- Email: [email protected]
Differential expression of rat and human type 1 metabotropic glutamate receptor splice variant messenger RNAs
Pergamon
PII:
Neuroscience Vol. 85, No. 3, pp. 733–749, 1998 Copyright 1998 IBRO. Published by Elsevier Science Ltd Printed in Great Britain. All rights reserved 0306–4522/98 $19.00+0.00 S0306-4522(97)00670-2
DIFFERENTIAL EXPRESSION OF RAT AND HUMAN TYPE 1 METABOTROPIC GLUTAMATE RECEPTOR SPLICE VARIANT MESSENGER RNAS A. BERTHELE,†§0 D. J. LAURIE,*0 S. PLATZER,† W. ZIEGLGA } NSBERGER,† T. R. TO } LLE†§ and B. SOMMER*‡ *NOVARTIS Pharma AG, CH-4002 Basle, Switzerland †Max-Planck Institute of Psychiatry, Munich, Germany Abstract––The type I metabotropic glutamate receptor (mGlu1) messenger RNA and protein are known to be widely expressed in rat brain, but knowledge of the regional expression of splice variants other than mGlu1a is limited. Probes were designed for in situ hybridization that specifically recognize each of the carboxy-terminal splice variants mGlu1a, -1b, -1c and -1d. The novel rat mGlu1d sequence was obtained by polymerase chain reaction and the predicted protein is highly homologous to the human sequence but contains both conservative and radical substitutions and is slightly longer (912 vs 908 amino acids). Each rat mGlu1 splice variant messenger RNA was found in a unique expression pattern. The messenger RNA encoding mGlu1a was abundant in cerebellar Purkinje cells and in mitral and tufted cells of the olfactory bulb. Strong expression was also detected in hippocampal interneurons, and neurons of the thalamus and substantia nigra, while moderate expression was found in colliculi and cerebellar granule cells. The mGlu1b messenger RNA was strongly expressed in Purkinje cells, hippocampal pyramidal neurons, dentate gyrus granule cells and lateral septum, and moderately expressed in striatal, superficial cortical and cerebellar granule neurons. The mGlu1d messenger RNA was expressed in all regions where mGlu1a and -1b were detected; abundant in Purkinje cells, mitral and tufted cells, and hippocampal principal neurons and interneurons, strong in thalamus and substantia nigra, and moderate in lateral septum, cortex, striatum and colliculi. Human mGlu1 splice variant expression in the cerebellum matched that found for the rat. No specific signal was found with a probe capable of hybridizing to the rat mGlu1c splice junction, although another probe designed against a more 3 sequence of mGlu1c gave strong signals in the cerebellum and hippocampus, and moderate signals in thalamus and colliculi. It is concluded that mGlu1d messenger RNA is widely expressed, that mGlu1a and -1b messenger RNAs are expressed in almost complementary patterns and that formation of the mGlu1c splice junction is a rare event. 1998 IBRO. Published by Elsevier Science Ltd. Key words: in situ hybridization, metabotropic glutamate receptor type I, splice variants, rat, human.
The metabotropic glutamate (mGlu) receptors belong to a distinct family of G-protein-coupled receptors of the CNS that includes the calciumsensing and GABAB receptors.17,31 To date, eight related mGlu sequences have been identified (mGlu1 to -8) and assigned to three groups according to their sequence similarities, pharmacological preferences and second messenger coupling.31 Group I comprises mGlu1 and mGlu5 receptors, Group II contains the mGlu2 and mGlu3 receptors, and Group III consists of the mGlu4, -6, -7 and -8 receptors. Each receptor mRNA is expressed in a unique and distinct pattern ‡To whom correspondence should be addressed. §Present address: Department of Neurology, Technical University, Munich, Germany 0These authors contributed equally to this work. Abbreviations: DTT, dithiothreitol; IP3, inositol trisphosphate; IR, immunoreactivity; ISH, in situ hybridization; LTD, long-term depression; LTP, long-term potentiation; mGlu, metabotropic glutamate; OB, olfactory bulb; RT– PCR, reverse transcription–PCR; SSC, standard saline citrate; TdT, terminal deoxynucleotidyl transferase.
in the rat brain,7,28,35,36,43 except mGlu6 which is restricted to the retina.26 The rat mGlu1 receptor has previously been found in three carboxy terminal splice variant forms; mGlu1a (or -1á), mGlu1b (or -1â) and mGlu1c (1199, 906 and 897 amino acids, respectively).15,24,32,42 Relative to the coding sequence of mGlu1a, mGlu1b possesses an additional 85 base pair exon, inserted between bases 2660 and 2661,42 whereas mGlu1c is formed by the splicing of a unique sequence to the same splice junction.32 Both mGlu1b and -1c exons contain in-frame termination codons resulting in shorter receptors, and encode novel carboxy terminal sequences of 20 and 10 amino acids, respectively. The human homologues hmGlu1a and hmGlu1b have recently been cloned.9,41 An additional human splice variant, hmGlu1d, lacks 35 base pairs immediately after the common splice junction, relative to hmGlu1a. This deletion induces a shift of the reading frame, a novel carboxy terminal sequence and termination after 908 amino acids.19 Gene deletion experiments have shown that the mouse mGlu1 receptor is fundamental in motor
733
734
A. Berthele et al.
co-ordination and cerebellar long-term depression (LTD) at the parallel fibre/Purkinje cell synapse.1,2,8 It may also have a central role in long-term potentiation (LTP) in the hippocampus and spatial memory.1,2,4,8 Since in these procedures all mGlu1 splice variants were simultaneously deleted, it is as yet uncertain if each, or only specific, mGlu1 splice variants are involved in such LTD and LTP. Examination of the regional expression of each mGlu1 splice variant mRNA and protein will assist determination of their functional roles. The mRNAs encoding alternative splice forms of ionotropic glutamate receptors are differentially distributed,18,21,40 implying regional heterogeneity of function. Heterogenous distribution of mGlu1 splice variants is supported by reverse transcription– polymerase chain reaction (RT–PCR) and western analysis of mGlu1a and -1b,6,10,25 but spatial resolution by such methods is limited. Regional and subcellular localization by immunohistochemistry have as yet been performed thoroughly only on rat mGlu1a,3,22,23 due to difficulties in raising specific antibodies for the other splice variants.13,14 Previous in situ hybridization (ISH) studies on rat brain, although identifying the individual expression profile of mGlu1c mRNA,32 have not resolved the regional expression of mGlu1a, -1b and -1d mRNAs due to the use of non-discriminating probes.7,10,24,32,39,43 This study therefore examines the regional expression of the individual mGlu1 splice variant mRNAs in rat and human brain. A preliminary account of these findings has been presented in abstract form.20 EXPERIMENTAL PROCEDURES
Cloning of rat and human sequences In order to confirm the existence of rat mGlu1d, and to obtain cDNA for specificity testing (see below), sequences encoding the rat mGlu1 splice junctions were amplified from rat whole brain cDNA using primer DL198 (5 CTGGGATCCATGTTTACTCCGAAGATGTAC-3 ) and the antisense primer 5 -ATTAAGCTTCACGTGCACAGA GAGGCGCTG-3 . (Artificial BamHI and HindIII sites are italicized). The thermocycling conditions were 1 min at 94C, 1 min at 60C, 1 min at 72C, 38 cycles. The PCR products (300 base pairs) were ligated into the HindIII and BamHI sites of pBluescript, sequenced and identified as fragments of the rat mGlu1a and -1b splice variants,42 and the rat homologue of human mGlu1d (Fig. 1a). Sequential PCR as described above was also performed on rat brain cDNA in an attempt to isolate the rat mGlu1c sequence32 using the specific primers 5 -CAACTACAAGATCATCA CTACCTGC-3 and 5 -GGTCTGCATCTCAGGTGCA TTTC-3 in the first round, followed by primers DL198 and 5 -GGTAAGCTTCTCAGGTGCATTTCACTTCAA-3 in the second round, where 0.1 µl of the first round reaction was used as template. (An artificial HindIII site is italicized). No PCR product homologous to the rat mGlu1c sequence was obtained. The sequences encoding the human hmGlu1a, -1b and -1d splice variants have already been described.9,19,41 In an attempt to obtain sequence encoding the human homologue of the rat mGlu1c variant, sequential PCR was performed on a human hippocampal cDNA library in pBluescript (Stratagene) using as antisense primer in both rounds the
degenerate primer 5 -CGCGGATCCTCAATAGACAGT GTTTTGGCGGTCTA(GA)(GA)GC(GA)AA(GA)TT-3 . (The nucleotides complementary to the termination codon of rat mGlu1c are in bold text, and an artificial BamHI site is italicized). In the first round the sense primer 5 CATGTACACCACCTGTATCATCTG-3 was used, and in the second round the nested sense primer DL198 (see above). The first round thermocycling conditions were; 94C for 1 min, 45C for 1 min, 72C for 2 min, 10 cycles, then 94C for 1 min, 55C for 1 min and 72C for 2 min, 20 cycles. The second round used 0.1 µl of the first round as template under conditions of 94C for 1 min, 55C for 1 min, 72C for 2 min, 38 cycles. No sequence homologous to rat mGlu1c was obtained by this method, or by PCR using the above sense primers with external pBluescript sequencing primers, or by screening ë-phage libraries of human hippocampal, retinal or whole brain cDNAs (Stratagene and Clontech). In situ hybridization In situ hybridization was performed on rat and human brain sections based on the method of Wisden and Morris.45 An antisense oligonucleotide probe (rmGlu1pan, 5 -AA GGCACTGCGGACGTTCCTCTCAGGTTTGGCAATG ATGA-3 (40-mer)) was designed against a common sequence, upstream of the splice junction15,24 in order to hybridize to all mGlu1 splice variant mRNAs simultaneously. A similar probe (hmGlu1pan, 5 -AAGGCA C TGCGGACATTCCTCTCAGGCTTGGCAATAATGA3 (40-mer)) was designed against a common human mGlu1 sequence.9,19 Splice variant-specific probes (40-mers) were designed from the rat mGlu1 sequences,32,42 (rat mGlu1d, this study) (rmGlu1a, 5 -TGACACAGACTTGCCGTTA GAA-TTGGCATTCCCTGCCCCG-3 ; rmGlu1b, 5 -CGA GAATTCTGGCTGCCTCTTC-TTGGCATTCCCTGCC CCG-3 ; rmGlu1c, 5 -GTTTTGGCGGTCTAAAGCAA AA-TTGGCATTCCCTGCCCCG-3 ; rmGlu1d, 5 -CCCT TGGGCGCCTGTCTTCCAC-TTGGCATTCCCTGCCC CG-3 ), and human mGlu1 sequences9,19 (hmGlu1a, 5 TGACACAGACTTGCCATTAGAA-TTGGCATTCCCT GCCCCT-3 ; hmGlu1b, 5 -CGAGAATTCTGGCTGCC TCTTC-TTGGCATTCCCTGCCCCT-3 ; hmGlu1d, 5 CCCTTGGGCACCTGTCCTCCAC-TTGGCATTCCCT GCCCCT-3 ). These probes straddle the splice junction (-) of each splice variant. Two additional 40-mer probes were synthesized which recognize sequences of the unique rat mGlu1b and mGlu1c exons (rmGlu1bx, 5 -GTTTTCAA AGCTGCGCATGTGCCGACGGACACTGGCTGCT-3 ; rmGlu1cx 5 - GGTCTGCATCTCAGGTGCATTTCACT TCAATAGACAGTGT-3 , respectively). Rat brains (n=5) were excised from adult female Wistar rats (Charles River) with an average body weight of 280 g and immediately frozen on dry ice. Human brain tissues (n=4) were obtained at autopsy from consenting patients with no history of neurological or psychiatric disease (age 48–81 years, mean 63 years; two females, two males). After a post mortem interval of 12–18 h, tissues were removed and rapidly frozen on dry ice. Sections (14 µm) of rat whole brain and human brain regions were cut on a cryotome, mounted on polylysine-coated slides and fixed in 4% paraformaldehyde. Hybridization was performed without further tissue pretreatment. All probes were radiolabelled using á-[35S]dATP (Amersham) and terminal deoxynucleotidyl transferase (TdT; Boehringer Mannheim) to a specific activity of approximately 5107 c.p.m./pmol. The labelled probes were diluted in hybridization buffer (50% formamide, 4standard saline citrate (SSC), 5Denhardt’s solution, 10% dextran sulphate, dithiothreitol (DTT)45) to a final concentration of 0.06 pmol/ml and hybridized at 42C to the rat and human brain sections. In preliminary studies it was found that the optimum conditions for human sections involved a 48 h incubation period and 50 mM DTT rather than the overnight incubation and 10 mM DTT used
In situ hybridization on mGlu1 splice variant mRNAs for the rat sections. After incubation, the sections were washed (1SSC, 55C, 30 min), dried through ethanol (70–95%) and exposed to autoradiographic film (Kodak Biomax) for four weeks or dipped in photographic emulsion (Kodak NTB2) and exposed for three months. Non-specific hybridization was determined by the coincubation in control experiments of 50-fold excess of unlabelled probe. Identification of structures in Cresyl Violet-stained sections was performed with the aid of a rat brain atlas.29
735
sequence (908 amino acids), the deduced rat sequence contains a few conservative (e.g., Arg to Lys) and more radical (e.g., Tyr to Arg) substitutions, and the termination codon is at a more distant position predicting a longer protein (912 amino acids) (Fig. 1A). These differences indicate two potential protein kinase C and cAMP/cGMP kinase phosphorylation sites30 in the rat sequence and one in the human (Fig. 1A).
Probe specificity The specificity and efficacy of the rat splice variantspecific ISH probes were examined by hybridization to pBluescript clones encoding the rat mGlu1a, -1b, -1d (see above) and -1c splice junctions. The unique sequence for rat mGlu1c was artificially constructed from two sense oligonucleotides and two complementary antisense oligonucleotides which, when hybridized, would produce the rat mGlu1c splice junction with 3 -overhangs complementary to the KpnI and SacI sites of pBluescript. The two sequential sense oligonucleotides were 5 -CGGGGCAGGGAATGCCA ATTTTGCTTTAGACCGCCAAAACACTGTCTATT-3 and 5 -GAAGTGAAATGCACCTGAGATGCAGACCA AGCT-3 (the termination codon is in bold text and the overhang complementary to SacI is italicized). The two sequential antisense oligonucleotides were 5 -TGGTCT GCATCTCAGGTGCATTTCACTTCAATAGACAGTG TTTTGGCGGT-3 and 5 -CTAAAGCAAAATTGGCAT TCCCTGCCCCGGTAC-3 (the bases complementary to the termination codon are in bold text and the overhang complementary to KpnI is italicized). These oligonucleotides (400 pmol of each) were 5 -phosphorylated using T4 polynucleotide kinase (Boehringer Mannheim) and ATP (10 mM), heated at 94C for 10 min and allowed to cool and anneal slowly over 2 h. The annealled oligonucleotides were then ligated together and into the SacI and KpnI sites of pBluescript. Sequencing confirmed the construction of a sequence encoding the region around the rat mGlu1c splice junction32 (bases 2642–2722). The pBluescript clones (10ng each) encoding the rat mGlu1a, -1b, -1c and -1d splice junction sequences were dotted onto nitrocellulose membrane, denatured with alkali and immobilized by drying. The ISH probes were 5 radiolabelled using [ã-32P]dCTP (Amersham) and T4 polynucleotide kinase (Boehringer Mannheim). In additional experiments, before 5 -radiolabelling, the rmGlu1d probe was 3 -tailed with non-radioactive dATP using TdT (Boehringer Mannheim) in conditions corresponding to the [35S]dATP labelling of the ISH oligos. Hybridization to immobilized cDNAs, and subsequent washing conditions were performed as for the brain sections. The blots were exposed to autoradiography film (Kodak XOmat AR) overnight and developed.
Probe specificity In situ hybridization was performed on the rat and human mGlu1 mRNAs. In horizontal sections of rat brain (Fig. 2), a probe simultaneously recognizing all carboxy terminal splice variants (rmGlu1pan) showed a widespread expression of this mRNA type with prominent expression in cerebellum, hippocampus, thalamus and olfactory bulb. White matter tracts were not labelled by this or any other probe. Similar results were obtained with another probe designed against a sequence upstream of the first transmembrane domain (data not shown). Expression of individual mGlu1 splice variants was examined using oligonucleotides that straddle the 3 -splice junction. Specificity of the rat probes was confirmed by hybridization to constructs containing the splice junction sequences of each variant. The pan probe hybridized to all constructs except the artificial rat mGlu1c construct, which lacked the appropriate sequence (Fig. 1B). Each of the other probes hybridized strongly to the construct against which it was designed (Fig. 1B). Only probe rmGlu1d showed some weak cross-hybridization to the rat mGlu1a and mGlu1b sequences, but this was even further reduced when the oligo was 3 -tailed with poly-dATP to mimic the experimental conditions used for hybridization to the brain sections (Fig. 1B). Specificity of each splice-specific probe was also examined on rat brain sections by co-incubation with a 50-fold excess of either the same, unlabelled probe or an excess of the other unlabelled probes in combination (Fig. 3). Whereas excess of each matching probe completely prevented specific hybridization, a concentrated cocktail of related but non-identical probes had only marginal effects on each ISH signal.
RESULTS
The coding sequences around the common splice junction were amplified from rat whole brain cDNA by PCR. By this method three amplicons (366, 281 and 246 base pairs) were simultaneously amplified, the first two of which were confirmed by sequencing as rat mGlu1b and -1a, respectively.15,24,42 The third sequence (Fig. 1A) lacked 35 bases (bases 2660–2695) of the rat mGlu1a sequence,24 analogous to the published human hmGlu1d sequence.19 This 35 base pair deletion results in a shift of the reading frame and the introduction of an alternative termination codon. Compared to the human mGlu1d
mGlu1a receptor messenger RNA Using a splice-specific probe it was apparent that mGlu1a mRNA was abundant in cerebellum and olfactory bulb (Figs 2, 3). Microscopic examination revealed intense signals over Purkinje cells (Fig. 5) and over mitral neurons of the olfactory bulb (OB) (Fig. 6). Strongly-labelled tufted cells were found throughout the OB external plexiform layer (Fig. 6). The mGlu1a mRNA was moderately expressed in cerebellar granule cells, putative stellate/basket cells and OB periglomerular cells, and weakly expressed in OB granule cells (Figs 2, 3, 5, 6) and cerebellar deep
736
A. Berthele et al.
Fig. 1. (A) Comparison of the 3 -ends and carboxy termini of human and rat mGlu1d. Human sequence from Laurie et al.19 Sequences begin at base 2653 and amino acid 885. The arrow indicates the splice junction (-). Differences between the coding sequences are given above and below the line while resultant amino acid changes are highlighted as bold italics. Termination of translation is indicated by asterisks. Potential sites for phosphorylation by protein kinase C or cGMP-dependent protein kinase30 are indicated by ~. (B) Assessment of ISH probe specificities. 32P-labelled oligonucleotide probes were hybridized to cDNA constructs dotted onto nitrocellulose membrane and exposed to film. (a, b, c and d) indicate probes spanning the splice junctions of rat mGlu1a, -1b, -1c and -1d, respectively. (cx) indicates the probe rmGlu1cx, designed against a unique sequence of rat mGlu1c downstream from the splice junction. (d-A) indicates hybridization with the 3 -polyadenylated rmGlu1d probe. (pan) indicates a probe recognizing a common mGlu1 sequence upstream of the splice junctions.
nuclei (not shown). Strong expression was noted in the substantia nigra, pars compacta and reticulata, and in almost all nuclei of the thalamus, except the reticular nucleus and habenula (Figs 2, 7). Moderate expression was detected in colliculi and central gray (Fig. 2), the medial septum and globus pallidus (not shown). Punctate signals in the hippocampal CA1 stratum oriens and the hilus of the dentate gyrus were found to be labelled non-principal neurons, presum-
ably interneurons (Figs 2, 8). In the cerebral cortex some neurons in layers IV and V were moderately labelled, while the striatum and lateral septum gave no ISH signal (Fig. 2). The granule cell layer of the cerebellum often gave a strong signal on autoradiographic film for the mGlu1pan and splice variant-specific probes (Figs 2, 9). Shorter exposure times (Fig. 3) and photomicrography (Figs 5, 10) indicate that the
In situ hybridization on mGlu1 splice variant mRNAs
Fig. 2. X-Ray film autoradiographs depicting the in situ hybridization of mGlu1 splice-specific probes to horizontal sections of rat brain. (A) pan probe (all splice variants); (B–D) probes specific for mGlu1a, -1b and -1d, respectively. Abbreviations: Cb, cerebellum; CG, central gray; Co, colliculi; Cx, cerebral cortex; hb, habenula; Hc, hippocampus; hi, hilus of dentate gyrus; LS, lateral septum; m, mitral cell layer; OB, olfactory bulb; rn, reticular nucleus of thalamus; Str, striatum; Th, thalamus. Scale bar=3 mm.
737
738
A. Berthele et al.
Fig. 3. Assessment of ISH probe specificities on sections of rat brain by X-ray film autoradiography. (A, D and G) ISH of radiolabelled mGlu1a, -1b and -1d probes to olfactory bulb, hippocampus and cerebellum, respectively. (B, E and H) as for A, D and G, respectively, but with co-incubation of 50-fold excess of unlabelled non-matching probes (e.g., [35S]rmGlu1a+rmGlu1b (50)+rmGlu1d (50)). (C, F and I) as for A, D and G, respectively, but with co-incubation of 50-fold excess of unlabelled matching probe (e.g., [35S]rmGlu1a+rmGlu1a (50)). Abbreviations: dg, dentate gyrus; hpc, hippocampal pyramidal cell layer; m, mitral cell layer; pcl, Purkinje cell layer. Scale bars=1 mm.
strength of this signal on film was due to moderate signals from densely packed granule cells. This was also observed in a previous ISH study on mGlu1 mRNA.39
mGlu1b receptor messenger RNA The mGlu1b mRNA was abundantly expressed in dentate gyrus granule cells and hippocampal
In situ hybridization on mGlu1 splice variant mRNAs
pyramidal cells, especially of region CA3 (Figs 2, 3, 8). Strong expression was also detected in the lateral septum and cerebellar Purkinje cells (Figs 2, 5). Moderate to strong signals were noted in striatum, in cerebellar and OB granule cells, and in superficial (II) and deep (V/VI) layers of the cerebral cortex (Figs 2, 5, 6). Weak labelling was detected in cerebellar stellate/basket cells, in OB periglomerular cells and central grey (Figs 2, 6). Mitral and tufted cells of the OB, hippocampal interneurons, stellate/basket neurons, and neurons of the substantia nigra were not notably labelled (Figs 6–8). This expression profile of mGlu1b mRNA was obtained with both probe rmGlu1b that straddles the splice junction and a second probe, rmGlu1bx, designed against the unique mGlu1b exon (data not shown). mGlu1c receptor messenger RNA Both probe rmGlu1c, designed to straddle the splice junction of rat mGlu1c, and probe rmGlu1cx, designed against the unique exon sequence of rat mGlu1c downstream from the splice junction, hybridized strongly to the artificial mGlu1c construct dotted onto nitrocellulose membrane (Fig. 1b). However, on rat brain sections probe rmGlu1c unexpectedly gave no signal above that of the competition control (Fig. 4). This was confirmed by repeating the experiment with a second, identical probe synthesized separately. In contrast, probe rmGlu1cx hybridized strongly to cerebellar Purkinje and granule cells, and principal neurons of the dentate gyrus and hippocampus (especially CA3). Moderate signals were obtained throughout the thalamus and colliculi, and weak signals in OB granule cells (Fig. 4). mGlu1d receptor messenger RNA The hybridization pattern of the mGlu1d probe indicated abundant mRNA expression in Purkinje cells, dentate gyrus granule cells, hippocampal pyramidal cells (especially of region CA3) and mitral and tufted cells of the olfactory bulb (Figs 2, 3, 5, 6, 8). Neurons of the substantia nigra and thalamus (except the reticular nucleus and lateral habenula) were strongly labelled (Figs 2, 7), as were some OB periglomerular cells (Figs 2, 6). This splice variant was also strongly detected in presumed interneurons of the hippocampal CA1 stratum oriens and dentate gyrus hilar region (Fig. 8). Moderate labelling was noted in granule and stellate/basket cells of the cerebellum, and OB granule cells (Figs 2, 3, 5, 6). Slightly weaker signals were observed in lateral septum, striatum, cortical layers II and IV–VI, and the central gray (Fig. 2). In situ hybridization was performed similarly on sections of human cerebellum. Cerebellar expression patterns of the total hmGlu1 mRNA population and the individual hmGlu1a, -1b and -1d splice variant mRNAs (Figs 9, 10) were comparable to those of the
739
corresponding rat homologues (Figs 2, 3, 5). Strong signals were noted in all cerebellar cell types with the hmGlu1pan probe. Strong signals from Purkinje and stellate/basket cells were noted for the hmGlu1a and -1d variants, whereas the hmGlu1b mRNA was less strongly detected in these cell types (Figs 9, 10). Moderate expression of all splice variants was noted in the granule cells. DISCUSSION
Sequences encoding a fourth splice variant, mGlu1d, of the type I metabotropic glutamate receptor have been cloned from human19 and now rat cDNAs (Fig. 1A). Both lack 35 base pairs of the mGlu1a 3 coding sequence, resulting in a shift of the reading frame and the introduction of an alternative termination codon. Downstream of the splice junction the rat and human sequences show high identity, but notable features of the rat clone include its greater length (912 vs 908 amino acids) and the presence of an additional kinase consensus site (Fig. 1A), which may affect its function or regulation. Previous RT–PCR analysis on rat brain cDNAs did not detect the short mGlu1d splice variant.14,25 This may be due to the small size difference (35 base pairs) from the mGlu1a variant, the difficulty in quantitatively detecting small amplicons on ethidium bromide-stained gels, or to the use of a PCR primer hybridizing to the splice junction.25 However, the presence of a homologous splice variant in both rat and human (Fig. 1A) confirms its existence. Previous ISH studies on the rat mGlu1 mRNA distribution7,10,11,24,32,39,43 did not discriminate between mGlu1a and -1b mRNAs since probes were designed against sequences common to both splice variants. Such probes gave ISH results matching the present data obtained using the non-discriminating (see Fig. 1B) rmGlu1pan probe (Fig. 2), and concur with results from northern analyses.15,24 The hybridization patterns obtained with the mGlu1pan probe were highly similar in rat and human cerebellum (Figs 9, 10), in agreement with the similarity between human and rat mGlu1 mRNA distributions assessed by northern blotting.41 The use of ISH probes that straddle the splice junction allows discrimination between related mRNA splice variants.18 The specificity of the splice variant probes was proven in both a defined cDNA assay (Fig. 1B) and in the ISH procedure on sections (Fig. 3), showing that more than half of the nucleotides in each 40-mer probe must find a complementary match to form a stable hybrid. The 3 -polyadenosine tail reduces the degree of complementarity, thereby reducing the stability of the hybrids and further increasing stringency18 (Fig. 1B). ISH with splice-specific oligonucleotide probes reveals for the first time that the mRNAs encoding the mGlu1a and -1b mRNAs are expressed in almost complementary patterns in the forebrain, while
740
A. Berthele et al.
Fig. 4. X-Ray film autoradiographs depicting the ISH of mGlu1c probes to horizontal sections of rat brain. (A, B) probe rmGlu1c, designed against the rat mGlu1c splice junction. (C, D) probe rmGlu1cx, designed against the unique downstream exon. Upper panel A and C of each pair shows the total ISH signal, while lower panel B and D shows the signal in presence of 50-fold excess of unlabelled matching probe. Abbreviation: IC, inferior colliculus; others as for Fig. 2. Scale bar=3 mm.
mGlu1d mRNA co-localizes with both mGlu1a and -1b (Fig. 2). Surprisingly, no specific ISH signal was obtained in the rat brain for the mGlu1c splice junction (Fig. 4), although the ability of the probe to recognize the appropriate sequence was confirmed in dot-blot experiments (Fig. 1b). The sequence downstream of the splice junction was, however, detected in both dot-blot and ISH procedures (Figs 1B, 4), revealing a distribution matching that found with a similarly designed probe.32 We found no mGlu1c clone using library screening or by PCR using specific or degenerate primers. Northern blotting has
revealed no transcript of the expected size for human mGlu1c41 and, although a mGlu1c antibody immunostained Purkinje cells,13 immunoblotting produced only a ‘‘virtually undetectable’’ signal.6 It is therefore concluded that, although the unique mGlu1c sequence downstream of the splice junction is transcribed32 (Fig. 4), splicing of the mGlu1 mRNA to form the mGlu1c clone must be a rare event. In agreement with the present ISH results, analysis of mGlu1a and -1b distribution by RT–PCR14,25 reveals high expression of mGlu1a mRNA in extracts of cerebellum, olfactory bulb and thalamus,
Fig. 5. Photomicrographs of rat cerebellum depicting the ISH of mGlu1 splice-specific probes. Panels as in Fig. 2. Abbreviations; gcl, granule cell layer; ml, molecular layer. Single arrows, putative stellate/basket cells; double arrows, Purkinje cells. Scale bar=15 µm.
In situ hybridization on mGlu1 splice variant mRNAs 741
Fig. 6.
In situ hybridization on mGlu1 splice variant mRNAs
743
Fig. 7. Photomicrographs of rat substantia nigra depicting the ISH of mGlu1 splice-specific probes. Panels as in Fig. 2. Abbreviations; SNC, pars compacta; SNR, pars reticulata. Dotted line delineates boundary between SNC and SNR. Scale bar=100 µm.
and shows much mGlu1b mRNA in hippocampus. Immunoblotting and immunohistochemical studies indicate a similar distribution of the 150,000 mol. wt mGlu1a protein.3,6,10,13,14,23 Immunoblotting for the amino terminus of mGlu1 indicates a 95,000 mol. wt protein in rat cortex, striatum, hippocampus and cerebellum, which was assumed to be mGlu1b.10,39 In hippocampus however, specific mGlu1b antibodies detect a presumptive 190,000 mol. wt dimer but no 95,000 mol. wt protein.6,14 The hippocampal 95,000 mol. wt mGlu1 protein may represent mGlu1d since the mRNA is present (Figs 2, 8) and it is of similar size (912 amino acids) (Fig. 1A) to mGlu1b (906 amino acids). From past and present data the cerebellum, thalamus, olfactory bulb and hippocampus stand out as four structures with pronounced differences in mGlu1 splice variant expression.
Cerebellum The cerebellar expression profiles of the human mGlu1 splice variant mRNAs (Figs 9, 10) closely resembled those found in the rat (Figs 2, 3, 5), implying similar roles in the two species. In rat and human Purkinje and stellate/basket cells, mRNAs encoding the mGlu1a and -1d variants were abundant whereas mGlu1b mRNA was more weakly detected (Figs 2, 3, 5, 9, 10). These results concur with an abundance of mGlu1 and mGlu1a immunoreactivity (IR) and weaker mGlu1b-IR in stellate/basket cells and Purkinje cell somata and dendrites.3,10,13,14,23,37 The Purkinje cell mGlu1 receptors are important in cerebellar function since blockade of the receptor by a specific antibody,37 or absence of the receptor in mGlu1 / mice2,8 impairs Purkinje cell LTD and
Fig. 6. Photomicrographs of rat olfactory bulb depicting the ISH of mGlu1 splice-specific probes. (A, B) hybridization with probe rmGlu1pan. (C, D) hybridization with probe rmGlu1a. (E, F) hybridization with probe rmGlu1b. (G, H) hybridization with probe rmGlu1d. Abbreviations; epl, external plexiform layer; glo, glomerular layer; gcl, granule cell layer. Single arrows, tufted cells, double arrows; mitral cells. Scale bar=30 µm.
Fig. 8.
In situ hybridization on mGlu1 splice variant mRNAs
745
Fig. 9. X-Ray film autoradiographs depicting the ISH of mGlu1 splice-specific probes to sections of human cerebellum. (A) Pan probe (all splice variants); (B–D) probes specific for hmGlu1a, -1b and -1d, respectively. Abbreviations; ml, molecular layer; pcl, Purkinje cell layer; gcl, granule cell layer. Scale bar=1 mm.
severely affects motor co-ordination. The mGlu1 / mice also show a high incidence of polyinnervation of Purkinje cells by climbing fibres, contrasting with the normal feature of virtual monoinnervation.16 The present ISH results indicate that both the mGlu1a and -1d receptors may be abundant in Purkinje and stellate/basket cells (Figs 2,
3, 5, 9, 10) and may therefore contribute to Purkinje cell LTD and/or the regulation of climbing fibre innervation. The mGlu1 mRNA in granule cells of rat and human cerebellum7,10,24,39,43 (Figs 2, 9), is inferred from the present data to comprise mGlu1a, -1b and -1d approximately equally (Figs 2, 3, 5, 9, 10).
Fig. 8. Photomicrographs of rat hippocampus depicting the ISH of mGlu1 splice-specific probes. Panels as in Fig. 6. Left column, dark-field. Right column, bright-field. Abbreviations; dg, dentate gyrus; gcl, granule cell layer; CA3/4, hippocampal pyramidal cell layer of region CA3/4. Arrows indicate non-principal cells, presumably interneurons. Scale bars=100 µm (left), 15 µm (right).
A. Berthele et al.
Fig. 10.
746
In situ hybridization on mGlu1 splice variant mRNAs
IR for the mGlu1 amino terminus and the mGlu1a and -1b carboxy termini has been reported by some as weak or undetectable in granule cell somata and nerve terminals.3,13,14,23,37 Others, however, have described mGlu1- and mGlu1a-IR as ranging from absent to strong depending in the cerebellar folia examined.3,10 These results suggest that the mGlu1a and -1b proteins in granule cells are not translated from the mRNA, are rapidly degraded, or are detected only in certain regions or under particular experimental conditions. Future experiments will determine if the mGlu1d protein can be detected in cerebellar granule cells. Thalamus In horizontal sections of the rat thalamus mGlu1a and -1d mRNAs are about equally expressed in all nuclei except the reticular thalamus and the habenula (Fig. 2). IR for both short and long mGlu1 variants has been detected in the thalamus in a similar distribution.3,10 In contrast mGlu1b mRNA is absent from the entire thalamus (Fig. 2). Splice variant specific IR has been determined only for the mGlu1a receptor and is localized postsynaptically on thalamic neurons receiving stimulatory input from corticothalamic projections.3,23,44 Excitatory postsynaptic Class I mGlu receptors have also been functionally detected on neurons of the rat ventrobasal thalamus responding to nociceptive stimuli and mGlu receptor agonists.33,34 Whether these are accounted for by mGlu1a or -1d receptors needs to be determined. Olfactory bulb In the rat olfactory bulb the splice variant mRNAs encoding mGlu1a and -1d are abundantly expressed in mitral and tufted neurons (Figs 2, 3, 6). This correlates well with the intense mGlu1 and mGlu1a-specific IR in olfactory glomeruli10,23 where the olfactory nerves synapse onto the primary dendrites of mitral and tufted cells. The mGlu1 receptors are therefore involved in olfaction at the point of primary sensory input. Granule cells express moderate amounts of all three splice variant mRNAs (Figs 2, 3, 6). IR for the mGlu1 amino terminus and mGlu1a carboxy terminus is weak in the granule cell layer but strong in the external plexiform layer.3,10,23 Thus, mGlu1 receptors may exist on both faces of the dendrodendritic synapses formed between mitral and granule cells in the external plexiform layer. Hippocampus In the stratum oriens of hippocampal region CA1 and the hilus of the dentate gyrus mGlu1a mRNA
747
was located only in non-principal cells, presumably interneurons (Figs 2, 8). IR for mGlu1a and the mGlu1 amino terminus has been confirmed on somata and dendrites of somatostatin-positive rat hippocampal interneurons in the above areas and in several layers of CA3.3,14,22,23 The mRNA encoding mGlu1d was also detected in interneurons of these hippocampal regions (Figs 2, 8). It has been proposed3,14 that interneuron mGlu1 and kainate receptors may regulate somatostatin release in response to glutamate from local recurrent collaterals of principal neurons, and may also confer the high susceptibility of these interneurons to glutamatergic excitotoxicity. Interestingly, mGlu7-IR in the hippocampus is found only on terminals of pyramidal cell axons which appose dendrites of mGlu1a-positive interneurons,38 indicating specific pre- and postsynaptic organization of mGlu receptors to control the release of, and response to, neurotransmitter. Since hippocampal mGlu1a mRNA and protein are restricted to interneurons3,14,23 (Figs 2, 8), then the strong IR signals for the mGlu1 amino terminus in the neuropil layers of CA3 and the molecular layer of the dentate gyrus10,22 can be attributed to the shorter mGlu1 splice variants. This conclusion correlates well with the expression of mGlu1b and -1d mRNAs in hippocampal pyramidal neurons and in granule cells of the dentate gyrus (Figs 2, 3, 8). IR for mGlu1b has also been described on terminals of dentate gyrus mossy fibres forming synapses with CA3 pyramidal neurons12 which would be consistent with the presence of mGlu1b mRNA in dentate gyrus granule cells. LTP at this synapse is impaired in mice lacking the mGlu1 gene8 suggesting a pre- and/or postsynaptic involvement of mGlu1b or -1d receptors. Association of these receptors with LTP in other hippocampal pathways is as yet unresolved, since in mGlu1 / mice LTP is inducible in perforant path/dentate gyrus synapses in hippocampal slices8 but not in vivo,4 and in Schaeffer collateral/CA1 synapses by some authors1 but not by others.8 Preliminary results indicate that human mGlu1 splice variant mRNAs are similarly distributed in the hippocampus, implying similar functional roles. In rat striatum, IR indicating a short variant of mGlu1 has been located in presynaptic terminals.10 Whether this IR represents mGlu1b or -1d and whether it is located on intra- or nigrostriatal terminals needs to be determined. CONCLUSION
From the present study it is apparent that alternative splicing of the mGlu1 receptor mRNA is regionally regulated in both rat and human. Although the mGlu1 and inositol trisphosphate (IP3) receptors are co-expressed in a number of structures (e.g.,
Fig. 10. Photomicrographs of human cerebellum depicting the ISH of mGlu1 splice-specific probes. Panels as in Fig. 9. Abbreviations; ml, molecular layer; gcl, granule cell layer. Single arrows, putative stellate/basket cells; double arrows, Purkinje cells. Scale bar=15 µm.
748
A. Berthele et al.
cerebellar molecular layer, hippocampus CA3), there are several locations where one is present in the absence of the other10 (e.g., olfactory bulb glomeruli, dentate gyrus molecular layer). In such regions, signal transduction through mGlu1 receptors may not proceed via IP3 and Ca2+ signalling, but via diacylglycerol and kinase pathways, or other second messengers. The mGlu1a receptor is targetted to the periphery of postsynaptic specializations in many areas of the brain3,22,27 perhaps in association with
Homer, a protein that binds to the C-terminus of mGlu1a and -5a.5 In order to understand more fully the functions of the mGlu1 receptor it will be necessary to locate the regional and subcellular locations of the mGlu1b and -1d splice variants and identify their signalling pathways. Acknowledgements—The authors are indebted to Mr A. Wanner, Novartis, for quality sequencing, and to Dr S. Weis, Munich, for providing excellent human brain tissue.
REFERENCES
1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23.
Aiba A., Chen C., Herrup K., Rosenmund C., Stevens C. F. and Tonegawa S. (1994) Reduced hippocampal long-term potentiation and context-specific deficit in associative learning in mGluR1 mutant mice. Cell 79, 365–375. Aiba A., Kano M., Chen C., Stanton M., Fox G. D., Herrup K., Zwingman T. A. and Tonegawa S. (1994) Deficient cerebellar long-term depression and impaired motor learning in mGluR1 mutant mice. Cell 79, 377–388. Baude A., Nusser Z., Roberts J. D. B., Mulvihill E., McIlhinney R. A. J. and Somogyi P. (1993) The metabotropic glutamate receptor (mGluR1á) is concentrated at perisynaptic membrane of neuronal subpopulations as detected by immunogold reaction. Neuron 11, 771–787. Bordi F. (1996) Reduced long-term potentiation in the dentate gyrus of mGlu1 receptor-mutant mice in vivo. Eur. J. Pharmac. 301, R15–R16. Brakeman P. R., Lanahan A. A., O’Brian R., Roche K., Barnes C. A., Huganir R. L. and Worley P. F. (1997) Homer: a protein that selectively binds metabotropic glutamate receptors. Nature 386, 284–288. Casabona G., Kno¨pfel T., Kuhn R., Gasparini F., Baumann P., Sortino M. A., Copani A. and Nicoletti F. (1997) Expression and coupling to polyphosphoinositide hydrolysis of group I metabotropic glutamate receptors in early postnatal and adult rat brain. Eur. J. Neurosci. 9, 12–17. Catania M. V., Landwehrmeyer G. B., Testa C. M., Standaert D. G., Penney J. B. and Young A. B. (1994) Metabotropic glutamate receptors are differentially regulated during development. Neuroscience 61, 481–495. Conquet F., Bashir Z. I., Davies C. H., Daniel H., Ferraguti F., Bordi F., Franz-Bacon K., Reggiani A., Matarese V., Conde´ F., Collingridge G. L. and Cre´pel F. (1994) Motor deficit and impairment of synaptic plasticity in mice lacking mGluR1. Nature 372, 237–243. Desai M. A., Burnett J. P., Mayne N. G. and Schoepp D. D. (1995) Cloning and expression of a human metabotropic glutamate receptor 1á: enhanced coupling on cotransfection with a glutamate transporter. Molec. Pharmac. 48, 648–657. Fotuhi M., Sharp A. H., Glatt C. E., Hwang P. M., von Krosigk M., Snyder S. and Dawson T. (1993) Differential localization of phosphoinositide-linked metabotropic glutamate receptor (mGluR1) and the inositol 1,4,5trisphosphate receptor in rat brain. J. Neurosci. 13, 2001–2012. Fotuhi M., Standaert D. G., Testa C. M., Penney J. B. and Young A. B. (1994) Differential expression of metabotropic glutamate receptors in the hippocampus and entorhinal cortex of the rat. Molec. Brain Res. 21, 283–292. Grandes P., Mateos J. M., Azkue J., Sarria R., Benitez R., Ruegg D., Malitschek B., Kuhn R. and Knoepfel T. (1996) Immunocytochemical localization of the mGluR1b metabotropic glutamate receptor in synaptic terminals of rat hippocampus. Neuropharmacology 35, A14. Grandes P., Mateos J. M., Ru¨egg D., Kuhn R. and Kno¨pfel T. (1994) Differential cellular localization of three splice variants of the mGluR1 metabotropic glutamate receptor in rat cerebellum. NeuroReport 5, 2249–2252. Hampson D. R., Theriault E., Huang X.-P., Kristensen P., Pickering D. S., Franck J. E. and Mulvihill E. R. (1994) Characterization of two alternatively spliced forms of a metabotropic glutamate receptor in the central nervous system of the rat. Neuroscience 60, 325–336. Houamed K. M., Kuijper J. L., Gilbert T. L., Haldeman B. A., O’Hara P. J., Mulvihill E. R., Almers W. and Hagen F. S. (1991) Cloning, expression and gene structure of a G protein-coupled glutamate receptor from rat brain. Science 252, 1318–1321. Kano M., Hashimoto K., Kurihara H., Watanabe M., Inoue Y., Aiba A. and Tonegawa S. (1997) Persistent multiple climbing fibre innervation of cerebellar Purkinje cells in mice lacking mGluR1. Neuron 18, 71–79. Kaupmann K., Huggel K., Heid J., Flor P. J., Bischoff S., Mickel S. J., McMaster G., Angst C., Bittiger H., Froestl W. and Bettler B. (1997) Expression cloning of GABAB receptors uncovers similarity to metabotropic glutamate receptors. Nature 386, 239–246. Laurie D. J. and Seeburg P. H. (1994) Regional and developmental heterogeneity in splicing of the rat brain NMDAR1 mRNA. J. Neurosci. 14, 3180–3194. Laurie D. J., Boddeke H. W. G. M., Hiltscher R. and Sommer B. (1996) HmGlu1d, a novel splice variant of the human type I metabotropic glutamate receptor. Eur. J. Pharmac. 296, R1–R3. Laurie D. J., Hiltscher R., Boddeke H. W. G. M., Berthele A., To¨lle T., Seuwen K. and Sommer B. (1996) Distribution and functional analysis of human mGlu1 receptor splice variants. Neuropharmacology 35, A18. Laurie D. J., Putzke J., Zieglga¨nsberger W., Seeburg P. H. and To¨lle T. R. (1995) The distribution of splice variants of the NMDAR1 subunit mRNA in adult rat brain. Molec. Brain Res. 32, 94–108. Luja´n R., Nusser Z., Roberts J. D. B., Shigemoto R. and Somogyi P. (1996) Perisynaptic location of metabotropic glutamate receptors mGluR1 and mGluR5 on dendrites and dendritic spines in the rat hippocampus. Eur. J. Neurosci. 8, 1488–1500. Martin L. J., Blackstone C. D., Huganir R. L. and Price D. L. (1992) Cellular localization of a metabotropic glutamate receptor in rat brain. Neuron 9, 259–270.
In situ hybridization on mGlu1 splice variant mRNAs 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45.
749
Masu M., Tanabe Y., Tsuchida K., Shigemoto R. and Nakanishi S. (1991) Sequence and expression of a metabotropic glutamate receptor. Nature 349, 760–765. Minakami R., Iida K., Hirakawa N. and Sugiyama H. (1995) The expression of two splice variants of metabotropic glutamate receptor subtype 5 in the rat brain and neuronal cells during development. J. Neurochem. 65, 1536–1542. Nakajima Y., Iwakabe H., Akazawa C., Nawa H., Shigemoto R., Mizuno N. and Nakanishi S. (1993) Molecular characterisation of a novel retinal metabotropic glutamate receptor mGluR6 with a high agonist selectivity for L-2-amino-4-phosphonobutyrate. J. biol. Chem. 16, 11,868–11,873. Nusser Z., Mulvihill E., Streit P. and Somogyi P. (1994) Subsynaptic segregation of metabotropic and ionotropic glutamate receptors as revealed by immunogold localization. Neuroscience 61, 421–427. Okamoto N., Hori S., Akazawa C., Hayashi Y., Shigemoto R., Mizuno N. and Nakanishi S. (1994) Molecular characterization of a new metabotropic glutamate receptor mGluR7 coupled to inhibitory cyclic AMP signal transduction. J. biol. Chem. 269, 1231–1236. Paxinos G. and Watson C. (1986) The Rat Brain in Stereotaxic Coordinates. 2nd edn. Academic, Sydney. Pearson R. B., Mitchelhill K. I. and Kemp B. E. (1993) Studies of protein kinase/phosphatase specificity using synthetic peptides. In Protein Phosphorylation—A Practical Approach (ed. D. G. Hardie), pp. 265–280. IRL/Oxford University Press, Oxford. Pin J.-P. and Duvoisin R. (1995) Review: neurotransmitters I. The metabotropic glutamate receptors: structure and functions. Neuropharmacology 34, 1–26. Pin J.-P., Waeber C., Prezeau L., Bockaert J. and Heinemann S. F. (1992) Alternative splicing generates metabotropic glutamate receptors inducing different patterns of calcium release in Xenopus oocytes. Proc. natn. Acad. Sci. U.S.A. 89, 10,331–10,335. Salt T. E. and Eaton S. A. (1994) The function of metabotropic excitatory amino acid receptors in synaptic transmission in the thalamus: studies with novel phenylglycine antagonists. Neurochem. Int. 24, 451–458. Salt T. E. and Eaton S. A. (1995) Modulation of sensory neurone excitatory and inhibitory responses in the ventrobasal thalamus by activation of metabotropic excitatory amino acid receptors. Neuropharmacology 34, 1043–1051. Saugstad J. A., Kinzie J. M., Mulvihill E. R., Segerson T. P. and Westbrook G. L. (1994) Cloning and expression of a new member of the L-2-amino-4-phosphonobutyric acid-sensitive class of metabotropic glutamate receptors. Molec. Pharmac. 45, 367–372. Saugstad J. A., Kinzie J. M., Shinohara M. M., Segerson T. P. and Westbrook G. L. (1997) Cloning and expression of rat metabotropic glutamate receptor 8 reveals a distinct pharmacological profile. Molec. Pharmac. 51, 119–125. Shigemoto R., Abe T., Nomura S., Nakanishi S. and Hirano T. (1994) Antibodies inactivating mGluR1 metabotropic glutamate receptor block long-term depression in cultured Purkinje cells. Neuron 12, 1245–1255. Shigemoto R., Kulik A., Roberts J. D. B., Ohishi H., Nusser Z., Kaneko T. and Somogyi P. (1996) Target-cell-specific concentration of a metabotropic glutamate receptor in the presynaptic active zone. Nature 381, 523–525. Shigemoto R., Nakanishi S. and Mizuno N. (1992) Distribution of the mRNA for a metabotropic glutamate receptor (mGluR1) in the central nervous system: an in situ hybridization study in adult and developing rat. J. comp. Neurol. 322, 121–135. Sommer B., Keina¨nen K., Verdoorn T. A., Wisden W., Burnashev N., Herb A., Ko¨hler M., Takagi T., Sakmann B. and Seeburg P. H. (1990) Flip and flop: a cell-specific functional switch in glutamate-operated channels of the CNS. Science 249, 1580–1585. Stephan D., Bon C., Holzwarth J. A., Galvan M. and Pruss R. M. (1996) Human metabotropic glutamate receptor 1: mRNA distribution, chromosomal localization and functional expression of two splice variants. Neuropharmacology 35, 1649–1660. Tanabe Y., Masu M., Ishii T., Shigemoto R. and Nakanishi S. (1992) A family of metabotropic glutamate receptors. Neuron 8, 169–179. Testa C. M., Standaert D. G., Young A. B. and Penney J. B. (1994) Metabotropic glutamate receptor mRNA expression in the basal ganglia of the rat. J. Neurosci. 14, 3005–3018. Vidnya´nszky Z., Go¨rcs T. J., Ne´gyessy L., Borostya´nko˜i Z., Kuhn R., Kno¨pfel T. and Ha´mori J. (1996) Immunocytochemical visualization of the mGluR1a metabotropic glutamate receptor at synapses of corticothalamic terminals originating from Area 17 of the rat. Eur. J. Neurosci. 8, 1061–1071. Wisden W. and Morris B. J. (1994) In situ hybridization with synthetic oligonucleotide probes. In In Situ Hybridization Protocols for the Brain (eds Wisden W. and Morris B. J.), pp. 9–34. Academic, London. (Accepted 9 December 1997)
PII:
Neuroscience Vol. 85, No. 3, pp. 733–749, 1998 Copyright 1998 IBRO. Published by Elsevier Science Ltd Printed in Great Britain. All rights reserved 0306–4522/98 $19.00+0.00 S0306-4522(97)00670-2
DIFFERENTIAL EXPRESSION OF RAT AND HUMAN TYPE 1 METABOTROPIC GLUTAMATE RECEPTOR SPLICE VARIANT MESSENGER RNAS A. BERTHELE,†§0 D. J. LAURIE,*0 S. PLATZER,† W. ZIEGLGA } NSBERGER,† T. R. TO } LLE†§ and B. SOMMER*‡ *NOVARTIS Pharma AG, CH-4002 Basle, Switzerland †Max-Planck Institute of Psychiatry, Munich, Germany Abstract––The type I metabotropic glutamate receptor (mGlu1) messenger RNA and protein are known to be widely expressed in rat brain, but knowledge of the regional expression of splice variants other than mGlu1a is limited. Probes were designed for in situ hybridization that specifically recognize each of the carboxy-terminal splice variants mGlu1a, -1b, -1c and -1d. The novel rat mGlu1d sequence was obtained by polymerase chain reaction and the predicted protein is highly homologous to the human sequence but contains both conservative and radical substitutions and is slightly longer (912 vs 908 amino acids). Each rat mGlu1 splice variant messenger RNA was found in a unique expression pattern. The messenger RNA encoding mGlu1a was abundant in cerebellar Purkinje cells and in mitral and tufted cells of the olfactory bulb. Strong expression was also detected in hippocampal interneurons, and neurons of the thalamus and substantia nigra, while moderate expression was found in colliculi and cerebellar granule cells. The mGlu1b messenger RNA was strongly expressed in Purkinje cells, hippocampal pyramidal neurons, dentate gyrus granule cells and lateral septum, and moderately expressed in striatal, superficial cortical and cerebellar granule neurons. The mGlu1d messenger RNA was expressed in all regions where mGlu1a and -1b were detected; abundant in Purkinje cells, mitral and tufted cells, and hippocampal principal neurons and interneurons, strong in thalamus and substantia nigra, and moderate in lateral septum, cortex, striatum and colliculi. Human mGlu1 splice variant expression in the cerebellum matched that found for the rat. No specific signal was found with a probe capable of hybridizing to the rat mGlu1c splice junction, although another probe designed against a more 3 sequence of mGlu1c gave strong signals in the cerebellum and hippocampus, and moderate signals in thalamus and colliculi. It is concluded that mGlu1d messenger RNA is widely expressed, that mGlu1a and -1b messenger RNAs are expressed in almost complementary patterns and that formation of the mGlu1c splice junction is a rare event. 1998 IBRO. Published by Elsevier Science Ltd. Key words: in situ hybridization, metabotropic glutamate receptor type I, splice variants, rat, human.
The metabotropic glutamate (mGlu) receptors belong to a distinct family of G-protein-coupled receptors of the CNS that includes the calciumsensing and GABAB receptors.17,31 To date, eight related mGlu sequences have been identified (mGlu1 to -8) and assigned to three groups according to their sequence similarities, pharmacological preferences and second messenger coupling.31 Group I comprises mGlu1 and mGlu5 receptors, Group II contains the mGlu2 and mGlu3 receptors, and Group III consists of the mGlu4, -6, -7 and -8 receptors. Each receptor mRNA is expressed in a unique and distinct pattern ‡To whom correspondence should be addressed. §Present address: Department of Neurology, Technical University, Munich, Germany 0These authors contributed equally to this work. Abbreviations: DTT, dithiothreitol; IP3, inositol trisphosphate; IR, immunoreactivity; ISH, in situ hybridization; LTD, long-term depression; LTP, long-term potentiation; mGlu, metabotropic glutamate; OB, olfactory bulb; RT– PCR, reverse transcription–PCR; SSC, standard saline citrate; TdT, terminal deoxynucleotidyl transferase.
in the rat brain,7,28,35,36,43 except mGlu6 which is restricted to the retina.26 The rat mGlu1 receptor has previously been found in three carboxy terminal splice variant forms; mGlu1a (or -1á), mGlu1b (or -1â) and mGlu1c (1199, 906 and 897 amino acids, respectively).15,24,32,42 Relative to the coding sequence of mGlu1a, mGlu1b possesses an additional 85 base pair exon, inserted between bases 2660 and 2661,42 whereas mGlu1c is formed by the splicing of a unique sequence to the same splice junction.32 Both mGlu1b and -1c exons contain in-frame termination codons resulting in shorter receptors, and encode novel carboxy terminal sequences of 20 and 10 amino acids, respectively. The human homologues hmGlu1a and hmGlu1b have recently been cloned.9,41 An additional human splice variant, hmGlu1d, lacks 35 base pairs immediately after the common splice junction, relative to hmGlu1a. This deletion induces a shift of the reading frame, a novel carboxy terminal sequence and termination after 908 amino acids.19 Gene deletion experiments have shown that the mouse mGlu1 receptor is fundamental in motor
733
734
A. Berthele et al.
co-ordination and cerebellar long-term depression (LTD) at the parallel fibre/Purkinje cell synapse.1,2,8 It may also have a central role in long-term potentiation (LTP) in the hippocampus and spatial memory.1,2,4,8 Since in these procedures all mGlu1 splice variants were simultaneously deleted, it is as yet uncertain if each, or only specific, mGlu1 splice variants are involved in such LTD and LTP. Examination of the regional expression of each mGlu1 splice variant mRNA and protein will assist determination of their functional roles. The mRNAs encoding alternative splice forms of ionotropic glutamate receptors are differentially distributed,18,21,40 implying regional heterogeneity of function. Heterogenous distribution of mGlu1 splice variants is supported by reverse transcription– polymerase chain reaction (RT–PCR) and western analysis of mGlu1a and -1b,6,10,25 but spatial resolution by such methods is limited. Regional and subcellular localization by immunohistochemistry have as yet been performed thoroughly only on rat mGlu1a,3,22,23 due to difficulties in raising specific antibodies for the other splice variants.13,14 Previous in situ hybridization (ISH) studies on rat brain, although identifying the individual expression profile of mGlu1c mRNA,32 have not resolved the regional expression of mGlu1a, -1b and -1d mRNAs due to the use of non-discriminating probes.7,10,24,32,39,43 This study therefore examines the regional expression of the individual mGlu1 splice variant mRNAs in rat and human brain. A preliminary account of these findings has been presented in abstract form.20 EXPERIMENTAL PROCEDURES
Cloning of rat and human sequences In order to confirm the existence of rat mGlu1d, and to obtain cDNA for specificity testing (see below), sequences encoding the rat mGlu1 splice junctions were amplified from rat whole brain cDNA using primer DL198 (5 CTGGGATCCATGTTTACTCCGAAGATGTAC-3 ) and the antisense primer 5 -ATTAAGCTTCACGTGCACAGA GAGGCGCTG-3 . (Artificial BamHI and HindIII sites are italicized). The thermocycling conditions were 1 min at 94C, 1 min at 60C, 1 min at 72C, 38 cycles. The PCR products (300 base pairs) were ligated into the HindIII and BamHI sites of pBluescript, sequenced and identified as fragments of the rat mGlu1a and -1b splice variants,42 and the rat homologue of human mGlu1d (Fig. 1a). Sequential PCR as described above was also performed on rat brain cDNA in an attempt to isolate the rat mGlu1c sequence32 using the specific primers 5 -CAACTACAAGATCATCA CTACCTGC-3 and 5 -GGTCTGCATCTCAGGTGCA TTTC-3 in the first round, followed by primers DL198 and 5 -GGTAAGCTTCTCAGGTGCATTTCACTTCAA-3 in the second round, where 0.1 µl of the first round reaction was used as template. (An artificial HindIII site is italicized). No PCR product homologous to the rat mGlu1c sequence was obtained. The sequences encoding the human hmGlu1a, -1b and -1d splice variants have already been described.9,19,41 In an attempt to obtain sequence encoding the human homologue of the rat mGlu1c variant, sequential PCR was performed on a human hippocampal cDNA library in pBluescript (Stratagene) using as antisense primer in both rounds the
degenerate primer 5 -CGCGGATCCTCAATAGACAGT GTTTTGGCGGTCTA(GA)(GA)GC(GA)AA(GA)TT-3 . (The nucleotides complementary to the termination codon of rat mGlu1c are in bold text, and an artificial BamHI site is italicized). In the first round the sense primer 5 CATGTACACCACCTGTATCATCTG-3 was used, and in the second round the nested sense primer DL198 (see above). The first round thermocycling conditions were; 94C for 1 min, 45C for 1 min, 72C for 2 min, 10 cycles, then 94C for 1 min, 55C for 1 min and 72C for 2 min, 20 cycles. The second round used 0.1 µl of the first round as template under conditions of 94C for 1 min, 55C for 1 min, 72C for 2 min, 38 cycles. No sequence homologous to rat mGlu1c was obtained by this method, or by PCR using the above sense primers with external pBluescript sequencing primers, or by screening ë-phage libraries of human hippocampal, retinal or whole brain cDNAs (Stratagene and Clontech). In situ hybridization In situ hybridization was performed on rat and human brain sections based on the method of Wisden and Morris.45 An antisense oligonucleotide probe (rmGlu1pan, 5 -AA GGCACTGCGGACGTTCCTCTCAGGTTTGGCAATG ATGA-3 (40-mer)) was designed against a common sequence, upstream of the splice junction15,24 in order to hybridize to all mGlu1 splice variant mRNAs simultaneously. A similar probe (hmGlu1pan, 5 -AAGGCA C TGCGGACATTCCTCTCAGGCTTGGCAATAATGA3 (40-mer)) was designed against a common human mGlu1 sequence.9,19 Splice variant-specific probes (40-mers) were designed from the rat mGlu1 sequences,32,42 (rat mGlu1d, this study) (rmGlu1a, 5 -TGACACAGACTTGCCGTTA GAA-TTGGCATTCCCTGCCCCG-3 ; rmGlu1b, 5 -CGA GAATTCTGGCTGCCTCTTC-TTGGCATTCCCTGCC CCG-3 ; rmGlu1c, 5 -GTTTTGGCGGTCTAAAGCAA AA-TTGGCATTCCCTGCCCCG-3 ; rmGlu1d, 5 -CCCT TGGGCGCCTGTCTTCCAC-TTGGCATTCCCTGCCC CG-3 ), and human mGlu1 sequences9,19 (hmGlu1a, 5 TGACACAGACTTGCCATTAGAA-TTGGCATTCCCT GCCCCT-3 ; hmGlu1b, 5 -CGAGAATTCTGGCTGCC TCTTC-TTGGCATTCCCTGCCCCT-3 ; hmGlu1d, 5 CCCTTGGGCACCTGTCCTCCAC-TTGGCATTCCCT GCCCCT-3 ). These probes straddle the splice junction (-) of each splice variant. Two additional 40-mer probes were synthesized which recognize sequences of the unique rat mGlu1b and mGlu1c exons (rmGlu1bx, 5 -GTTTTCAA AGCTGCGCATGTGCCGACGGACACTGGCTGCT-3 ; rmGlu1cx 5 - GGTCTGCATCTCAGGTGCATTTCACT TCAATAGACAGTGT-3 , respectively). Rat brains (n=5) were excised from adult female Wistar rats (Charles River) with an average body weight of 280 g and immediately frozen on dry ice. Human brain tissues (n=4) were obtained at autopsy from consenting patients with no history of neurological or psychiatric disease (age 48–81 years, mean 63 years; two females, two males). After a post mortem interval of 12–18 h, tissues were removed and rapidly frozen on dry ice. Sections (14 µm) of rat whole brain and human brain regions were cut on a cryotome, mounted on polylysine-coated slides and fixed in 4% paraformaldehyde. Hybridization was performed without further tissue pretreatment. All probes were radiolabelled using á-[35S]dATP (Amersham) and terminal deoxynucleotidyl transferase (TdT; Boehringer Mannheim) to a specific activity of approximately 5107 c.p.m./pmol. The labelled probes were diluted in hybridization buffer (50% formamide, 4standard saline citrate (SSC), 5Denhardt’s solution, 10% dextran sulphate, dithiothreitol (DTT)45) to a final concentration of 0.06 pmol/ml and hybridized at 42C to the rat and human brain sections. In preliminary studies it was found that the optimum conditions for human sections involved a 48 h incubation period and 50 mM DTT rather than the overnight incubation and 10 mM DTT used
In situ hybridization on mGlu1 splice variant mRNAs for the rat sections. After incubation, the sections were washed (1SSC, 55C, 30 min), dried through ethanol (70–95%) and exposed to autoradiographic film (Kodak Biomax) for four weeks or dipped in photographic emulsion (Kodak NTB2) and exposed for three months. Non-specific hybridization was determined by the coincubation in control experiments of 50-fold excess of unlabelled probe. Identification of structures in Cresyl Violet-stained sections was performed with the aid of a rat brain atlas.29
735
sequence (908 amino acids), the deduced rat sequence contains a few conservative (e.g., Arg to Lys) and more radical (e.g., Tyr to Arg) substitutions, and the termination codon is at a more distant position predicting a longer protein (912 amino acids) (Fig. 1A). These differences indicate two potential protein kinase C and cAMP/cGMP kinase phosphorylation sites30 in the rat sequence and one in the human (Fig. 1A).
Probe specificity The specificity and efficacy of the rat splice variantspecific ISH probes were examined by hybridization to pBluescript clones encoding the rat mGlu1a, -1b, -1d (see above) and -1c splice junctions. The unique sequence for rat mGlu1c was artificially constructed from two sense oligonucleotides and two complementary antisense oligonucleotides which, when hybridized, would produce the rat mGlu1c splice junction with 3 -overhangs complementary to the KpnI and SacI sites of pBluescript. The two sequential sense oligonucleotides were 5 -CGGGGCAGGGAATGCCA ATTTTGCTTTAGACCGCCAAAACACTGTCTATT-3 and 5 -GAAGTGAAATGCACCTGAGATGCAGACCA AGCT-3 (the termination codon is in bold text and the overhang complementary to SacI is italicized). The two sequential antisense oligonucleotides were 5 -TGGTCT GCATCTCAGGTGCATTTCACTTCAATAGACAGTG TTTTGGCGGT-3 and 5 -CTAAAGCAAAATTGGCAT TCCCTGCCCCGGTAC-3 (the bases complementary to the termination codon are in bold text and the overhang complementary to KpnI is italicized). These oligonucleotides (400 pmol of each) were 5 -phosphorylated using T4 polynucleotide kinase (Boehringer Mannheim) and ATP (10 mM), heated at 94C for 10 min and allowed to cool and anneal slowly over 2 h. The annealled oligonucleotides were then ligated together and into the SacI and KpnI sites of pBluescript. Sequencing confirmed the construction of a sequence encoding the region around the rat mGlu1c splice junction32 (bases 2642–2722). The pBluescript clones (10ng each) encoding the rat mGlu1a, -1b, -1c and -1d splice junction sequences were dotted onto nitrocellulose membrane, denatured with alkali and immobilized by drying. The ISH probes were 5 radiolabelled using [ã-32P]dCTP (Amersham) and T4 polynucleotide kinase (Boehringer Mannheim). In additional experiments, before 5 -radiolabelling, the rmGlu1d probe was 3 -tailed with non-radioactive dATP using TdT (Boehringer Mannheim) in conditions corresponding to the [35S]dATP labelling of the ISH oligos. Hybridization to immobilized cDNAs, and subsequent washing conditions were performed as for the brain sections. The blots were exposed to autoradiography film (Kodak XOmat AR) overnight and developed.
Probe specificity In situ hybridization was performed on the rat and human mGlu1 mRNAs. In horizontal sections of rat brain (Fig. 2), a probe simultaneously recognizing all carboxy terminal splice variants (rmGlu1pan) showed a widespread expression of this mRNA type with prominent expression in cerebellum, hippocampus, thalamus and olfactory bulb. White matter tracts were not labelled by this or any other probe. Similar results were obtained with another probe designed against a sequence upstream of the first transmembrane domain (data not shown). Expression of individual mGlu1 splice variants was examined using oligonucleotides that straddle the 3 -splice junction. Specificity of the rat probes was confirmed by hybridization to constructs containing the splice junction sequences of each variant. The pan probe hybridized to all constructs except the artificial rat mGlu1c construct, which lacked the appropriate sequence (Fig. 1B). Each of the other probes hybridized strongly to the construct against which it was designed (Fig. 1B). Only probe rmGlu1d showed some weak cross-hybridization to the rat mGlu1a and mGlu1b sequences, but this was even further reduced when the oligo was 3 -tailed with poly-dATP to mimic the experimental conditions used for hybridization to the brain sections (Fig. 1B). Specificity of each splice-specific probe was also examined on rat brain sections by co-incubation with a 50-fold excess of either the same, unlabelled probe or an excess of the other unlabelled probes in combination (Fig. 3). Whereas excess of each matching probe completely prevented specific hybridization, a concentrated cocktail of related but non-identical probes had only marginal effects on each ISH signal.
RESULTS
The coding sequences around the common splice junction were amplified from rat whole brain cDNA by PCR. By this method three amplicons (366, 281 and 246 base pairs) were simultaneously amplified, the first two of which were confirmed by sequencing as rat mGlu1b and -1a, respectively.15,24,42 The third sequence (Fig. 1A) lacked 35 bases (bases 2660–2695) of the rat mGlu1a sequence,24 analogous to the published human hmGlu1d sequence.19 This 35 base pair deletion results in a shift of the reading frame and the introduction of an alternative termination codon. Compared to the human mGlu1d
mGlu1a receptor messenger RNA Using a splice-specific probe it was apparent that mGlu1a mRNA was abundant in cerebellum and olfactory bulb (Figs 2, 3). Microscopic examination revealed intense signals over Purkinje cells (Fig. 5) and over mitral neurons of the olfactory bulb (OB) (Fig. 6). Strongly-labelled tufted cells were found throughout the OB external plexiform layer (Fig. 6). The mGlu1a mRNA was moderately expressed in cerebellar granule cells, putative stellate/basket cells and OB periglomerular cells, and weakly expressed in OB granule cells (Figs 2, 3, 5, 6) and cerebellar deep
736
A. Berthele et al.
Fig. 1. (A) Comparison of the 3 -ends and carboxy termini of human and rat mGlu1d. Human sequence from Laurie et al.19 Sequences begin at base 2653 and amino acid 885. The arrow indicates the splice junction (-). Differences between the coding sequences are given above and below the line while resultant amino acid changes are highlighted as bold italics. Termination of translation is indicated by asterisks. Potential sites for phosphorylation by protein kinase C or cGMP-dependent protein kinase30 are indicated by ~. (B) Assessment of ISH probe specificities. 32P-labelled oligonucleotide probes were hybridized to cDNA constructs dotted onto nitrocellulose membrane and exposed to film. (a, b, c and d) indicate probes spanning the splice junctions of rat mGlu1a, -1b, -1c and -1d, respectively. (cx) indicates the probe rmGlu1cx, designed against a unique sequence of rat mGlu1c downstream from the splice junction. (d-A) indicates hybridization with the 3 -polyadenylated rmGlu1d probe. (pan) indicates a probe recognizing a common mGlu1 sequence upstream of the splice junctions.
nuclei (not shown). Strong expression was noted in the substantia nigra, pars compacta and reticulata, and in almost all nuclei of the thalamus, except the reticular nucleus and habenula (Figs 2, 7). Moderate expression was detected in colliculi and central gray (Fig. 2), the medial septum and globus pallidus (not shown). Punctate signals in the hippocampal CA1 stratum oriens and the hilus of the dentate gyrus were found to be labelled non-principal neurons, presum-
ably interneurons (Figs 2, 8). In the cerebral cortex some neurons in layers IV and V were moderately labelled, while the striatum and lateral septum gave no ISH signal (Fig. 2). The granule cell layer of the cerebellum often gave a strong signal on autoradiographic film for the mGlu1pan and splice variant-specific probes (Figs 2, 9). Shorter exposure times (Fig. 3) and photomicrography (Figs 5, 10) indicate that the
In situ hybridization on mGlu1 splice variant mRNAs
Fig. 2. X-Ray film autoradiographs depicting the in situ hybridization of mGlu1 splice-specific probes to horizontal sections of rat brain. (A) pan probe (all splice variants); (B–D) probes specific for mGlu1a, -1b and -1d, respectively. Abbreviations: Cb, cerebellum; CG, central gray; Co, colliculi; Cx, cerebral cortex; hb, habenula; Hc, hippocampus; hi, hilus of dentate gyrus; LS, lateral septum; m, mitral cell layer; OB, olfactory bulb; rn, reticular nucleus of thalamus; Str, striatum; Th, thalamus. Scale bar=3 mm.
737
738
A. Berthele et al.
Fig. 3. Assessment of ISH probe specificities on sections of rat brain by X-ray film autoradiography. (A, D and G) ISH of radiolabelled mGlu1a, -1b and -1d probes to olfactory bulb, hippocampus and cerebellum, respectively. (B, E and H) as for A, D and G, respectively, but with co-incubation of 50-fold excess of unlabelled non-matching probes (e.g., [35S]rmGlu1a+rmGlu1b (50)+rmGlu1d (50)). (C, F and I) as for A, D and G, respectively, but with co-incubation of 50-fold excess of unlabelled matching probe (e.g., [35S]rmGlu1a+rmGlu1a (50)). Abbreviations: dg, dentate gyrus; hpc, hippocampal pyramidal cell layer; m, mitral cell layer; pcl, Purkinje cell layer. Scale bars=1 mm.
strength of this signal on film was due to moderate signals from densely packed granule cells. This was also observed in a previous ISH study on mGlu1 mRNA.39
mGlu1b receptor messenger RNA The mGlu1b mRNA was abundantly expressed in dentate gyrus granule cells and hippocampal
In situ hybridization on mGlu1 splice variant mRNAs
pyramidal cells, especially of region CA3 (Figs 2, 3, 8). Strong expression was also detected in the lateral septum and cerebellar Purkinje cells (Figs 2, 5). Moderate to strong signals were noted in striatum, in cerebellar and OB granule cells, and in superficial (II) and deep (V/VI) layers of the cerebral cortex (Figs 2, 5, 6). Weak labelling was detected in cerebellar stellate/basket cells, in OB periglomerular cells and central grey (Figs 2, 6). Mitral and tufted cells of the OB, hippocampal interneurons, stellate/basket neurons, and neurons of the substantia nigra were not notably labelled (Figs 6–8). This expression profile of mGlu1b mRNA was obtained with both probe rmGlu1b that straddles the splice junction and a second probe, rmGlu1bx, designed against the unique mGlu1b exon (data not shown). mGlu1c receptor messenger RNA Both probe rmGlu1c, designed to straddle the splice junction of rat mGlu1c, and probe rmGlu1cx, designed against the unique exon sequence of rat mGlu1c downstream from the splice junction, hybridized strongly to the artificial mGlu1c construct dotted onto nitrocellulose membrane (Fig. 1b). However, on rat brain sections probe rmGlu1c unexpectedly gave no signal above that of the competition control (Fig. 4). This was confirmed by repeating the experiment with a second, identical probe synthesized separately. In contrast, probe rmGlu1cx hybridized strongly to cerebellar Purkinje and granule cells, and principal neurons of the dentate gyrus and hippocampus (especially CA3). Moderate signals were obtained throughout the thalamus and colliculi, and weak signals in OB granule cells (Fig. 4). mGlu1d receptor messenger RNA The hybridization pattern of the mGlu1d probe indicated abundant mRNA expression in Purkinje cells, dentate gyrus granule cells, hippocampal pyramidal cells (especially of region CA3) and mitral and tufted cells of the olfactory bulb (Figs 2, 3, 5, 6, 8). Neurons of the substantia nigra and thalamus (except the reticular nucleus and lateral habenula) were strongly labelled (Figs 2, 7), as were some OB periglomerular cells (Figs 2, 6). This splice variant was also strongly detected in presumed interneurons of the hippocampal CA1 stratum oriens and dentate gyrus hilar region (Fig. 8). Moderate labelling was noted in granule and stellate/basket cells of the cerebellum, and OB granule cells (Figs 2, 3, 5, 6). Slightly weaker signals were observed in lateral septum, striatum, cortical layers II and IV–VI, and the central gray (Fig. 2). In situ hybridization was performed similarly on sections of human cerebellum. Cerebellar expression patterns of the total hmGlu1 mRNA population and the individual hmGlu1a, -1b and -1d splice variant mRNAs (Figs 9, 10) were comparable to those of the
739
corresponding rat homologues (Figs 2, 3, 5). Strong signals were noted in all cerebellar cell types with the hmGlu1pan probe. Strong signals from Purkinje and stellate/basket cells were noted for the hmGlu1a and -1d variants, whereas the hmGlu1b mRNA was less strongly detected in these cell types (Figs 9, 10). Moderate expression of all splice variants was noted in the granule cells. DISCUSSION
Sequences encoding a fourth splice variant, mGlu1d, of the type I metabotropic glutamate receptor have been cloned from human19 and now rat cDNAs (Fig. 1A). Both lack 35 base pairs of the mGlu1a 3 coding sequence, resulting in a shift of the reading frame and the introduction of an alternative termination codon. Downstream of the splice junction the rat and human sequences show high identity, but notable features of the rat clone include its greater length (912 vs 908 amino acids) and the presence of an additional kinase consensus site (Fig. 1A), which may affect its function or regulation. Previous RT–PCR analysis on rat brain cDNAs did not detect the short mGlu1d splice variant.14,25 This may be due to the small size difference (35 base pairs) from the mGlu1a variant, the difficulty in quantitatively detecting small amplicons on ethidium bromide-stained gels, or to the use of a PCR primer hybridizing to the splice junction.25 However, the presence of a homologous splice variant in both rat and human (Fig. 1A) confirms its existence. Previous ISH studies on the rat mGlu1 mRNA distribution7,10,11,24,32,39,43 did not discriminate between mGlu1a and -1b mRNAs since probes were designed against sequences common to both splice variants. Such probes gave ISH results matching the present data obtained using the non-discriminating (see Fig. 1B) rmGlu1pan probe (Fig. 2), and concur with results from northern analyses.15,24 The hybridization patterns obtained with the mGlu1pan probe were highly similar in rat and human cerebellum (Figs 9, 10), in agreement with the similarity between human and rat mGlu1 mRNA distributions assessed by northern blotting.41 The use of ISH probes that straddle the splice junction allows discrimination between related mRNA splice variants.18 The specificity of the splice variant probes was proven in both a defined cDNA assay (Fig. 1B) and in the ISH procedure on sections (Fig. 3), showing that more than half of the nucleotides in each 40-mer probe must find a complementary match to form a stable hybrid. The 3 -polyadenosine tail reduces the degree of complementarity, thereby reducing the stability of the hybrids and further increasing stringency18 (Fig. 1B). ISH with splice-specific oligonucleotide probes reveals for the first time that the mRNAs encoding the mGlu1a and -1b mRNAs are expressed in almost complementary patterns in the forebrain, while
740
A. Berthele et al.
Fig. 4. X-Ray film autoradiographs depicting the ISH of mGlu1c probes to horizontal sections of rat brain. (A, B) probe rmGlu1c, designed against the rat mGlu1c splice junction. (C, D) probe rmGlu1cx, designed against the unique downstream exon. Upper panel A and C of each pair shows the total ISH signal, while lower panel B and D shows the signal in presence of 50-fold excess of unlabelled matching probe. Abbreviation: IC, inferior colliculus; others as for Fig. 2. Scale bar=3 mm.
mGlu1d mRNA co-localizes with both mGlu1a and -1b (Fig. 2). Surprisingly, no specific ISH signal was obtained in the rat brain for the mGlu1c splice junction (Fig. 4), although the ability of the probe to recognize the appropriate sequence was confirmed in dot-blot experiments (Fig. 1b). The sequence downstream of the splice junction was, however, detected in both dot-blot and ISH procedures (Figs 1B, 4), revealing a distribution matching that found with a similarly designed probe.32 We found no mGlu1c clone using library screening or by PCR using specific or degenerate primers. Northern blotting has
revealed no transcript of the expected size for human mGlu1c41 and, although a mGlu1c antibody immunostained Purkinje cells,13 immunoblotting produced only a ‘‘virtually undetectable’’ signal.6 It is therefore concluded that, although the unique mGlu1c sequence downstream of the splice junction is transcribed32 (Fig. 4), splicing of the mGlu1 mRNA to form the mGlu1c clone must be a rare event. In agreement with the present ISH results, analysis of mGlu1a and -1b distribution by RT–PCR14,25 reveals high expression of mGlu1a mRNA in extracts of cerebellum, olfactory bulb and thalamus,
Fig. 5. Photomicrographs of rat cerebellum depicting the ISH of mGlu1 splice-specific probes. Panels as in Fig. 2. Abbreviations; gcl, granule cell layer; ml, molecular layer. Single arrows, putative stellate/basket cells; double arrows, Purkinje cells. Scale bar=15 µm.
In situ hybridization on mGlu1 splice variant mRNAs 741
Fig. 6.
In situ hybridization on mGlu1 splice variant mRNAs
743
Fig. 7. Photomicrographs of rat substantia nigra depicting the ISH of mGlu1 splice-specific probes. Panels as in Fig. 2. Abbreviations; SNC, pars compacta; SNR, pars reticulata. Dotted line delineates boundary between SNC and SNR. Scale bar=100 µm.
and shows much mGlu1b mRNA in hippocampus. Immunoblotting and immunohistochemical studies indicate a similar distribution of the 150,000 mol. wt mGlu1a protein.3,6,10,13,14,23 Immunoblotting for the amino terminus of mGlu1 indicates a 95,000 mol. wt protein in rat cortex, striatum, hippocampus and cerebellum, which was assumed to be mGlu1b.10,39 In hippocampus however, specific mGlu1b antibodies detect a presumptive 190,000 mol. wt dimer but no 95,000 mol. wt protein.6,14 The hippocampal 95,000 mol. wt mGlu1 protein may represent mGlu1d since the mRNA is present (Figs 2, 8) and it is of similar size (912 amino acids) (Fig. 1A) to mGlu1b (906 amino acids). From past and present data the cerebellum, thalamus, olfactory bulb and hippocampus stand out as four structures with pronounced differences in mGlu1 splice variant expression.
Cerebellum The cerebellar expression profiles of the human mGlu1 splice variant mRNAs (Figs 9, 10) closely resembled those found in the rat (Figs 2, 3, 5), implying similar roles in the two species. In rat and human Purkinje and stellate/basket cells, mRNAs encoding the mGlu1a and -1d variants were abundant whereas mGlu1b mRNA was more weakly detected (Figs 2, 3, 5, 9, 10). These results concur with an abundance of mGlu1 and mGlu1a immunoreactivity (IR) and weaker mGlu1b-IR in stellate/basket cells and Purkinje cell somata and dendrites.3,10,13,14,23,37 The Purkinje cell mGlu1 receptors are important in cerebellar function since blockade of the receptor by a specific antibody,37 or absence of the receptor in mGlu1 / mice2,8 impairs Purkinje cell LTD and
Fig. 6. Photomicrographs of rat olfactory bulb depicting the ISH of mGlu1 splice-specific probes. (A, B) hybridization with probe rmGlu1pan. (C, D) hybridization with probe rmGlu1a. (E, F) hybridization with probe rmGlu1b. (G, H) hybridization with probe rmGlu1d. Abbreviations; epl, external plexiform layer; glo, glomerular layer; gcl, granule cell layer. Single arrows, tufted cells, double arrows; mitral cells. Scale bar=30 µm.
Fig. 8.
In situ hybridization on mGlu1 splice variant mRNAs
745
Fig. 9. X-Ray film autoradiographs depicting the ISH of mGlu1 splice-specific probes to sections of human cerebellum. (A) Pan probe (all splice variants); (B–D) probes specific for hmGlu1a, -1b and -1d, respectively. Abbreviations; ml, molecular layer; pcl, Purkinje cell layer; gcl, granule cell layer. Scale bar=1 mm.
severely affects motor co-ordination. The mGlu1 / mice also show a high incidence of polyinnervation of Purkinje cells by climbing fibres, contrasting with the normal feature of virtual monoinnervation.16 The present ISH results indicate that both the mGlu1a and -1d receptors may be abundant in Purkinje and stellate/basket cells (Figs 2,
3, 5, 9, 10) and may therefore contribute to Purkinje cell LTD and/or the regulation of climbing fibre innervation. The mGlu1 mRNA in granule cells of rat and human cerebellum7,10,24,39,43 (Figs 2, 9), is inferred from the present data to comprise mGlu1a, -1b and -1d approximately equally (Figs 2, 3, 5, 9, 10).
Fig. 8. Photomicrographs of rat hippocampus depicting the ISH of mGlu1 splice-specific probes. Panels as in Fig. 6. Left column, dark-field. Right column, bright-field. Abbreviations; dg, dentate gyrus; gcl, granule cell layer; CA3/4, hippocampal pyramidal cell layer of region CA3/4. Arrows indicate non-principal cells, presumably interneurons. Scale bars=100 µm (left), 15 µm (right).
A. Berthele et al.
Fig. 10.
746
In situ hybridization on mGlu1 splice variant mRNAs
IR for the mGlu1 amino terminus and the mGlu1a and -1b carboxy termini has been reported by some as weak or undetectable in granule cell somata and nerve terminals.3,13,14,23,37 Others, however, have described mGlu1- and mGlu1a-IR as ranging from absent to strong depending in the cerebellar folia examined.3,10 These results suggest that the mGlu1a and -1b proteins in granule cells are not translated from the mRNA, are rapidly degraded, or are detected only in certain regions or under particular experimental conditions. Future experiments will determine if the mGlu1d protein can be detected in cerebellar granule cells. Thalamus In horizontal sections of the rat thalamus mGlu1a and -1d mRNAs are about equally expressed in all nuclei except the reticular thalamus and the habenula (Fig. 2). IR for both short and long mGlu1 variants has been detected in the thalamus in a similar distribution.3,10 In contrast mGlu1b mRNA is absent from the entire thalamus (Fig. 2). Splice variant specific IR has been determined only for the mGlu1a receptor and is localized postsynaptically on thalamic neurons receiving stimulatory input from corticothalamic projections.3,23,44 Excitatory postsynaptic Class I mGlu receptors have also been functionally detected on neurons of the rat ventrobasal thalamus responding to nociceptive stimuli and mGlu receptor agonists.33,34 Whether these are accounted for by mGlu1a or -1d receptors needs to be determined. Olfactory bulb In the rat olfactory bulb the splice variant mRNAs encoding mGlu1a and -1d are abundantly expressed in mitral and tufted neurons (Figs 2, 3, 6). This correlates well with the intense mGlu1 and mGlu1a-specific IR in olfactory glomeruli10,23 where the olfactory nerves synapse onto the primary dendrites of mitral and tufted cells. The mGlu1 receptors are therefore involved in olfaction at the point of primary sensory input. Granule cells express moderate amounts of all three splice variant mRNAs (Figs 2, 3, 6). IR for the mGlu1 amino terminus and mGlu1a carboxy terminus is weak in the granule cell layer but strong in the external plexiform layer.3,10,23 Thus, mGlu1 receptors may exist on both faces of the dendrodendritic synapses formed between mitral and granule cells in the external plexiform layer. Hippocampus In the stratum oriens of hippocampal region CA1 and the hilus of the dentate gyrus mGlu1a mRNA
747
was located only in non-principal cells, presumably interneurons (Figs 2, 8). IR for mGlu1a and the mGlu1 amino terminus has been confirmed on somata and dendrites of somatostatin-positive rat hippocampal interneurons in the above areas and in several layers of CA3.3,14,22,23 The mRNA encoding mGlu1d was also detected in interneurons of these hippocampal regions (Figs 2, 8). It has been proposed3,14 that interneuron mGlu1 and kainate receptors may regulate somatostatin release in response to glutamate from local recurrent collaterals of principal neurons, and may also confer the high susceptibility of these interneurons to glutamatergic excitotoxicity. Interestingly, mGlu7-IR in the hippocampus is found only on terminals of pyramidal cell axons which appose dendrites of mGlu1a-positive interneurons,38 indicating specific pre- and postsynaptic organization of mGlu receptors to control the release of, and response to, neurotransmitter. Since hippocampal mGlu1a mRNA and protein are restricted to interneurons3,14,23 (Figs 2, 8), then the strong IR signals for the mGlu1 amino terminus in the neuropil layers of CA3 and the molecular layer of the dentate gyrus10,22 can be attributed to the shorter mGlu1 splice variants. This conclusion correlates well with the expression of mGlu1b and -1d mRNAs in hippocampal pyramidal neurons and in granule cells of the dentate gyrus (Figs 2, 3, 8). IR for mGlu1b has also been described on terminals of dentate gyrus mossy fibres forming synapses with CA3 pyramidal neurons12 which would be consistent with the presence of mGlu1b mRNA in dentate gyrus granule cells. LTP at this synapse is impaired in mice lacking the mGlu1 gene8 suggesting a pre- and/or postsynaptic involvement of mGlu1b or -1d receptors. Association of these receptors with LTP in other hippocampal pathways is as yet unresolved, since in mGlu1 / mice LTP is inducible in perforant path/dentate gyrus synapses in hippocampal slices8 but not in vivo,4 and in Schaeffer collateral/CA1 synapses by some authors1 but not by others.8 Preliminary results indicate that human mGlu1 splice variant mRNAs are similarly distributed in the hippocampus, implying similar functional roles. In rat striatum, IR indicating a short variant of mGlu1 has been located in presynaptic terminals.10 Whether this IR represents mGlu1b or -1d and whether it is located on intra- or nigrostriatal terminals needs to be determined. CONCLUSION
From the present study it is apparent that alternative splicing of the mGlu1 receptor mRNA is regionally regulated in both rat and human. Although the mGlu1 and inositol trisphosphate (IP3) receptors are co-expressed in a number of structures (e.g.,
Fig. 10. Photomicrographs of human cerebellum depicting the ISH of mGlu1 splice-specific probes. Panels as in Fig. 9. Abbreviations; ml, molecular layer; gcl, granule cell layer. Single arrows, putative stellate/basket cells; double arrows, Purkinje cells. Scale bar=15 µm.
748
A. Berthele et al.
cerebellar molecular layer, hippocampus CA3), there are several locations where one is present in the absence of the other10 (e.g., olfactory bulb glomeruli, dentate gyrus molecular layer). In such regions, signal transduction through mGlu1 receptors may not proceed via IP3 and Ca2+ signalling, but via diacylglycerol and kinase pathways, or other second messengers. The mGlu1a receptor is targetted to the periphery of postsynaptic specializations in many areas of the brain3,22,27 perhaps in association with
Homer, a protein that binds to the C-terminus of mGlu1a and -5a.5 In order to understand more fully the functions of the mGlu1 receptor it will be necessary to locate the regional and subcellular locations of the mGlu1b and -1d splice variants and identify their signalling pathways. Acknowledgements—The authors are indebted to Mr A. Wanner, Novartis, for quality sequencing, and to Dr S. Weis, Munich, for providing excellent human brain tissue.
REFERENCES
1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23.
Aiba A., Chen C., Herrup K., Rosenmund C., Stevens C. F. and Tonegawa S. (1994) Reduced hippocampal long-term potentiation and context-specific deficit in associative learning in mGluR1 mutant mice. Cell 79, 365–375. Aiba A., Kano M., Chen C., Stanton M., Fox G. D., Herrup K., Zwingman T. A. and Tonegawa S. (1994) Deficient cerebellar long-term depression and impaired motor learning in mGluR1 mutant mice. Cell 79, 377–388. Baude A., Nusser Z., Roberts J. D. B., Mulvihill E., McIlhinney R. A. J. and Somogyi P. (1993) The metabotropic glutamate receptor (mGluR1á) is concentrated at perisynaptic membrane of neuronal subpopulations as detected by immunogold reaction. Neuron 11, 771–787. Bordi F. (1996) Reduced long-term potentiation in the dentate gyrus of mGlu1 receptor-mutant mice in vivo. Eur. J. Pharmac. 301, R15–R16. Brakeman P. R., Lanahan A. A., O’Brian R., Roche K., Barnes C. A., Huganir R. L. and Worley P. F. (1997) Homer: a protein that selectively binds metabotropic glutamate receptors. Nature 386, 284–288. Casabona G., Kno¨pfel T., Kuhn R., Gasparini F., Baumann P., Sortino M. A., Copani A. and Nicoletti F. (1997) Expression and coupling to polyphosphoinositide hydrolysis of group I metabotropic glutamate receptors in early postnatal and adult rat brain. Eur. J. Neurosci. 9, 12–17. Catania M. V., Landwehrmeyer G. B., Testa C. M., Standaert D. G., Penney J. B. and Young A. B. (1994) Metabotropic glutamate receptors are differentially regulated during development. Neuroscience 61, 481–495. Conquet F., Bashir Z. I., Davies C. H., Daniel H., Ferraguti F., Bordi F., Franz-Bacon K., Reggiani A., Matarese V., Conde´ F., Collingridge G. L. and Cre´pel F. (1994) Motor deficit and impairment of synaptic plasticity in mice lacking mGluR1. Nature 372, 237–243. Desai M. A., Burnett J. P., Mayne N. G. and Schoepp D. D. (1995) Cloning and expression of a human metabotropic glutamate receptor 1á: enhanced coupling on cotransfection with a glutamate transporter. Molec. Pharmac. 48, 648–657. Fotuhi M., Sharp A. H., Glatt C. E., Hwang P. M., von Krosigk M., Snyder S. and Dawson T. (1993) Differential localization of phosphoinositide-linked metabotropic glutamate receptor (mGluR1) and the inositol 1,4,5trisphosphate receptor in rat brain. J. Neurosci. 13, 2001–2012. Fotuhi M., Standaert D. G., Testa C. M., Penney J. B. and Young A. B. (1994) Differential expression of metabotropic glutamate receptors in the hippocampus and entorhinal cortex of the rat. Molec. Brain Res. 21, 283–292. Grandes P., Mateos J. M., Azkue J., Sarria R., Benitez R., Ruegg D., Malitschek B., Kuhn R. and Knoepfel T. (1996) Immunocytochemical localization of the mGluR1b metabotropic glutamate receptor in synaptic terminals of rat hippocampus. Neuropharmacology 35, A14. Grandes P., Mateos J. M., Ru¨egg D., Kuhn R. and Kno¨pfel T. (1994) Differential cellular localization of three splice variants of the mGluR1 metabotropic glutamate receptor in rat cerebellum. NeuroReport 5, 2249–2252. Hampson D. R., Theriault E., Huang X.-P., Kristensen P., Pickering D. S., Franck J. E. and Mulvihill E. R. (1994) Characterization of two alternatively spliced forms of a metabotropic glutamate receptor in the central nervous system of the rat. Neuroscience 60, 325–336. Houamed K. M., Kuijper J. L., Gilbert T. L., Haldeman B. A., O’Hara P. J., Mulvihill E. R., Almers W. and Hagen F. S. (1991) Cloning, expression and gene structure of a G protein-coupled glutamate receptor from rat brain. Science 252, 1318–1321. Kano M., Hashimoto K., Kurihara H., Watanabe M., Inoue Y., Aiba A. and Tonegawa S. (1997) Persistent multiple climbing fibre innervation of cerebellar Purkinje cells in mice lacking mGluR1. Neuron 18, 71–79. Kaupmann K., Huggel K., Heid J., Flor P. J., Bischoff S., Mickel S. J., McMaster G., Angst C., Bittiger H., Froestl W. and Bettler B. (1997) Expression cloning of GABAB receptors uncovers similarity to metabotropic glutamate receptors. Nature 386, 239–246. Laurie D. J. and Seeburg P. H. (1994) Regional and developmental heterogeneity in splicing of the rat brain NMDAR1 mRNA. J. Neurosci. 14, 3180–3194. Laurie D. J., Boddeke H. W. G. M., Hiltscher R. and Sommer B. (1996) HmGlu1d, a novel splice variant of the human type I metabotropic glutamate receptor. Eur. J. Pharmac. 296, R1–R3. Laurie D. J., Hiltscher R., Boddeke H. W. G. M., Berthele A., To¨lle T., Seuwen K. and Sommer B. (1996) Distribution and functional analysis of human mGlu1 receptor splice variants. Neuropharmacology 35, A18. Laurie D. J., Putzke J., Zieglga¨nsberger W., Seeburg P. H. and To¨lle T. R. (1995) The distribution of splice variants of the NMDAR1 subunit mRNA in adult rat brain. Molec. Brain Res. 32, 94–108. Luja´n R., Nusser Z., Roberts J. D. B., Shigemoto R. and Somogyi P. (1996) Perisynaptic location of metabotropic glutamate receptors mGluR1 and mGluR5 on dendrites and dendritic spines in the rat hippocampus. Eur. J. Neurosci. 8, 1488–1500. Martin L. J., Blackstone C. D., Huganir R. L. and Price D. L. (1992) Cellular localization of a metabotropic glutamate receptor in rat brain. Neuron 9, 259–270.
In situ hybridization on mGlu1 splice variant mRNAs 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45.
749
Masu M., Tanabe Y., Tsuchida K., Shigemoto R. and Nakanishi S. (1991) Sequence and expression of a metabotropic glutamate receptor. Nature 349, 760–765. Minakami R., Iida K., Hirakawa N. and Sugiyama H. (1995) The expression of two splice variants of metabotropic glutamate receptor subtype 5 in the rat brain and neuronal cells during development. J. Neurochem. 65, 1536–1542. Nakajima Y., Iwakabe H., Akazawa C., Nawa H., Shigemoto R., Mizuno N. and Nakanishi S. (1993) Molecular characterisation of a novel retinal metabotropic glutamate receptor mGluR6 with a high agonist selectivity for L-2-amino-4-phosphonobutyrate. J. biol. Chem. 16, 11,868–11,873. Nusser Z., Mulvihill E., Streit P. and Somogyi P. (1994) Subsynaptic segregation of metabotropic and ionotropic glutamate receptors as revealed by immunogold localization. Neuroscience 61, 421–427. Okamoto N., Hori S., Akazawa C., Hayashi Y., Shigemoto R., Mizuno N. and Nakanishi S. (1994) Molecular characterization of a new metabotropic glutamate receptor mGluR7 coupled to inhibitory cyclic AMP signal transduction. J. biol. Chem. 269, 1231–1236. Paxinos G. and Watson C. (1986) The Rat Brain in Stereotaxic Coordinates. 2nd edn. Academic, Sydney. Pearson R. B., Mitchelhill K. I. and Kemp B. E. (1993) Studies of protein kinase/phosphatase specificity using synthetic peptides. In Protein Phosphorylation—A Practical Approach (ed. D. G. Hardie), pp. 265–280. IRL/Oxford University Press, Oxford. Pin J.-P. and Duvoisin R. (1995) Review: neurotransmitters I. The metabotropic glutamate receptors: structure and functions. Neuropharmacology 34, 1–26. Pin J.-P., Waeber C., Prezeau L., Bockaert J. and Heinemann S. F. (1992) Alternative splicing generates metabotropic glutamate receptors inducing different patterns of calcium release in Xenopus oocytes. Proc. natn. Acad. Sci. U.S.A. 89, 10,331–10,335. Salt T. E. and Eaton S. A. (1994) The function of metabotropic excitatory amino acid receptors in synaptic transmission in the thalamus: studies with novel phenylglycine antagonists. Neurochem. Int. 24, 451–458. Salt T. E. and Eaton S. A. (1995) Modulation of sensory neurone excitatory and inhibitory responses in the ventrobasal thalamus by activation of metabotropic excitatory amino acid receptors. Neuropharmacology 34, 1043–1051. Saugstad J. A., Kinzie J. M., Mulvihill E. R., Segerson T. P. and Westbrook G. L. (1994) Cloning and expression of a new member of the L-2-amino-4-phosphonobutyric acid-sensitive class of metabotropic glutamate receptors. Molec. Pharmac. 45, 367–372. Saugstad J. A., Kinzie J. M., Shinohara M. M., Segerson T. P. and Westbrook G. L. (1997) Cloning and expression of rat metabotropic glutamate receptor 8 reveals a distinct pharmacological profile. Molec. Pharmac. 51, 119–125. Shigemoto R., Abe T., Nomura S., Nakanishi S. and Hirano T. (1994) Antibodies inactivating mGluR1 metabotropic glutamate receptor block long-term depression in cultured Purkinje cells. Neuron 12, 1245–1255. Shigemoto R., Kulik A., Roberts J. D. B., Ohishi H., Nusser Z., Kaneko T. and Somogyi P. (1996) Target-cell-specific concentration of a metabotropic glutamate receptor in the presynaptic active zone. Nature 381, 523–525. Shigemoto R., Nakanishi S. and Mizuno N. (1992) Distribution of the mRNA for a metabotropic glutamate receptor (mGluR1) in the central nervous system: an in situ hybridization study in adult and developing rat. J. comp. Neurol. 322, 121–135. Sommer B., Keina¨nen K., Verdoorn T. A., Wisden W., Burnashev N., Herb A., Ko¨hler M., Takagi T., Sakmann B. and Seeburg P. H. (1990) Flip and flop: a cell-specific functional switch in glutamate-operated channels of the CNS. Science 249, 1580–1585. Stephan D., Bon C., Holzwarth J. A., Galvan M. and Pruss R. M. (1996) Human metabotropic glutamate receptor 1: mRNA distribution, chromosomal localization and functional expression of two splice variants. Neuropharmacology 35, 1649–1660. Tanabe Y., Masu M., Ishii T., Shigemoto R. and Nakanishi S. (1992) A family of metabotropic glutamate receptors. Neuron 8, 169–179. Testa C. M., Standaert D. G., Young A. B. and Penney J. B. (1994) Metabotropic glutamate receptor mRNA expression in the basal ganglia of the rat. J. Neurosci. 14, 3005–3018. Vidnya´nszky Z., Go¨rcs T. J., Ne´gyessy L., Borostya´nko˜i Z., Kuhn R., Kno¨pfel T. and Ha´mori J. (1996) Immunocytochemical visualization of the mGluR1a metabotropic glutamate receptor at synapses of corticothalamic terminals originating from Area 17 of the rat. Eur. J. Neurosci. 8, 1061–1071. Wisden W. and Morris B. J. (1994) In situ hybridization with synthetic oligonucleotide probes. In In Situ Hybridization Protocols for the Brain (eds Wisden W. and Morris B. J.), pp. 9–34. Academic, London. (Accepted 9 December 1997)