure to ambient light. Fractionated BrdUrd-labeled nascent DNA was puri®ed twice with anti-BrdUrd as previously described by Wu et al. (1993a,b) after Vassilev & Johnson (1990). The abundance of sequence in the c-myc origin region was determined by duplicate competitive PCR analyses as described in the legend to Figure 2 and Table 3 footnotes.

cent DNA was approximately one-third of B48 abundance; from synchronized cells, the abundance for SE10 and B13 in nascent DNA (average size 600 bp) was also approximately one-third (Giacca et al., 1994). This demonstrates that our DNA prepared in this manner were true nascent DNA samples. The abundance of sequences associated with the c-myc origin (Vassilev & Johnson, 1990; IguchiAriga et al., 1988; Berberich et al., 1995) and locus were determined by competitive PCR (Figure 2(b). In order to avoid ampli®cation of Okazaki fragments contained in the prepared nascent DNA sample, we also designed primers which ampli®ed 400 to 450 bp of target sequences. The results (Figure 2(b)) show that the maximal amount (75 copies) of the sequence closest to ori c-myc was detected, while copies of sequence located 7 kb away from the origin were not detectable. Since we failed to detect any ampli®cation products 7 kb distant from the origin, the nascent DNA does not seem to contain any signi®cant contamination by sheared or broken parental DNA. (Because of the lack of the sequence data more 50 to the origin, we were unable to further test in the 50 direction of this origin). We also detected ten copies of a sequence located 4.5 kb downstream from the cmyc origin. The detection of signi®cant, but greatly reduced, numbers of copies of sequence slightly farther away (4.5 kb) from the mapped origin site has been consistently seen using other methodologies (Vassilev & Johnson, 1990; Giacca et al., 1994) and may be due to the presence of small amounts of nascent DNA of larger size. Detection of a signi®cant, but lesser, amount of sequence 4.5 kb away also might be explained by the recent observation that within the region under study there may be other initiation sites which contribute to the replication of this region of chromosomal DNA (Berberich et al., 1995; Waltz et al., 1996). Finally, we compared the nascent DNA samples from HeLa cells without and with bromodeoxyuridine (BrdUrd) labeling, following two applications of af®nity puri®cation with anti-BrdUrd. The activity (normalized to that of sequence nearby an origin associated with b-globin, see below) for the

c-myc origin (Vassilev & Johnson, 1990) determined from the nascent DNA samples with and without anti-BrdUrd puri®cation were almost identical (Table 1). Nascent DNA was prepared from equivalent numbers of tissue culture ¯asks (175 cm2) of HeLa cells at approximately 30% con¯uency. The ratio of abundance of copies of ori c-myc to sequence nearby an origin associated with b-globin was identical, varying only from 0.448 for our method of preparation of nascent DNA to 0.444 for nascent DNA labeled, but not antibody-puri®ed, to 0.459 for nascent DNA which had twice been antibody-puri®ed. This result demonstrates that our method of isolation of nascent DNA yielded DNA of equivalent quality to that which could be obtained by labeling of nascent DNA with BrdUrd (Vassilev & Johnson, 1990; Giacca et al., 1994) and its further puri®cation by anti-BrdUrd antibody. Typically, such preparations of nascent DNA in our laboratory (Wu et al., 1993b) and others (Vassilev & Russev, 1988; Vassilev & Johnson, 1990; Vassilev et al., 1990) yield preparations which are composed of <0.0004% contaminating broken genomic DNA. Recently, Kumar et al. (1996) also successfully used a competitive PCR method with a related method for isolation of nascent DNA molecules, also omitting the BrdUrd labeling for replicating DNA. In conclusion, this modi®ed nascent strand extrusion method, which has previously been demonstrated to enrich for origin containing sequences (Frappier & ZannisHadjopoulos, 1987; Landry & Zannis-Hadjopoulos, 1991), is easily and quickly performed. Furthermore, the double size-selection provides the possibility of better controlling the distribution of fragment sizes, thus assuring a greater con®dence in equivalency of nascent DNA from different cells. The elimination of the need for newly replicated DNA labeling and af®nity puri®cation or precipitation methods to obtain nascent DNA suitable for PCR-based methods of analysis of origins of DNA replication simpli®ed the procedure and reduced the cost of nascent DNA. In recent years, several DNA replication origins in human cells have been identi®ed and characterized (Vassilev & Johnson, 1990; Kitsberg et al., 1993; Wu et al., 1993b; Giacca et al., 1994; Taira

513

DNA Replication Origin Activities Table 2. Activities of known and putative replication origins in human normal and transformed cell lines Origin or putative origin 343 NOA3 S3 S14 F9 F15 HSP Em c-myc b-globin

Origin activation in cell lines NSF

HeLa

SL-MG-1

WI-38

Autonomous replication in vivoa

‡ ‡ ‡ ‡ ÿ ‡ ‡ ‡ ‡ ‡

‡ ‡ ‡ ‡ ÿ ‡ ‡ ‡ ‡ ‡

‡ ‡ ‡ ‡ ÿ ‡ ‡ ‡ ‡ ‡

‡ ‡ ‡ ‡ ÿ ‡ ‡ ‡ ‡ ‡

‡ ‡ ‡ ‡ ‡ ‡ ‡ ‡ ‡ ‡

Autonomous replication in vitroa ‡ ‡ ‡ ‡ ‡ ‡ N.D. N.D. ‡ N.D.

a The F- and S-clones were isolated by their ability to be replicated after mass transfection into HeLa cells or in the in vitro DNA replication system (Nielsen et al., 1994). Sequences designated F9 and S14 were not found after mass screening using the in vitro DNA replication system; however, when they were tested singly in this system, they were found to function in vitro as autonomously replicating sequences (Nielsen, 1995). N.D., not done. Sources of known and putative origins: 343 and NOA3, cDNA library of IMR90 cells (Wu et al., 1993a); S3 and S14, genomic library of SW48 colon adenocarcinoma cells (Nielsen et al., 1994); F9 and F15, genomic library of primary human genital ®broblast cells (Nielsen et al., 1994); HSP (Taira et al., 1994); E m (Ariizumi et al., 1993a), c-myc (Vassilev & Johnson, 1990; Iguchi-Ariga et al., 1988; Berberich et al., 1995) and b-globin (Kitsberg et al., 1993; Aladjem et al., 1995) and noted in the literature. Forward (f) and reverse (r) primers and ampli®ed fragment size for 343 (Wu et al., 1993b; GenBank accession no. L08443 and Locus: HUMAUTONJ): Mf: 50 AATCCTCTCTGTGTCTTAAG30 , Mr:50 GACTACGGTATAGACAACAC30 , 406 bp; for NOA3 (Genbank accession no. L08439 and Locus: HUMAUTONF): NOA3f2, 50 GAATTCACCCCTCCCACC30 ; NOA3r2, 50 GAAGTCTGGCATTTCATAATCA30 , 331 bp; for S3: S3f, 50 CTTGTGCTTCCCCAGTGA A30 ; S3r, 50 TGAGGCAGGTGGATCATGA30 , 435 bp; for S14: S14f, 50 GTGGGAGTTTCTAATAATGTG30 ; S14r, 50 GGATCACTCACCAACCCTT30 , 410 bp; for F9: F9f, 50 CCTTCTGATGGATCAGCGT30 ; F9r, 50 CACCGAGTGGTATGAGCAT30 , 350 bp; for F15: F15f2, 50 CCAGGTGCTGCCTCAGAT30 ; F15r2, 50 CCCGGTACGCACCAGAAA30 , 453 bp; for HSP (GenBank accession no. X04676 and Locus: HSHSP70A): HSPf, 109±127; HSPr, 503 ±519, 411 bp; for Em (GenBank accession no. X57331 and Locus: HSIGCMUDE): Emf, 2556±2574; Emr, 3006±3024, 469 bp; for b-globin (GenBank accession no. J00179 and Locus: HUMHBB): Gf, 54806±55824; Gr, 55224± 55242, 437 bp; for c-myc, Bf and Br2 are described in the legend to Figure 2. The PCR ampli®cation was the same as that described in the legend to Figure 2, but without competitors. The PCR ampli®cation products were analyzed by electrophoresis in 1% agarose gel.

et al., 1994); in addition, many putative origins in human cells have been identi®ed, based upon autonomous replicating activity assays in vivo and in vitro (Frappier & Zannis-Hadjopoulos, 1987; McWhinney & Leffak, 1990; Landry & ZannisHadjopoulos, 1991; Pearson et al., 1991; Wu et al., 1993a; Ariizumi et al., 1993a,b; Nielsen et al., 1994). We assessed the chromosomal activities of many of these origins in alternative cell lines using the modi®ed nascent strand extrusion and puri®cation methods described here. First, we assessed the origin activity of ten known or putative origins of DNA replication in multiple cell lines, using a conventional PCR method (Table 2). Ori Em refers to a chromosomal origin associated with the immunoglobulin heavy chain enhancer Em (Ariizumi et al., 1993a,b); Ori HSP is an origin identi®ed in association with the heat shock protein 70 gene promoter in HeLa cells (Taira et al., 1994). Ori b-globin refers to sequence associated with an origin in the human b-globin gene region (Kitsberg et al., 1993; Aladjem et al., 1995). Table 2 shows that ori c-myc, ori b-globin, ori Em, and ori HSP were all activated in all the four cell lines tested, which once again con®rmed that the nascent DNA was suitable for assaying origin activities. Origin 343 (GenBank accession no. L08443), containing the ``O''-family repetitive sequence, was previously obtained from a cDNA library of human embryo lung ®broblast cells (IMR90; Wu et al., 1993a). Origin 343 was characterized and mapped in vivo as a chromosomal

DNA replication origin in human cells (Wu et al., 1993b: designated here as ori 343). NOA3 (GenBank accession no. L08439), a sequence with autonomously replicating activity that was identi®ed as a portion of the 30 -UT of human 14-3-3 eta isoform (Ichimura-Ohshima et al., 1992; Swanson et al., 1993; GenBank accession no. L20422), is a putative origin also obtained from a cDNA library of IMR90 normal embryonic lung ®broblasts (Wu et al., 1993a: designated here as NOA3). F and S clones, containing autonomously replicating genomic DNA sequences, were obtained from genomic libraries that were constructed using af®nity puri®cation of cruciform containing DNA from primary human genital ®broblast cells and SW 48 colon adenocarcinoma cells, respectively (Nielsen et al., 1994: designated here as F or S). The results (Table 1) con®rm the chromosomal origin activity of ori 343 in four different cell lines. Furthermore, since NOA3, S3, S14 and F15 are autonomously replicating sequences (Wu et al., 1993a; Nielsen et al., 1994) and present in these nascent DNA preparations, they are also likely to contain functional chromosomal origins of DNA replication for these four cell lines. Apparent differences in the amount to products after PCR ampli®cation of sequences near these origins indicated that there may be some origins which were differentially activated in different cell lines. This led us to conduct a more precise quantative investigation of the activities of some of these origin-associated sequences.

514

DNA Replication Origin Activities

Figure 3. Determination of abundance of the sequences in origin regions. The abundance of sequences associated with ori c-myc (a), ori b-globin (b) and ori NOA3 (c) was determined by competitive PCR in pairs of preparations of nascent DNA from NSF and HeLa cells. PCR ampli®cation reaction conditions are indicated in the legend to Figure 2(a). The 20 to 50 bp shorter competitors were prepared as described in the legend to Figure 2(b). The primers that were used are those described in the legend to Figure 2(b) and Table 2 footnotes. The bands of ampli®ed products and competitors were scanned and quanti®ed using Bio Image (Millipore) hardware and software. The linear curve represents the best ®tted line for the averages of data from two to three sets of measurements (data not shown for S14 or ori 343). The correlation coef®cients of the data for all origin associated sequences, ®tted to the line, were greater than 0.99. The abundance of origin associated sequences in the nascent DNA preparations is given in Table 3.

515

DNA Replication Origin Activities Table 3. Abundance of ®ve origins in one pair of preparations of nascent DNA from NSF and HeLa cell lines

Origin b-globin c-myc NOA3 S14 343

abundance of origin (copies/sample) 160 40 50 30 75

NSF normalized to b-globin

abundance of origin (copies/sample)

1 0.250 0.313 0.188 0.467

290 130 195 60 70

HeLa normalized to b-globin 1 0.448 0.672 0.207 0.241

The abundance of origin associated sequences was determined by competitive PCR as described in the legends of Figures 2 and 3. The abundance listed above is the average of two to three replicates of the assessment of abundance of origin-associated sequences in a pair of different preparations of nascent DNA from cultures of NSF and HeLa cell lines.

Thus, a more quantative PCR method (Giacca et al., 1994; Kumar et al., 1996; Zimmerman & Mannhalter, 1996) was employed to assay the activities of the origins ori c-myc, ori b-globin, ori 343, NOA3 and S14 in NSF and HeLa cell lines. The short 0.3 to 1.3 kb nascent DNA samples with the same fragment size distribution (peak size at 0.7 kb, see Figure 1) were prepared as described above from nascent DNA extruded from logarithmically growing NSF and HeLa cells. The DNA was then used to determine the abundance of the ®ve origins in nascent DNA samples by competitive PCR. If an origin is equally active in two different cell types, but transformed cells or cells of different types can employ different numbers of origins, the DNA sample from one cell type to another may contain a different number of origins, the DNA sample from one cell type to another may contain a different abundance of that origin by comparison to the same amount of nascent DNA from a cell of another type or transformation state. That is, a comparison of origin activities, based on the abundance of the origin-associated sequence in the same amount of the nascent DNA samples obtained from different cells, e.g. normal and transformed cells, cannot be made. Therefore, we determined the abundance of the ®ve origins in the same preparation of short nascent DNA and normalized it to that of an internal reference, ori bglobin, an origin whose activity is not associated with transcriptional activity. This origin is always utilized in the cells regardless of its expression or replication timing. However, deletion of the region from the 50 end of the d-globin gene to the 50 end of the b-globin gene abolished the replication origin and resulted in a change in the replication direction in this region (Kitsberg et al., 1993). The locus control region (LCR) is required in the initiation of DNA replication, and the factors mediating the interaction between the distantly separated sequences appear to be conserved in evolution (Aladjem et al., 1995). The activity of a target origin in any cell line was measured relative to that of ori b-globin. Importantly, we used the same set and series of dilutions of competitors for determination of the activity of the target origin in NSF and HeLa cells; in this manner, the variation in competitive PCR results, due to errors in

measurement of competitor concentrations or preparation of dilutions of competitors, was limited. Figure 3 and Table 3 show examples of the measurement of origin activities in a pair of nascent DNA preparations from cultures of NSF and HeLa cell lines. Figure 4 shows the comparison of chromosomal activities of the ®ve origins expressed as a ratio relative to ori b-globin and as an average of three sets of pairs of nascent DNA samples from NSF and HeLa cell lines, obtained from two different sets of cultures of those cells. Retrospectively, ori 343 or S14 as internal references (useful for normalizing for different amounts of nascent DNA, cell types, or different cell cycle times) would have yielded very similar results indicating that ori c-myc and NOA3 are differentially active between NSF and HeLa cells. Interestingly, ori c-myc was about twofold more active in HeLa cells than in NSF relative to ori bglobin (Table 2 and Figure 4). One possibility for the apparent increase in activity may be related to increased transcriptional activity of c-myc in transformed cells. Ori c-myc is located in the upstream region of the c-myc gene (Iguchi-Ariga et al., 1988; Vassilev & Johnson, 1990). The sequence containing this origin has autonomous replicating activities in vivo (McWhinney & Leffak, 1990; IguchiAriga et al., 1988) and in vitro (Berberich et al., 1995). This origin is able to function at sites in which is was integrated on chromosomes (Khaira et al., 1996). A correlation between transcription and origin activation has been suggested for the cmyc gene (Leffak & James, 1989), and an induction of in vitro DNA replication by transcription in the region upstream of human c-myc gene has been demonstrated (Ohba et al., 1996). Overexpression of c-myc has been found in transformed cells. In some cases, the c-myc gene was found to be selectively ampli®ed in certain tumor cells (Alitalo et al., 1983; Dalla-Favera et al., 1982; Harlow & Stewart, 1993), but in HeLa cells, c-myc is present at a single copy per haploid genome (Lazo et al.,1989); we con®rmed the single copy number per haploid genome of c-myc and NOA3 by quantitative PCR of total genomic DNA of HeLa relative to that from NSF (data not shown). Thus, a differential activation of ori c-myc or NOA3 observed between NSF and HeLa cells may be caused by either mod-

516

Figure 4. Comparison of origin activities in NSF and HeLa cell lines. The ratio of normalized abundance of sequences associated with origins in HeLa to that in NSF indicates differential origin activities in the two cell lines. The ratio in the Figure is shown as the average plus S.E.M. from three sets of data of normalized abundance (Table 3 lists one set of the data). Pairs of nascent DNA samples used in set 1 and set 2 were from the same growing NSF and HeLa cells. (The distribution of DNA in samples containing 0.3 to 1.3 kb nascent DNA used in set 1 peaked at 0.7 kb; the distribution of DNA used in set 2 peaked at 0.6 kb; the distribution of DNA in set 3 nascent DNA samples from a different set of cultures of NSF and HeLa cells peaked at 0.7 kb.)

ulating effects of differential transcriptional activity or, possibly, by differential availability of proteins associated with the activation of ori c-myc or NOA3. NOA3 is a genomic DNA sequence which is also present at a single copy per haploid genome in HeLa cells, as was also con®rmed by quantative PCR analysis of HeLa and NSF genomic DNA (data not shown). Similar to ori c-myc, ori NOA3 was also found to be more activated in HeLa cells, approaching twofold (Table 2 and Figure 4). NOA3 is expressed in ®broblasts as part of the gene encoding the human 14-3-3 eta isoform (Wu et al., 1993a; Ichimura-Ohshima et al., 1992). The DNA replication origins that are situated within the gene undergoing transcription may be activated by transcriptional factors. At least seven mammalian isoforms of the ubiquitous 14-3-3 family of proteins have been identi®ed, and low levels are expressed in most mammalian tissues (Aitken et al., 1992; Aitken, 1995) including human ®broblasts (Celis et al., 1990a,b). Members of the 14-3-3 family show a variety of apparently unrelated biological activities, including direct or indirect roles in signal transduction pathways and cell cycle regulation (Burbelo & Hall, 1995; Michaud et al., 1995; Suen et al., 1995). In summary, the results demonstrate that the approach described here can be effectively used for

DNA Replication Origin Activities

the preparation of nascent DNA to measure origin activities. In combination with competitive PCR ampli®cation of sequences that are believed to be nearby chromosomal origins of DNA replication, the approach has a high degree of sensitivity, ®delity, and utility. Application of this approach indicates that NOA3, S14, S3 and F15 represent or are nearby functional chromosomal origins. However, F9, an autonomously replicating sequence (Nielsen et al., 1994), is either not a chromosomal origin or its activation occurs in another cell type and/or condition that is not represented by the four cell lines that we have examined in this study. Ori c-myc and NOA3, but not ori 343 or S14, are more activated in HeLa cells than in NSF cells. The apparently increased activity of ori c-myc and NOA3 may be related to effects associated with cell transformation. Since the nascent DNA was isolated from logarithmically growing and not from synchronized cells, effects due to cell cycle phase and replication timing are minimized. Quantitative differential activities can now be assessed between different cell types. This approach lends itself to the discovery of those origins which are differentially active in different cell types or conditions, and is the prelude to experimentation which aims at the discovery of the cell-type or transformation-speci®c factors which regulate origin activation and control cell proliferation.

Acknowledgements We thank R. Pelletier and A. Todd for expert technical advice and Dr N. Cossons for critical reading of the manuscript. L.T. is a recipient of a studentship from a FCAR Centre Grant Award to the McGill Cancer Centre and the Clifford Wong Fellowship of McGill University. T.T. is a recipient of a studentship from the MRC of Canada. This research is supported by the Cancer Research Society Inc.

References Aitken, A. (1995). 14-3-3 proteins on the MAP. Trends Biochem. Sci. 20, 95± 97. Aitken, A., Collinge, D. B., van Heusden, B. P. H., Isobe, T., Roseboom, P. H., Rosenfeld, G. & Soll, J. (1992). 14-3-3 proteins: a highly conserved, widespread family of eukaryotic proteins. Trends Biochem. Sci. 17, 498± 501. Aladjem, M. I., Groudine, M., Brody, L. L., Dieken, E. S., Fournier, R. E. K., Wahl, G. M. & Epner, E. M. (1995). Participation of the human b-globin locus control region in initiation of DNA replication. Science, 270, 815± 819. Alitalo, K., Schwab, M., Lin, C. C., Varmus, H. E. & Bishop, J. N. (1983). Homogeneously staining chromosome regions contain ampli®ed copies of abundantly expressed cellular oncogene (c-myc) in malignant neuroendocrine cells from a human colon carcinoma. Proc Natl Acad. Sci. USA, 80, 1707± 1711.

DNA Replication Origin Activities Ariizumi, K., Wang, Z. & Tucker, P. W. (1993a). Immunoglobulin in heavy chain enhancer is located near or in an initiation zone of chromosomal DNA replication. Proc Natl Acad. Sci. USA, 90, 3695± 3699. Ariizumi, K., Ghosh, M. R. & Tucker, P. W. (1993b). Elements in the immunoglobulin heavy-chain enhancer directly regulate simian virus 40 oridependent DNA replication. Mol. Cell. Biol. 13, 5629± 5636. Berberich, S., Trivedi, A., Daniel, D. C., Johnson, E. M. & Leffak, M. (1995). In vitro replication of plasmids containing human c-myc DNA. J. Mol. Biol. 245, 92± 109. Biamonti, G., Perini, G., Weighardt, F., Riva, S., Giacca, M., Norio, P., Zentilin, L., Diviacco, S., Dimitrova, D. & Falaschi, A. (1992). A human DNA replication region: localization and transcriptional characterization. Chromosoma, 102, S24 ±S31. Boulikas, T. (1996). Common structural features of replication origins in all life forms. J. Cell. Biochem. 60, 297± 316. Burbelo, P. D. & Hall, A. (1995). Hot numbers in signal reduction. Curr. Biol. 5, 95± 96. Celis, J. E., Gesser, B., Rasmussen, H. H., Madsen, P., Leffers, H., Dejagaard, K., Honore, B., Olsen, E., Ratz, G., Lauridsen, J. B., Basse, B., Mouritzen, S., Hellerup, M., Andersen, A., Walbum, E., Celis, A., Bauw, G., Puype, M., Van Damme, J. & Vandekerekhove, J. (1990a). Comprehensive twodimensional gel protein databases offer a global approach to the analysis of human cells: the transformed amnion cells (AMA) master database and its link to genome DNA sequence data. Electrophoresis, 11, 989 ± 1071. Celis, J. E., Dejagaard, K., Madsen, P., Leffers, H., Gesser, B., Honore, b. , Rasmussen, H. H., Olsen, E., Lauridsen, J. B., Ratz, G., Mouritzen, S., Basse, B., Hellerup, M., Celis, A., Fuype, M., Van Damme, J. & Vandekerekhove, J. (1990b). The MRC-5 human embryonal lung ®broblast two-dimensional gel cellular protein database: quantitative identi®cation of polypeptides whose relative abundance differ between quiescent, proliferating and SV40 transformed cells. Electrophoresis, 11, 1072± 1113. Chevalier, S. & Blow, J. J. (1996). Cell cycle control of replication initiation in eukaryotes. Curr. Opin. Cell Biol. 8, 815 ±821. Collins, J. M., Glock, M. S. & Chu, A. K. (1982). Nuclease S1 sensitive site in parental deoxyribonucleic acid of cold-and temperature-sensitive mammalian cells. Biochemistry, 21, 3414± 3419. Coverley, D. & Laskey, R. A. (1994). Regulation of eukaryotic DNA replication. Annu. Rev. Biochem. 63, 745± 776. Dalla-Favera, R., Wong-Stall, F. & Gallo, R. C. (1982). Onc gene ampli®cation in promyelocytic leukemia line HL60 and primary leukemic cells of the same patient. Nature, 299, 61 ± 63. DePamphilis, M. L. (1993a). Eukaryotic DNA replication: anatomy of an origin. Annu. Rev. Biochem. 62, 29 ± 63. DePamphilis, M. L. (1993b). How transcription factors regulate origins of DNA replication in eukaryotic cells. Trends Cell. Biol. 3, 161± 167. Dhar, V., Mager, D., Iqbal, A. & Schildkraut, C. L. (1988). The coordinate replication of the human b-globin gene domain re¯ects it transcriptional activity and nuclease hypersensitivity. Mol. Cell. Biol. 8, 4958± 4965.

517 Dif¯ey, J. F. X. & Stillman, B. (1990). The initiation of chromosomal DNA replication in eukaryotes. Trends Genet. 6, 427 ± 432. Dijkwel, P. A. & Hamlin, J. L. (1996). Sequence and context effects on origin function in mammalian cells. J. Cell. Biochem. 62, 210 ± 222. Diller, J. D. & Raghuraman, M. K. (1994). Eukaryotic replication origins: control in space and time. Trends Biochem. Sci. 19, 320 ±325. Diviacco, S., Norio, P., Zentilin, L., Menzo, S., Clementi, M., Biamonti, G., Riva, S., Falaschi, A. & Giacca, M. (1992). A novel procedure for quantitative polymerase chain reaction by coampli®cation of competitive templates. Gene, 122, 313± 320. Edenberg, H. J. & Huberman, J. A. (1975). Eukaryotic chromosome replication. Annu. Rev. Genet. 9, 245 ± 284. FoÈrster, E. (1994). An improved general method to generate internal standards for competitive PCR. BioTechniques, 16, 18 ± 20. Frappier, L. & Zannis-Hadjopoulos, M. (1987). Autonomous replication of plasmids bearing monkey DNA origin-enriched sequences. Proc Natl Acad. Sci. USA, 84, 6668± 6672. Giacca, M., Zentilin, L., Norio, P., Diviacco, S., Dimitrova, D., Contreas, C., Biamonti, G., Perini, G., Weighardt, F., Riva, S. & Falaschi, A. (1994). Fine mapping of a replication origin of human DNA. Proc Natl Acad. Sci. USA, 91, 7119± 7123. Harlow, S. P. & Stewart, C. C. (1993). Quantitation of cmyc gene ampli®cation by a competitive PCR assay system. PCR Methods Applications, 3, 163± 168. Hatton, K. S., Dhar, V., Brown, E. H., Iqbal, M. A., Stuart, S., Didamo, V. T. & Schildkraut, C. L. (1988). Replication program of active and inactive multigene families in mammalian cells. Mol. Cell. Biol. 8, 2149± 2158. Hirt, B. (1967). Selective extraction of polyoma DNA from infected mouse cell cultures. J. Mol. Biol. 26, 365 ± 369. Hozak, P., Hassan, A. B., Jackson, D. A. & Cook, P. R. (1993). Visualization of replication factories attached to nucleoskeleton. Cell, 73, 361± 373. Huberman, J. A. (1995). Prokaryotic and eukaryotic replicons. Cell, 82, 535 ± 542. Ichimura-Ohshima, Y., Morii, K., Ichimura, T., Araki, K., Takahashi, Y., Isobe, T., Minoshima, S., Fukuyama, R., Shimizu, N. & Kuwano, R. (1992). cDNA cloning and chromosome assignment of the gene for human brain 14-3-3 protein eta chain. J. Neurosci. Res. 31, 600± 605. Iguchi-Ariga, S. M. M., Okazaki, T., Itani, T., Ogata, M., Sato Y., & Ariga, H. (1988). An initiation site of DNA replication with transcriptional enhancer activity present upstream of the c-myc gene. EMBO J. 7, 3135± 3142. Itoh-Lindstrom, Y. & Leffak, M. (1994). Alteration of in vitro DNA synthesis in the alpha globin locus of chicken embryo ®broblasts due to in vivo activity of rous virus pp60src. Nucl. Acids Res. 22, 498 ± 505. Kaufmann, G., Zannis-Hadjopoulos, M. & Martin, R. G. (1985). Cloning of nascent monkey DNA synthesized early in the cell cycle. Mol. Cell. Biol. 5, 721± 727. Khaira, P., Malott, M., Waltz, S. & Leffak, M. (1996). The activity of the c-myc replication origin does not rely on its normal chromosomal location. Abstract 23. Fourth McGill University International Conference

518 on Regulation of Eukaryotic DNA Replication. Oct., 1996. St. Sauvent, Qc, Canada. Kitsberg, D., Selig, S., Keshet, I. & Cedar, H. (1993). Replication structure of the human b-globin gene domain. Nature, 366, 588±590. Kumar, S., Giacca, M., Norio, P., Biamonti, G., Riva, S. & Falaschi, A. (1996). Utilization of the same DNA replication origin by human cells of different derivation. Nucl. Acids Res. 24, 3289± 3294. Landry, S. & Zannis-Hadjopoulos, M. (1991). Classes of autonomously replicating sequences are found among early-replicating monkey DNA. Biochim. Biophys. Acta, 1088, 234± 244. Lawlis, S. J., Keezer, S. M. & Gilbert, D. M. (1996). Chromosome architecture can dictate site-speci®c initiation of DNA replication in Xenopus egg extracts. J. Cell Biol. 135, 1207± 1218. Lazo, P. A., DiPaolo, J. A. & Popescu, N. C. (1989). Ampli®cation of the integrated viral transforming genes of human papillomavirus 18 and its 50 -¯anking cellular sequence located near the myc protooncogene in HeLa cells. Cancer Res. 49, 4305± 4310. Leffak, M. & James, C. D. (1989). Opposite replication polarity of the germ line c-myc gene in HeLa cells compared with that of two Burkitt lymphoma cell lines. Mol. Cell. Biol. 9, 586± 593. Martin, R. G. & Oppenheim, A. (1977). Initiation points for DNA replication in nontransformed and simian virus 40-transformed Chinese hamster lung cells. Cell, 11, 859± 869. McWhinney, C. & Leffak, M. (1990). Autonomous replication of a DNA fragment containing the chromosomal replication origin of the human c-myc gene. Nucl. Acids Res. 18, 1233±1242. Michaud, N. R., Fabian, J. R., Mathes, K. D. & Morrison, D. K. (1995). 14-3-3 is not essential for raf-function: identi®cation of raf-1 proteins that are biologically activated in a 14-3-3- and ras-independent manner. Mol. Cell. Biol. 15, 3390± 3397. Newport, J. & Yan, H. (1996). Organization of DNA into foci during replication. Curr. Opin. Cell Biol. 3, 365± 368. Nielsen, T. (1995). Human origins of DNA replication: identi®cation, analysis and application. Thesis. McGill University, Montreal, Canada. Nielsen, T., Bell, D., Lamoureux, C., ZannisHadjopoulos, M. & Price, G. (1994). A reproducible method for identi®cation of human gnomic DNA autonomously replicating sequences. Mol. Gen. Genet. 242, 280 ± 288. Ohba, R., Matsumoto, K. & Ishimi, Y. (1996). Induction of DNA replication by transcription in a region upstream of human c-myc gene in a model replication system. Mol. Cell. Biol. 16, 5754± 5763. Pearson, C. E., Frappier, L. & Zannis-Hadjopoulos, M. (1991). Plasmids bearing mammalian DNA-replication origin-enriched (ors) fragments initiate semiconservative replication in a cell-free system. Biochim. Biophys. Acta, 1090, 156 ± 166.

DNA Replication Origin Activities Pfreundschuh, M., Shiku, H., Takahashi, T., Ueda, R., Ransohoff, J., Oettgen, H. F. & Old, L. J. (1978). Serological analysis of cell surface antigens of malignant human brain tumors. Proc. Natl Acad. Sci. USA, 75, 5122± 5126. Stillman, B. (1996). Cell cycle control of DNA replication. Science, 274, 1659± 1664. Suen, K., Bustelo, X. R. & Barbacid, M. (1995). Lack of evidence for the activation of ras/raf mitogenic pathway by 14-3-3 proteins in mammalian cells. Oncogene, 11, 825± 831. Swanson, K. D., Dhar, M. S. & Joshi, J. G. (1993). The human and bovine 14-3-3 eta protein mRNAs are highly conserved in both their translated and untranslated regions. Biochim. Biophys. Acta, 1216, 145± 148. Taira, T., Iguchi-Ariga, S. M. M. & Ariga, H. (1994). A novel DNA replication origin identi®ed in the human heat shock protein 70 gene promoter. Mol. Cell. Biol. 14, 6386± 6387. Vassilev, L. & Johnson, E. M. (1990). An initiation zone of chromosomal DNA replication located upstream of c-myc gene in proliferating HeLa cells. Mol. Cell. Biol. 10, 4899± 4904. Vassilev, L. & Russev, G. (1988). Puri®cation of nascent DNA chains by immunoprecipitation with antiBrdU antibodies. Nucl. Acids Res. 21, 10397. Vassilev, L., Burhans, W. C. & DePamphilis, M. L. (1990). Mapping an origin of DNA replication at a single-copy locus in exponentially proliferating mammalian cells. Mol. Cell. Biol. 10, 4685± 4689. Walter, J. & Newport, J. W. (1997). Regulation of replicon size in Xenopus egg extracts. Science, 275, 993± 995. Waltz, S. E., Trivedi, A. A. & Leffak, M. (1996). DNA replication initiates non-randomly at multiple sites near the c-myc gene in HeLa cells. Nucl. Acids Res. 24, 1887± 1894. Wu, C., Friedlander, P., Lamoureux, C., ZannisHadjopoulos, M. & Price, G. B. (1993a). cDNA clones contain autonomous replication activity. Biochim. Biophys. Acta, 1174, 241± 257. Wu, C., Zannis-Hadjopoulos, M. & Price, G. B. (1993b). In vivo activity for initiation of DNA replication resides in a transcribed region of the human genome. Biochim. Biophys. Acta, 1174, 258± 266. Zannis-Hadjopoulos, M., Persico, M. & Martin, R. G. (1981). The remarkable instability of replication loops provides a general method for the isolation of origins of cDNA replication. Cell, 27, 155 ± 163. Zannis-Hadjopoulos, M., Kaufmann, G. & Martin, R. G. (1984). Mammalian DNA enriched for replication origins is enriched for snap-back sequences. J. Mol. Biol. 179, 577± 586. Zimmerman, K. & Mannhalter, W. (1996). Technical aspects of quantitative competitive. PCR. BioTechniques, 21, 268± 279.

Edited by J. Karn (Received 7 July 1997; accepted 14 August 1997)