- Email: [email protected]
DNA damage and repair, oxidative stress and metabolism biomarker responses in lungs of rats exposed to ambient atmospheric 1-nitropyrene
Environmental Toxicology and Pharmacology 54 (2017) 14–20
Contents lists available at ScienceDirect
Environmental Toxicology and Pharmacology journal homepage: www.elsevier.com/locate/etap
Research Paper
DNA damage and repair, oxidative stress and metabolism biomarker responses in lungs of rats exposed to ambient atmospheric 1-nitropyrene ⁎
Ruijin Lia, Lifang Zhaoa, Li Zhanga, Minghui Chena, Chuan Donga, , Zongwei Caib,
MARK
⁎⁎
a
Institute of Environmental Science, Shanxi University, Taiyuan, PR China State Key Laboratory of Environmental and Biological Analysis, Department of Chemistry, Hong Kong Baptist University, Hong Kong Special Administrative Region, PR China b
A R T I C L E I N F O
A B S T R A C T
Keywords: 1-Nitropyrene DNA damage and repair Rat lungs Oxidative stress Metabolic enzymes
1-Nitropyrene (1-NP) is a mutagenic and carcinogenic pollutant very widespread in the environment. However, the relative investigations on genotoxicity, oxidative stress and metabolic enzymes in lungs of mammalian caused by 1-NP have not been fully established. In this study, the 1-NP solutions at 3 dosages (1.0 × 10−5, 4.0 × 10−5 and 1.6 × 10−4 mg/kg body weight) were respectively given to rats by the intratracheal instillation. The responses of 1-NP on DNA damage and repair, oxidative stress and metabolism biomarkers in rat lungs after exposure to 1-NP were measured. The results showed 1-NP at three dosages induced obvious DNA strand breaks, 8-OH-dG formation and DNA-protein cross-link in rat lungs compared with the control. Higher dosage 1NP (4.0 × 10−5 and 1.6 × 10−4 mg/kg body weight) greatly activated DNA repair gene OGG1 and inhibited MTH1 and XRCC1 expressions, and they significantly elevated the levels of GADD153, heme oxygenase-1 and malondialdehyde and decreased SOD activity, accompanied by the increases of CYP450, CYP1A1, CYP1A2 and GST levels. These results suggested the genotoxicity of 1-NP might rely on 1-NP-caused DNA damage and its combined effects on the suppression of DNA repair and the enhancement of oxidative stress and metabolic enzyme activity.
1. Introduction Nitro-polycyclic aromatic hydrocarbons (NPAHs) are widespread in the air environment mainly from two major sources: direct emissions (e.g., from coal combustion, diesel engines, cigarette smoke, cooked meat products and biomass burning), and secondary formation through atmospheric reactions of polycyclic aromatic hydrocarbons (PAHs) and nitrogen dioxide (Lin et al., 2015a). In particular, they were ubiquitously identified in the atmosphere and ambient fine particulate matter (PM2.5) in America, Europe and Asia (Ringuet et al., 2012; Jariyasopit et al., 2014), with relatively higher levels of NPAHs in PM2.5 were found in East Asia including China, Russia, Korea and Japan (Lin et al., 2015a, 2015b; Hayakawa, 2016). NPAHs arouse extensive concern primarily because they not only are wide-spread environmental pollutants, but also possess much higher direct-acting mutagenicity and carcinogenicity than the parent PAHs, especially related to the development of lung, skin and bladder cancer (Yang et al., 2010; Wang et al., 2011; IARC, 2014). 1-Nitropyrene (1-NP), a representative of NPAHs and the most abundant NPAH, has been detected in many
⁎
environmental samples including air particulate, coal combustion fly ash, diesel engine exhaust, cigarette smoke (Albinet et al., 2007; Ding et al., 2012; IARC, 2013). It has been listed as an IARC Group 2A carcinogen (IARC, 2016), indicating it is possibly carcinogenic to humans and has potential respiratory health risks. From laboratory experimental data, 1-NP was found to be mutagenic in mutagenicity test using bacteria and mammalian cells (Varga and Szendi, 2006; Watt et al., 2007), and mammary tumors were induced in rats treated with 1-NP for 86 weeks (Imaida et al., 1995). 1-NP enhanced pro-inflammatory gene expression in cultured BEAS-2B cells and generated excessive 8-hydroxydeoxyguanosine (8-OH-dG) and reactive oxygen species (ROS) in A549 cells (Kim et al., 2005; Park and Park, 2009). Genotoxicity is refers to the property of chemical agents that may damage the genetic information (such as DNA or chromosome) within a cell, causing mutations (which may lead to cancer). However, to our best knowledge, studies on the genotoxicity roles of 1-NP are relatively shortage, therefore evaluating the genotoxicity of 1-NP and investigating the related mechanisms are vital to reveal the environmental health hazards of 1-NP.
Corresponding author at: Institute of Environmental Science, Shanxi University, 92 Wucheng Road, Taiyuan 030006, Shanxi Province, PR China. Corresponding author at: State Key Laboratory of Environmental and Biological Analysis, Department of Chemistry, Hong Kong Baptist University, Kowloon Tong, Kowloon, Hong Kong Special Administrative Region, PR China. E-mail addresses: [email protected] (C. Dong), [email protected] (Z. Cai). ⁎⁎
http://dx.doi.org/10.1016/j.etap.2017.06.009 Received 17 March 2017; Received in revised form 17 May 2017; Accepted 19 June 2017 Available online 20 June 2017 1382-6689/ © 2017 Published by Elsevier B.V.
Environmental Toxicology and Pharmacology 54 (2017) 14–20
R. Li et al.
respectively every other day for 10 days. The research revealed that no histopathological abnormalities were observed in lung tissues of the control mice after administration of 5% DMSO (Martínez-González et al., 2014). All animal procedures were approved by the Shanxi University Animal Investigational Committee and performed in accordance with the Guide for the Care and Use of Laboratory Animals published by Ministry of Health People’s Republic of China. In this study, the concentration of 3.04 ng/m3 of 1-NP, which was detected in PM2.5 sample in Taiyuan of China (Ma et al., 2015), was used to estimate the 1-NP instillation dosage for each rat every 2 days as about 1.0 × 10−5 mg/kg b.w. by taking the respiratory volume limit of an adult rat (200 mL/min, 200 g/rat) into account. Moreover, according to the orange alert criterion of haze PM2.5 in China (500 μg/m3) and the approximate proportion of mass concentration of NPAHs in wintertime PM2.5 ranging from 9 × 10−6 to 1 × 10−4 (Lin et al., 2015a), 4.0 × 10−5 mg/kg b.w. of 1-NP dosage was used when 2.7 × 10−5 of 1-NP proportions in PM2.5 were chosen. Based on above considerations and requirement of dose-response relationship experiment design, three concentrations of 1-NP were selected to be 1.0 × 10−5, 4.0 × 10−5 and 1.6 × 10−4 mg/kg b.w. in this study. After the last treatment, rats in different groups were euthanized and sacrificed, and then a piece of fresh lung tissue per rat was minced and grinded for comet assay, another part was homogenized for ELISA and biochemical analysis, and the rest lung tissue was quickly frozen in liquid nitrogen and then stored at −80 °C for mRNA and protein measurement.
Lung is a target organ that encounters most environmental chemicals. Previous studies indicated that the genotoxicity of environmental pollutants was linked to oxidative stress and DNA damage caused by the chemicals (Risom et al., 2005; Hanot-Roy et al., 2016), and related to the upregulation of metabolic enzymes (Shah et al., 2016). Generally, phase I xenobiotic-metabolizing enzymes like in particular cytochromes P450 (CYP450) and phase II enzymes including glutathione S-transferase (GST) may undergo a process of biotransformation and catalysis, accompanied by the formation of metabolites or intermediates, in which some metabolic active intermediates may mediate oxidative and reactive with DNA highly (Huang and Hu, 2014). In some cases, intermediates like ROS are produced in the process of metabolic bioactivation mediated by CYP450, triggering oxidative stress and leading to DNA damage if it is not repaired before replication (Moller et al., 2014; Hrycay and Bandiera, 2015). Notably, DNA repair genes play important roles in DNA damage repair processes. If normal DNA repair processes fail, DNA damage may occur (Sugasawa, 2016). Taken together, lung genotoxicity induced by chemicals is comprehensive and complex, in which DNA damage, oxidative stress, and metabolic disturbance are interrelated. As a PM2.5-bound NPAH component, 1-NP could be oxidized by human P450 2A13 to form mono- and di-oxygenated products (Shimada et al., 2016). It could generate ROS in A549 cells and induce DNA damage along with the slower rate of DNA repair (Kim et al., 2005; Andersson et al., 2009). However, the detailed mechanisms of DNA damage and repair, oxidative stress and metabolic activation in laboratory animals induced by 1-NP have not fully been investigated so far. Accordingly, in this study, we focused on the DNA damage markers like DNA strand breaks, 8-OH-dG and DNA-protein cross-link (DPC), and multiple DNA damage repair genes, such as 8-Oxoguanine DNA glycosylase (OGG1), MutT Homolog 1 (MTH1) and X-ray repair crosscomplementing group 1 (XRCC1), which were have been demonstrated to play key roles in DNA repair processes and be involved in mammalian nucleotide excision repair (Thacker and Zdzienicka, 2003; Nakabeppu, 2001). Meanwhile, growth arrest- and DNA damage-inducible gene 153 (GADD153) can be highly promoted when DNA damage or oxidative stress is initiated by envionmental pollutants (Fontanier-Razzaq et al., 2001; Tang et al., 2002), while heme oxygenase 1 (HMOX-1), superoxide dismutase (SOD) and malonaldehyde (MDA) may be obviously induced when oxidative stress occurs in the cells under the oxide stimulus (Takahashi et al., 2004; Tsikas, 2016). So GADD153, HMOX-1, SOD and MDA were used as the inducible and typical factors to explore the oxidative stress in rat lungs induced by 1NP. In addition, the changes of phase I enzymes CYP450s isoforms (CYP1A1 and 1A2) and phase II enzyme GST in rat lungs were investigated to indicate the lung metabolic characteristic of 1-NP. Our data will clarify the toxicological roles in DNA damage and repair, oxidative stress and metabolic activation induced by 1-NP in depth and will provide new insight into evaluation the genotoxicity of atmospheric 1-NP exposure.
2.2. Comet assay
2. Materials and methods
The alkaline comet assay was performed as follows. (1) Single cell suspensions were prepared in ice-cold phosphate-buffered saline (PBS) from a piece of lung (See “2.1” Section). (2) Preparation of “sandwich gel”. First layer was 1% normal melting-point agarose (NMA) in a slide; second layer was the mixture of cell/0.65% molten low melting-point agarose (LMA), third layer was 0.65% LMA. (3) The slides containing “sandwich gel” were transferred to cold lysis solution (2.5 mM NaCl, 100 mM EDTA, 1% sodium sarcosinate and 10 mM Tris, pH 10.0, to which 1% Triton X-100 and 10% DMSO were freshly added) for 60 min at 4 °C to cause denaturation. (4) The slides were then subjected to electrophoresis with cold electrophoreses buffer (300 mM NaOH, 1 mM EDTA, pH 13.0) at 25 V for 30 min at 4 °C, and immersed in Tris buffer (0.4 M Tris, pH 7.5) to neutralize the excess alkali. Subsequently the slides were air dried. (5) DNA was stained with 100 μL 4S Red Plus (Shengon, Shanghai, China, 1:10,000) for 20 min and immediately rinsed with Milli-Q water and air dried. (6) Slides were examined at 400× magnification using an Olympus BX51 fluorescence microscope (Olympus, Tokyo, Japan). 20–30 randomly acquired images of microscopic fields compared to each sample were recorded to enable analysis of 100–150 cells. (7) DNA damage indexes including comet tail DNA%, tail length, and olive tail moment (OTM) were assessed by a Comet Assay Software Project (CASP, CASP, version 1.2.3 beta1).
2.1. Animal and treatment protocols
2.3. Real time quantitative RT-PCR
Male Wistar rats (body weight 180–200 g) were obtained from Animal Center of Hebei Medical University (Shijiazhuang, China) and bred in an animal house in Institute of Environmental Science of Shanxi University (Taiyuan, China) under standard conditions (24 °C ± 2 °C and 50% ± 5% humidity). Animals received food and water ad labium, except during the exposure period. Rats were divided randomly into four equal groups with five animals for each group: (1) the control (5% dimethyl sulfoxide, DMSO), (2) low dose 1-NP group (1.0 × 10−5 mg/kg b.w. 1-NP in DMSO), (3) medium dose 1-NP group (4.0 × 10−5 mg/kg b.w. 1-NP in DMSO, and (4) high dose 1-NP group (1.6 × 10−4 mg/kg b.w. 1-NP in DMSO). The rats were administered using 5% DMSO and 1-NP solutions by intratracheal instillation
Lung tissues (See “2.1” Section) in different group rats were used to mRNA extraction and quantitative RT-PCR analysis of tested genes and housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was referenced as described previously (Li et al., 2015). Expression levels were assessed by real-time PCR in an iCycler iQ Real Time PCR Detection System (Bio-Rad, Richmond, CA, USA) with the Quantitect SYBRGreen I PCR kit. The GenBank accession numbers and the primer sequences of the tested genes with the PCR product amplified fragments and annealing temperature are listed in Table 1. The relative quantification of the expression of the target genes was measured using GAPDH mRNA as an internal control. The copy numbers of target gene/GAPDH mRNA ratio were measured in all samples. 15
Environmental Toxicology and Pharmacology 54 (2017) 14–20
R. Li et al.
Table 1 Primer sequences and the PCR product amplified fragments used in real-time RT-PCR. Genes
Accession No.
Sequence
MTH1 Products GADD153 Products XRCC1 Products OGG1 Products HO-1 Products CYP1A1 Products CYP1A2 Products GAPDH Products
NM_057120 148 bp, 60 °C RNU30186 110 bp, 60 °C NM_053435 195 bp, 60 °C NM_030870 195 bp, 60 °C BC091164 77 bp, 58 °C NM_012540 109 bp, 56 °C NM_012541 99 bp, 56 °C NM_017008 78 bp, 56 °C
Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer
5′-AGTGAAGAAATGCGCCCTCA-3′ 5′- TGAGGATGGTGTCCTGACCA -3′ 5′-GTCACAAGCACCTCCCAAAG-3′ 5′-CCACTCTGTTTCCGTTTCCT-3′ 5′- GATGGGGAACAGTCAGAAGGAC-3′ 5′- AATTGGCAGGTCAGCCTCTG-3′ 5′-CAACATTGCTCGCATCACTGG-3′ 5′-ATGGCTTTAGCACTGGCACATACA-3′ 5′-GTCAAGCACAGGGTGACAGA-3′ 5′-ATCACCTGCAGCTCCTCAAA-3′ 5′-TAACTCTTCCCTGGATGCCTTCAA-3′ 5′-GTCCCGGATGTGGCCCTTCTCAAA-3′ 5′-ACCCTGAGTGAGAAGGTGAT-3′ 5′-GAGGATGGCTAAGAAGAGGA-3′ 5′-ATGTATCCGTTGTGGATCTGAC-3′ 5′-CCTGCTTCACCACCTTCTTG-3′
DNA (free DNA plus DPC) was calculated. The results were expressed as percentage (DPC coefficient) of DPC on total DNA.
2.4. Western blotting Total proteins for MTH1, GADD153, XRCC1 and actin from frozen lung tissues were respectively extracted with protein extraction kit (Beyotime, Shanghai, China) according to the manufacturer’s instructions. Samples were mixed with loading buffer and boiled for 5 min. Western blot analysis of MTH1, GADD153, XRCC1 and actin was performed, and the rabbit polyclonal primary antibodies for rat MTH1 (Sc67291, dilution ratio 1:100), GADD153 (Sc-575, dilution ratio 1:100), XRCC1 (Sc-11429, dilution ratio 1:100) (Santa Cruz, CA, USA) and actin (AB10024, dilution ratio 1:3000, Sangon, Shanghai, China) were incubated overnight at 4 °C, whereas the infrared-labeled goat antirabbit secondary antibody (AlexaFlor 680 goat anti-rabbit IgG (H + L), USA) at a concentration of 1:20,000 were added to membranes and incubated for 1.5 h at room temperature. The membranes were scanned and the band densities were quantified using the Odyssey Infrared Imaging System (Li-COR Biosciences, USA). The blank tests in which PBS replaced specific antibodies were performed, and no false positive protein bands were found.
2.7. Statistical analysis Data were expressed as means ± SD and evaluated for statistical significance with one-way ANOVA using the SPSS19.0. Post hoc tests were conducted to determine the difference between the groups, followed by Fisher’s least significant difference (LSD) test. A level of P < 0.05 was accepted as statistically significant. The correlations of lung damage effects between 1-NP concentrations and DNA damage or metabolic enzyme responses were evaluated by using correlation analysis. A positive correlation is indicated by correlation coefficient (r) > 0.8. 3. Results 3.1. DNA damage effects induced by 1-NP in rat lungs As shown in Table 2, 1-NP at all doses tested significantly increased the values of three DNA damage markers in lung cells compared with the control (P < 0.01). 1-NP at all doses tested caused significant increases in Tail DNA%, OTM and Tail length values of lung cells in a dose-dependent manner (correlation coefficient, r = 0.87–0.98). Fig. 1 displays that 1-NP at higher doses (4 × 10−5 mg/kg b.w. and 1.6 × 10−4 mg/kg b.w.) significantly increased DPC levels in the lungs compared with the control (P < 0.05), and such increases induced by 1-NP had an obvious positive concentration-effect relationship (r = 0.73). In addition, 8-OH-dG levels were statistically raised in lungs of rats treated with the highest dose 1-NP (P < 0.01). No significant differences were observed in present of 1-NP at the dosages of 1.0 × 10−5 mg/kg and 4.0 × 10−5 mg/kg. 1-NP caused an increase of 8-OH-dG formation with a concentration-dependent property (r = 0.94).
2.5. ELISA assay The lung tissue was weighed and homogenized in ice-cold 0.9% physiological saline. After the homogenized solutions were centrifuged for 10 min at 3000 rpm (4 °C), the lung supernatants were collected. The levels of CYP1A1, CYP1A2, OGG1, HMOX-1 and 8-OH-dG in lung supernatants were measured using rat ELISA kit (R & D Systems, Minneapolis, MN, USA), and the level of CYP450s was detected using rat ELISA kit from the Beijing Fangcheng Biochemistry, China, according to the manufacturer’s instructions. 2.6. Measurement of SOD, MDA, GST and DPC The levels of SOD, MDA and GST in lung tissue homogenates were measured using the corresponding kits from the Nanjing Jiancheng Biochemistry, China according to the manufacturer’s protocols. DPC levels were detected as described previously (Xie et al., 2007). In brief, DPC was detected using sodium dodecylsulphate (SDS)-KCl fluorescence spectrometry. Lung supernatant was treated with SDS-KCl system, and then centrifuged. The new supernatant contains the unbound fraction of DNA (free DNA) while the SDS-KCl precipitate contains the protein and DPC complexes. After Hoechst 33258 was added to the free DNA sample and DPC sample, fluorescence signals of free DNA and DPC samples were measured at an excitation wavelength of 350 nm and an emission wave length of 460 nm (Hitachi F-4500, Tokyo, Japan). The ratio of the fluorescence of DPC to that of the total
3.2. DNA repair gene expression induced by 1-NP in rat lungs On the basis of our data in Fig. 2A, 1-NP at the higher dosages (4 × 10−5 and 1.6 × 10−4 mg/kg b.w.) significantly increased the OGG1 mRNA levels whereas decreased MTH1 and XRCC1 mRNA levels in the lungs of rats compared with the control (P < 0.05 or P < 0.01). In Fig. 2B, the elevation of OGG1 protein levels and the reduction of MTH1 and XRCC1 protein levels had a similar variation tendency to the mRNA changes in response to the higher dose exposure to 1-NP (4.0 × 10−5 and/or 1.6 × 10−4 mg/kg b.w.) compared to the control (P < 0.05 or P < 0.01). Gene expressions of 3 genes above were not 16
Environmental Toxicology and Pharmacology 54 (2017) 14–20
R. Li et al.
Table 2 Tail DNA%, tail length and OTM results in the lungs of rats from different groups. The values are expressed as means ± SD from three individual samples. Using one-way ANOVA, comparing with control group, significant difference is indicated by bP < 0.01. Groups (mg/kg b.w1-NP)
Tail DNA (%)
Tail length (μm)
OTM
0 1.0 × 10−5 4.0 × 10−5 1.6 × 10−4 Correlation coefficient (r) 0
0.60 ± 0.26 2.33 ± 1.15b 3.08 ± 0.99b 5.8 ± 2.28b 0.95 1.0 × 10−5
3.09 ± 0.38 4.07 ± 1.34b 5.40 ± 1.88b 8.59 ± 2.66b 0.98 4.0 × 10−5
0.17 ± 0.06 0.76 ± 0.14b 1.12 ± 0.55b 1.55 ± 0.48b 0.87 1.6 × 10−4 mg/kg 1-NP
Fig. 1. Levels of 8-OHdG and DPC in the lungs of rats of different groups. The values are expressed as means ± SD from five individual samples. Using one-way ANOVA, comparing with control group, significant difference is indicated by *P < 0.05 and **P < 0.01.
significant in the presence of 1-NP at dose of 1.0 × 10−5 mg/kg b.w. (P > 0.05). 1-NP caused the increases in OGG1 expressions in lungs in a dose-dependent manner (r = 0.81 and 0.97), while 1-NP caused the decreases in MTH1 and XRCC1 expressions with a concentration-dependent property (r = 0.76–0.90). 3.3. Effects of 1-NP on markers of oxidative stress in rat lungs In Fig. 3, compared with the control, the higher doses of 1-NP (4.0 × 10−5 and/or 1.6 × 10−4 mg/kg b.w.) markedly enhanced mRNA and protein expressions of GADD153 and HMOX-1 as well as MDA levels, and decreased the SOD activities (P < 0.05 or P < 0.01). The level changes of GADD153 and HMOX-1, MDA and SOD in the presence of 1-NP (1.0 × 10−5 mg/kg b.w.) were not statistically significant compared with the control group (P > 0.05). 1-NP increased GADD153 and HMOX-1 levels and decrease SOD activity in dose-dependent manner, respectively (r = 0.70–0.94).
Fig. 2. Expression of mRNA (A) and protein (B) of OGG1, MTH1, and XRCC1 in rat lungs treated with 1-NP. Mean expression of mRNA in each treated group is shown as increase compared to mean expression in control group which has been ascribed an arbitrary value of 1. The values are expressed as means ± SD from five individual samples. Using oneway ANOVA, comparing with control group, significant difference is indicated by *P < 0.05 and **P < 0.01.
3.4. Effects of 1-NP on metabolic enzymes in lungs of rats
alterations of GST activities in lungs induced by 1.0 × 10−5 and 4.0 × 10−5 mg/kg b.w 1-NP were not significant. 1-NP increased phase I enzyme CYP450 and phase II enzyme GST activities in dose-dependent manner (r = 0.89 and 0.99). Also, in Table 3, CYP1A1 and 1A2 mRNA levels in lungs of rats were obviously raised in the presence of 1-NP at doses of 4.0 × 10−5 and 1.6 × 10−4 mg/kg b.w. compared to the control (P < 0.05 or P < 0.01), and two gene protein levels induced by 1.6 × 10−4 mg/kg
As shown in Table 3, CYP450 activities in the presence of 1-NP at 4.0 × 10−5 and 1.6 × 10−4 mg/kg b.w. concentration were statistically high versus the control (P < 0.01), whereas no statistic changes of CYP450 activity in lung at 1.0 × 10−5 mg/kg b.w 1-NP were observed compared with the control. GST activity was 53.3 U per mg protein in the present of 1.6 × 10−4 mg/kg b.w. 1-NP, and such change was significantly higher than that of control (P < 0.01). The 17
Environmental Toxicology and Pharmacology 54 (2017) 14–20
R. Li et al.
were elevated, 1-NP caused obvious DNA damage responses, which underlying mechanisms may be linked with DNA repair inhibition, oxidative stress and dysfunction of metabolic enzymes. Firstly, multiple DNA repair genes such as OGG1, MTH1 and XRCC1 have been emonstrated to play important roles in DNA repair processes and be involved in mammalian nucleotide excision repair (Nakabeppu, 2001; Thacker and Zdzienicka, 2003). They are able to repair massive amounts of DNA damage and considered to be the good biomarkers involved in the early biological effects of DNA-damaging agents. If the DNA damage is not repaired before replication, the accumulation of DNA damage such as DNA strand breaks and 8-OH-dG formation along with the unrepaired or mispairing bases can cause mutations, leading to possibly disease (Clancy, 2008). Among DNA repair genes, for example, OGG1, as a DNA glycosylase, is a base excision repair (BER) enzyme that may recognize and remove the altered base like 8-OH-dG in the BER pathway (Boiteux and Radicella, 2000). MTH1 protein may effectively catalyze the hydrolysis of 8-oxo-dGTP to 8-oxodGMP, thereby preventing 8-oxo-dGTP misincorporation into DNA (Svensson et al., 2011). As a scaffolding protein, XRCC1 plays a major role in BER and single strand break repair pathways via an ability to interact with multiple enzymatic components of repair reactions such as DNA polymerase beta, DNA ligase III and Poly (ADP-ribose) polymerases (PARP) (Hanssen-Bauer et al., 2012), which have a positive regulation role in DNA repair process. Based on our results, higher dosage 1-NP induced OGG1 over-expression in lungs of rats in order to enhance the capability of removing 8-OH-dG, but inhibited MTH1 and XRCC1 to suppress the roles of catalyzing the hydrolysis from 8-oxo-dGTP to 8-oxodGMP and repairing BER and SSBR, leading to DNA strand breaks and 8-OH-dG formation. It suggests the inhibition roles induced by 1-NP on MTH1 and XRCC1 are greater than the enhancement roles did by 1-NP on OGG1. Considering that the complicated roles of DNA repair genes in the regulation of DNA damage responses, further in-depth work is needed to investigate the underlying molecular mechanisms of 1-NP on DNA damage and repair. Secondly, GADD153 can be highly promoted when endoplasmic reticulum stress and oxidative stress and DNA damage are initiated by chemicals (Fontanier-Razzaq et al., 2001; Tang et al., 2002; Oyadomari and Mori, 2004), and it may be a valuable prognostic factor of earlystage non-small cell lung cancer in patients and has potentially clinical significance (Lee et al., 2012). It was reported that ambient PM2.5 exposure activated GADD153 in lungs of mice (Laing et al., 2010), whereas whether 1-NP may enhance GADD153 is still not clear. In this study, accompanied with DNA damage response, the GADD153 expression in rat lungs was obviously induced by higher concentration 1NP (4.0 × 10−5 and 1.6 × 10−4 mg/kg b.w.). It suggests that severe 1NP pollution can mount an active response of GADD153 along with DNA damage and GADD153 can be used as a sensitive marker for the evaluation of DNA damage induced by 1-NP. It is a remarkable fact that the redox status has close links with DNA damage response (Weiss and Ito, 2014). Among the influential factors of cellular redox status, the inducible antioxidant enzyme HMOX-1, the rate-limiting enzyme in charge of heme degradation, exerts
Fig. 3. GADD153 and HMOX-1 mRNA and protein levels, SOD activities and MDA contents in rat lungs treated with 1-NP. Mean expression of mRNA in each treated group is shown as increase compared to mean expression in control group which has been ascribed an arbitrary value of 1. The values are expressed as means ± SD from five individual samples. Using one-way ANOVA, comparing with control group, significant difference is indicated by *P < 0.05 and **P < 0.01.
b.w. of 1-NP were significantly elevated compared with the control (P < 0.05 or P < 0.01). 1-NP increased CYP1A1 and CYP1A2 mRNA and protein levels in dose-dependent manner (r = 0.70–0.99). No significant changes of the CYP1A1 and CYP1A2 levels were observed in the rats exposed to 1-NP at the concentration of 1.0 × 10−5 mg/kg b.w. compared to that in the control (P > 0.05). 4. Discussion NPAHs in PM2.5 are released from the incomplete combustion of fossil fuel and from the photochemistry reaction of PAHs with nitrogen dioxide. Some of them have been proven to have mutagenicity and potential carcinogenicity, thus NPAHs-induced health risks have aroused general concern. 1-NP is a typical biomarker of PM2.5-bound NPAHs because of its higher exposure levels. As an IARC Group 2A carcinogen (IARC, 2016), the genotoxicity of 1-NP was assessed though detecting DNA strand breaks and DNA adducts in previous studies (Watt et al., 2007; Andersson et al., 2009). However, the more detailed mechanisms of genotoxictiy of 1-NP remain unclear. In the present study, we selected the typical markers about DNA damage, DNA repair genes, oxidative stress, and metabolic enzymes as the endpoints to characterize genotoxicity in lungs of rats treated with 1-NP, which aims to clarify 1-NP genotoxicty in depth and provide important experimental data for human health. Our present results revealed, under the experimental conditions, higher dosage 1-NP could induce DNA damage including DNA strand break, formation of DPC and 8-OH-dG in lung of rats, whereas no significant difference was observed in the presence of 1-NP at the dosage of 1.0 × 10−5 mg/kg. It implies, under 10 days of exposure of 1-NP with the actual ambient exposure levels, 1NP didn’t induce DNA damage. However, when the exposure doses
Table 3 Activities of CYP450s and GSTs and mRNA and protein levels of CYP1A1 and 1A2 in rat lungs treated with 1-NP. Mean expression of mRNA in each treated group is shown as increase compared to mean expression in control group which has been ascribed an arbitrary value of 1. The values are expressed as means ± SD from five individual samples. Using one-way ANOVA, comparing with control group, significant difference is indicated by aP < 0.05 and bP < 0.01. Groups (mg/kg b.w 1NP)
CYP450 (U/mg prot)
0 1.0 × 10−5 4.0 × 10−5 1.6 × 10−4 Correlation coefficient (r)
0.085 0.107 0.122 0.143 0.89
± ± ± ±
0.012 0.018 0.025b 0.017b
GST (U/mg prot)
33.2 ± 6.37 33.8 ± 6.78 39 ± 8.29 53.3 ± 12.2b 0.99
CYP1A1 mRNA (fold changed)
CYP1A2 mRNA (fold changed)
CYP1A1 protein (ng/mg prot)
CYP1A2 protein (ng/mg prot)
1.00 1.25 1.33 1.46 0.81
1.00 1.23 1.32 1.36 0.70
22.7 23.8 25.3 29.3 0.99
2 ± 0.14 2.23 ± 0.21 2.3 ± 0.27 2.55 ± 0.33b 0.91
± ± ± ±
0.2 0.21 0.26a 0.15b
18
± ± ± ±
0.1 0.25 0.15a 0.28a
± ± ± ±
3.9 3.5 3.5 5.6a
Environmental Toxicology and Pharmacology 54 (2017) 14–20
R. Li et al.
metabolic enzyme activity in lungs of rats. We propose that these effects are derived from three mechanisms: (1) the inhibition effects of MTH1 and XRCC1 expression induced by 1-NP exceed the scavenging role of OGG1 to damaged DNA, (2) 1-NP significantly induces the levels of oxidative stress factors like GADD153, HMOX-1 and MDA, along with SOD suppression, leading to oxidative stress, and (3) 1-NP markedly activates GST and CYP450 as well as CYP1A1 and CYP1A2, disturbing the biotransformation. Notably, our research clearly confirmed that 1NP induced a significant increase of lung DNA damage accompanied by decreasing DNA repair capacity, and promoting oxidative stress and metabolic enzyme activation, finally contributing to lung genotoxicity. At the same time, we realize that there is more work to be studied further. (1) Except for DNA strand breaks, DPC and 8-OH-dG, other markers to assess genotoxicity such as MN, chromosomal aberration (CA), sister chromatid exchange (SCE) induced by 1-NP need to be measured. (2) It is necessary to explore the regulation mechanisms of oxidative stress and xenobiotic-metabolizing enzyme on DNA damage caused by 1-NP. (3) More attention should be paid to the contributions of 1-NP or other NPAHs on PM2.5 lung toxicity. Accumulating more basic data will be very important to health risk of 1-NP.
cytoprotective effects in various cells (Takahashi et al., 2004), for excess of heme can catalyze ROS formation. The high-expression of HMOX-1 means, to some extent, the ROS increases and the stress response. SOD, another anti-oxidative enzyme, can scavenge superoxide radicals. When superoxide exceeds the clearance capacity of SOD and other ROS scavengers or SOD activity is inhibited, it will initiate oxidative stress or pathologic responses (Valdivia et al., 2009). Importantly, NPAHs including 1-NP were proven to generate the reactive intermediates including ROS (singlet oxygen and superoxide) and free radicals during UVA irradiation and mediate the formation of lipid peroxidation (Xia et al., 2013). ROS can be represented a molecular marker of oxidative stress related to the development of lung tumor. Additionally, 1-NP produced excessive ROS and weakened the ability to neutralize free radicals, resulting in oxidative stress. ROS can further induce DNA strand breaks, DNA oxidative damage and formation of DPC (Evans et al., 2004), which prevents chromatin development and blocks replication and transcription, in turn increasing the risk of inducing genotoxicity and involving in the aetiology of cancer (Donkena et al., 2010). As observed in Fig. 3 and Table 2, SOD was inhibited whereas HMOX-1 was activated in the lungs of rats in the presence of 1NP, along with the accumulation of the typical lipid peroxidation product MDA and DNA strand breaks, suggesting that 1-NP induced lung oxidative stress, which related to DNA damage. Thirdly, the biotransformation, which may be categorized into phase I and phase II reactions, possesses important toxicological significances, because it may either detoxify the compounds, or may produce more toxic intermediate metabolites than the parents compounds themselves. For instance, cytochrome P450 1A1 and 1A2 (CYP1A1 and 1A2) are the phase I enzymes, which can first activate xenobiotics like drugs, environmental pollutants, toxins, etc (Guengerich, 2007). It has been reported that CYP450 enzyme, CYP1A1 and 1A2 can mediate PAHs oxidation to epoxide and diol-epoxides intermediates, and convert PAHs into full carcinogens (Shimada and Fujii-Kuriyama, 2004; He and Feng, 2015). As the phase II enzymes, GSTs may catalyze the conjugation of glutathione together with the intermediates of xenobiotics from phase I reaction and produce inactive glutathione conjugates, which have more water soluble and likely eliminate from the organism (Nakamura et al., 2003). If the toxic xenobiotics could not be conjugated with glutathione and eliminated, they would attack the cellular DNA, RNA and proteins (Abraham and Singh, 1999). From another direction, the GST high expression partly means the harmful metabolite accumulation. Importantly, the literatures showed that the increases of CYP1A enzyme activity were associated with the elevated benzo(a)pyrene-DNA adduct levels (Arlt et al., 2015), while the significant increases of the DNA damage (DNA strand breaks and 8-OH-dG formation) in hepatocytes of mice induced by ulcerative colitis were accompanied with GST high-expression (Trivedi and Jena, 2013), suggesting the changes of phase I and II enzyme activities are related to DNA damage. As for 1-NP, it highly induced CYP1A1 and CYP1A2 expression in various human tissue-derived cell lines (Iwanari et al., 2002), and significantly increased hepatic GST activities in rats (Pegram and Chou, 1989). Especially, the mono- and di-oxygenated metabolites of 1-NP via CYP450 activation and adducts [N-(deoxyguanosin-8-yl)-1-aminopyrene (C8-AP-dG)] of 1-NP metabolites may be formed in the mouse lung and in mammalian cells (Watt et al., 2007; Shimada et al., 2016). In the present study, high dosage 1NP markedly increased the activities of CYP450s and GST as well as gene expression of CYP1A1 and CYP1A2 in rat lung compared with the control (See Table 3), which are consistent with the reports above. Combining this result with the responses of oxidative damage and DNA damage mediated by metabolic enzymes (Shah et al., 2016Huang et al., 2014), it implied that 1-NP may activate phase I and phase II enzymes and disturb lung metabolic process, further promoting the lung oxidative DNA damage. In conclusion, this study suggests that 1-NP exposure may cause the significant increases in the levels of DNA damage, oxidative stress, and
Conflict of interest None. Acknowledgments This research was supported by the National Natural Science Foundation of China (No. 91543202 and 21575084), HKBU Strategic Development Fund (15-1012-P04), Nature Science Foundation of Shanxi Province in China (No. 2014011036-2), and Foundation of Educational Committee of Shanxi Province in China (No. 2014110). References Abraham, S.K., Singh, S.P., 1999. Anti-genotoxicity and glutathione S-transferase activity in mice pretreated with caffeinated and decaffeinated coffee. Food Chem. Toxicol. 37, 733–739. Albinet, A., Leoz-Garziandia, E., Budzinski, H., Viilenave, E., 2007. Polycyclic aromatic hydrocarbons (PAHs), nitrated PAHs and oxygenated PAHs in ambient air of the Marseilles area (South of France): concentrations and sources. Sci. Total. Environ. 384, 280––292. Andersson, H., Piras, E., Demma, J., Hellman, B., Brittebo, E., 2009. Low levels of the air pollutant 1-nitropyrene induce DNA damage, increased levels of reactive oxygen species and endoplasmic reticulum stress in human endothelial cells. Toxicology 262, 57–64. Arlt, V.M., Krais, A.M., Godschalk, R.W., Riffo-Vasquez, Y., Mrizova, I., Roufosse, C.A., Corbin, C., Shi, Q., Frei, E., Stiborova, M., van Schooten, F.J., Phillips, D.H., Spina, D., 2015. Pulmonary inflammation impacts on CYP1A1-mediated respiratory tract DNA damage induced by the carcinogenic air pollutant benzo[a]pyrene. Toxicol. Sci. 146, 213–225. Boiteux, S., Radicella, J.P., 2000. The human OGG1 gene: structure, functions, and its implication in the process of carcinogenesis. Arch. Biochem. Biophys. 377, 1–8. Clancy, S., 2008. DNA damage & repair: mechanisms for maintaining DNA integrity. Nat. Educ. 1, 103. Ding, J., Zhong, J., Yang, Y., Li, B., Shen, G., Su, Y., Wang, C., Li, W., Shen, H., Wang, B., Wang, R., Huang, Y., Zhang, Y., Cao, H., Zhu, Y., Simonich, S.L.M., Tao, S., 2012. Occurrence and exposure to polycyclic aromatic hydrocarbons and their derivatives in a rural Chinese home through biomass fuelled cooking. Environ. Pollut. 169, 160–166. Donkena, K.V., Young, C.Y., Tindall, D.J., 2010. Oxidative stress and DNA methylation in prostate cancer. Obstet. Gynecol. Int. 302051. Evans, M.D., Dizdaroglu, M., Cooke, M.S., 2004. Oxidative DNA damage and disease: induction repair and significance. Mutat. Res. 567, 1–61. Fontanier-Razzaq, N., McEvoy, T.G., Robinson, J.J., Rees, W.D., 2001. DNA damaging agents increase gadd153 (CHOP–10) messenger RNA levels in bovine preimplantation embryos cultured in vitro. Biol. Reprod. 64 (5), 1386–1391. Guengerich, F.P., 2007. Cytochrome P450 and chemical toxicology. Chem. Res. Toxicol. 21, 70–83. Hanot-Roy, M., Tubeuf, E., Guilbert, A., Bado-Nilles, A., Vigneron, P., Trouiller, B., Braun, A., Lacroix, G., 2016. Oxidative stress pathways involved in cytotoxicity and genotoxicity of titanium dioxide (TiO2) nanoparticles on cells constitutive of alveolo-capillary barrier in vitro. Toxicol. In Vitro 33, 125–135. Hanssen-Bauer, A., Solvang-Garten, K., Akbari, M., Otterlei, M., 2012. X-ray repair cross complementing protein 1 in base excision repair. Int. J. Mol. Sci. 13, 17210––17229.
19
Environmental Toxicology and Pharmacology 54 (2017) 14–20
R. Li et al.
stress. Cell Death Differ. 11, 381–389. Park, E.J., Park, K., 2009. Induction of pro-inflammatory signals by 1-nitropyrene in cultured BEAS-2B cells. Toxicol. Lett. 184, 126–133. Pegram, R.A., Chou, M.W., 1989. Effect of nitro-substitution of environmental polycyclic aromatic hydrocarbons on activities of hepatic phase II enzymes in rats. Drug Chem. Toxicol. 12, 313–326. Ringuet, J., Albinet, A., Leoz-Garziandia, E., Budzinski, H., Villenave, E., 2012. Diurnal/ nocturnal concentrations and sources of particulate–bound PAHs, OPAHs and NPAHs at traffic and suburban sites in the region of Paris (France). Sci. Total. Environ. 437, 297–305. Risom, L., Møller, P., Loft, S., 2005. Oxidative stress-induced DNA damage by particulate air pollution. Mutat. Res. 592, 119–137. Shah, U.K., Seager, A.L., Fowler, P., Doak, S.H., Johnson, G.E., Scott, S.J., Scott, A.D., Jenkins, G.J., 2016. A comparison of the genotoxicity of benzo[a]pyrene in four cell lines with differing metabolic capacity. Mutat. Res. 808, 8–19. Shimada, T., Fujii-Kuriyama, Y., 2004. Metabolic activation of polycyclic aromatic hydrocarbons to carcinogens by cytochromes P450 1A1 and 1B1. Cancer Sci. 95, 1–6. Shimada, T., Takenaka, S., Murayama, N., Kramlinger, V.M., Kim, J.H., Kim, D., Liu, J., Foroozesh, M.K., Yamazaki, H., Guengerich, F.P., Komori, M., 2016. Oxidation of pyrene, 1-hydroxypyrene, 1-nitropyrene and 1-acetylpyrene by human cytochrome P450 2A13. Xenobiotica 46, 211–224. Sugasawa, K., 2016. Molecular mechanisms of DNA damage recognition for mammalian nucleotide excision repair. DNA Repair (Amst). 44, 110–117. Svensson, L.M., Jemth, A.S., Desroses, M., Loseva, O., Helleday, T., Högbom, M., Stenmark, P., 2011. Crystal structure of human MTH1 and the 8-oxo-dGMP product complex. FEBS Lett. 585, 2617–2621. Takahashi, T., Morita, K., Akagi, R., Sassa, S., 2004. Heme oxygenase-1: a novel therapeutic target in oxidative tissue injuries. Curr. Med. Chem. 11, 1545–1561. Tang, J.R., Nakamura, M., Okura, T., Takata, Y., Watanabe, S., Yang, Z.H., Liu, J., Kitami, Y., Hiwada, K., 2002. Mechanism of oxidative stress-induced GADD153 gene expression in vascular smooth muscle cells. Biochem. Biophys. Res. Commun. 290, 1255––1259. Thacker, J., Zdzienicka, M.Z., 2003. The mammalian XRCC genes: their roles in DNA repair and genetic stability. DNA Repair (Amst). 2, 655–672. Trivedi, P.P., Jena, G.B., 2013. Ulcerative colitis-induced hepatic damage in mice: studies on inflammation, fibrosis, oxidative DNA damage and GST-P expression. Chem. Biol. Interact. 201, 19–30. Tsikas, D., 2016. Assessment of lipid peroxidation by measuring malondialdehyde (MDA) and relatives in biological samples: analytical and biological challenges. Anal. Biochem. 30357–30358 S0003-2697. Valdivia, A., Pérez-Alvarez, S., Aroca-Aguilar, J.D., Ikuta, I., Jordán, J., 2009. Superoxide dismutases: a physiopharmacological update. J. Physiol. Biochem. 65, 195–208. Varga, C., Szendi, K., 2006. In vivo mutagenicity of the carcinogenic 1–nitropyrene: a model of a potential asbestos exposure. Magy. Onkol. 50, 337–340. Wang, W., Jariyasopit, N., Schrlau, J., Jia, Y., Tao, S., Yu, T.W., Dashwood, R.H., Zhang, W., Wang, X., Simonich, S.L., 2011. Concentration and photochemistry of PAHs NPAHs, and OPAHs and toxicity of PM2.5 during the Beijing Olympic Games. Environ. Sci. Technol. 45, 6887–6895. Watt, D.L., Utzat, C.D., Hilario, P., Basu, A.K., 2007. Mutagenicity of the 1-nitropyreneDNA adduct N-(deoxyguanosin-8-yl)-1-aminopyrene in mammalian cells. Chem. Res. Toxicol. 20, 1658–1664. Weiss, C.N., Ito, K., 2014. DNA damage response, redox status and hematopoiesis. Blood Cells Mol. Dis. 52, 12–18. Xia, Q., Yin, J.J., Zhao, Y., Wu, Y.S., Wang, Y.Q., Ma, L., Chen, S., Sun, X., Fu, P.P., Yu, H., 2013. UVA photoirradiation of nitro-polycyclic aromatic hydrocarbons-induction of reactive oxygen species and formation of lipid peroxides. Int. J. Environ. Res. Public Health 10, 1062–1084. Xie, J., Fan, R., Meng, Z., 2007. Protein oxidation and DNA-protein crosslink induced by sulfur dioxide in lungs livers, and hearts from mice. Inhal. Toxicol. 19, 759–765. Yang, X., Igarashi, K., Tang, N., Lin, J.M., Wang, W., Kameda, T., Toriba, A., Hayakawa, K., 2010. Indirect- and direct-acting mutagenicity of diesel: coal and wood burningderived particulates and contribution of polycyclic aromatic hydrocarbons and nitropolycyclic aromatic hydrocarbons. Mutat. Res. 695, 29–34.
Hayakawa, K., 2016. Environmental behaviors and toxicities of polycyclic aromatic hydrocarbons and nitropolycyclic aromatic hydrocarbons. Chem. Pharm. Bull. (Tokyo) 64, 83––94. He, X., Feng, S., 2015. Role of metabolic enzymes P450 (CYP) on activating procarcinogen and their polymorphisms on the risk of cancers. Curr. Drug Metab. 16, 850–863. Hrycay, E.G., Bandiera, S.M., 2015. Involvement of cytochrome P450 in reactive oxygen species formation and cancer. Adv. Pharmacol. 74, 35–84. Huang, S., Hu, J., 2014. Oxidative stress induced by exogenous chemicals mediated by oxidative metabolic enzymes. Chin. J. Ind. Hyg. Occup. Dis. 2, 549–554. IARC, 2013. 1-Nitropyrene. IARC Monogr. Eval. Carcinog. Risks Hum. 105, 621––688. IARC, 2017. Working group on the evaluation of carcinogenic risks to humans. diesel and gasoline engine exhausts and some nitroarenes. IARC Monogr. Eval. Carcinog. Risks Hum. 105, 9–699. IARC, 2016. Agents Classified by the IARC Monographs 1–115. pp. 10. Imaida, K., Lee, M.S., Land, S.J., Wang, C.Y., King, C.M., 1995. Carcinogenicity of nitropyrenes in the newborn female rat. Carcinogenesis 16, 3027–3030. Iwanari, M., Nakajima, M., Kizu, R., Hayakawa, K., Yokoi, T., 2002. Induction of CYP1A1, CYP1A2, and CYP1B1 mRNAs by nitropolycyclic aromatic hydrocarbons in various human tissue-derived cells: chemical- cytochrome P450 isoform-, and cell-specific differences. Arch. Toxicol. 76, 287–298. Jariyasopit, N., Zimmermann, K., Schrlau, J., Arey, J., Atkinson, R., Yu, T.W., Dashwood, R.H., Tao, S., Simonich, S.L., 2014. Heterogeneous reactions of particulate matterbound PAHs and NPAHs with NO3/N2O5 OH radicals, and O3 under simulated longrange atmospheric transport conditions: reactivity and mutagenicity. Environ. Sci. Technol. 48, 10155–10164. Kim, Y.D., Ko, Y.J., Kawamoto, T., Kim, H., 2005. The effects of 1-nitropyrene on oxidative DNA damage and expression of DNA repair enzymes. J. Occup. Health 47, 261–266. Laing, S., Wang, G., Briazova, T., Zhang, C., Wang, A., Zheng, Z., Gow, A., Chen, A.F., Rajagopalan, S., Chen, L.C., Sun, Q., Zhang, K., 2010. Airborne particulate matter selectively activates endoplasmic reticulum stress response in the lung and liver tissues. Am. J. Physiol. Cell Physiol. 299, C736–C749. Lee, C.Y., Lee, M.G., Choi, K.C., Kang, H.M., Chang, Y.S., 2012. Clinical significance of GADD153 expression in stage I non-small cell lung cancer. Oncol. Lett. 4, 408–412. Li, R., Kou, X., Geng, H., Xie, J., Yang, Z., Zhang, Y., Cai, Z., Dong, C., 2015. Effect of ambient PM2.5 on lung mitochondrial damage and fusion/fission gene expression in rats. Chem. Res. Toxicol. 28, 408–418. Lin, Y., Ma, Y., Qiu, X., Li, R., Fang, Y., Wang, Y., Zhu, Y., Hu, D., 2015a. Sources, transformation, and health implications of PAHs and their nitrated hydroxylated, and oxygenated derivatives in PM2.5 in Beijing. J. Geophys. Res. Atmos. 120, 7219–7228. Lin, Y., Qiu, X., Ma, Y., Ma, J., Zheng, M., Shao, M., 2015b. Concentrations and spatial distribution of polycyclic aromatic hydrocarbons (PAHs) and nitrated PAHs (NPAHs) in the atmosphere of North China, and the transformation from PAHs to NPAHs. Environ. Pollut. 196, 164–170. Ma, N., Bian, W., Li, R., Geng, H., Zhang, J., Dong, C., Shuang, S., Cai, Z., 2015. Quantitative analysis of nitro-polycyclic aromatic hydrocarbons in PM2.5 samples with graphene as a matrix by MALDI–TOF MS. Anal. Methods 7, 3967–3971. Martínez-González, I., Cruz, M.J., Moreno, R., Morell, F., Muñoz, X., Aran, J.M., 2014. Human mesenchymal stem cells resolve airway inflammation, hyperreactivity, and histopathology in a mouse model of occupational asthma. Stem Cells Dev. 23, 2352–2363. Moller, P., Danielsen, P.H., Karottki, D.G., Jantzen, K., Roursgaard, M., Klingberg, H., Jensen, D.M., Christophersen, D.V., Hemmingsen, J.G., Cao, Y., Loft, S., 2014. Oxidative stress and inflammation generated DNA damage by exposure to air pollution particles. Mutat. Res. 762, 133–166. Nakabeppu, Y., 2001. Regulation of intracellular localization of human MTH1, OGG1, and MYH proteins for repair of oxidative DNA damage. Prog. Nucleic Acid Res. Mol. Biol. 68, 75–94. Nakamura, Y., Miyamoto, M., Murakami, A., Ohigashi, H., Osawa, T., Uchida, K.A., 2003. Phase II detoxification enzyme inducer from lemongrass: identification of citral and involvement of electrophilic reaction in the enzyme induction. Biochem. Biophys. Res. Commun. 302, 593–600. Oyadomari, S., Mori, M., 2004. Roles of CHOP/GADD153 in endoplasmic reticulum
20
Contents lists available at ScienceDirect
Environmental Toxicology and Pharmacology journal homepage: www.elsevier.com/locate/etap
Research Paper
DNA damage and repair, oxidative stress and metabolism biomarker responses in lungs of rats exposed to ambient atmospheric 1-nitropyrene ⁎
Ruijin Lia, Lifang Zhaoa, Li Zhanga, Minghui Chena, Chuan Donga, , Zongwei Caib,
MARK
⁎⁎
a
Institute of Environmental Science, Shanxi University, Taiyuan, PR China State Key Laboratory of Environmental and Biological Analysis, Department of Chemistry, Hong Kong Baptist University, Hong Kong Special Administrative Region, PR China b
A R T I C L E I N F O
A B S T R A C T
Keywords: 1-Nitropyrene DNA damage and repair Rat lungs Oxidative stress Metabolic enzymes
1-Nitropyrene (1-NP) is a mutagenic and carcinogenic pollutant very widespread in the environment. However, the relative investigations on genotoxicity, oxidative stress and metabolic enzymes in lungs of mammalian caused by 1-NP have not been fully established. In this study, the 1-NP solutions at 3 dosages (1.0 × 10−5, 4.0 × 10−5 and 1.6 × 10−4 mg/kg body weight) were respectively given to rats by the intratracheal instillation. The responses of 1-NP on DNA damage and repair, oxidative stress and metabolism biomarkers in rat lungs after exposure to 1-NP were measured. The results showed 1-NP at three dosages induced obvious DNA strand breaks, 8-OH-dG formation and DNA-protein cross-link in rat lungs compared with the control. Higher dosage 1NP (4.0 × 10−5 and 1.6 × 10−4 mg/kg body weight) greatly activated DNA repair gene OGG1 and inhibited MTH1 and XRCC1 expressions, and they significantly elevated the levels of GADD153, heme oxygenase-1 and malondialdehyde and decreased SOD activity, accompanied by the increases of CYP450, CYP1A1, CYP1A2 and GST levels. These results suggested the genotoxicity of 1-NP might rely on 1-NP-caused DNA damage and its combined effects on the suppression of DNA repair and the enhancement of oxidative stress and metabolic enzyme activity.
1. Introduction Nitro-polycyclic aromatic hydrocarbons (NPAHs) are widespread in the air environment mainly from two major sources: direct emissions (e.g., from coal combustion, diesel engines, cigarette smoke, cooked meat products and biomass burning), and secondary formation through atmospheric reactions of polycyclic aromatic hydrocarbons (PAHs) and nitrogen dioxide (Lin et al., 2015a). In particular, they were ubiquitously identified in the atmosphere and ambient fine particulate matter (PM2.5) in America, Europe and Asia (Ringuet et al., 2012; Jariyasopit et al., 2014), with relatively higher levels of NPAHs in PM2.5 were found in East Asia including China, Russia, Korea and Japan (Lin et al., 2015a, 2015b; Hayakawa, 2016). NPAHs arouse extensive concern primarily because they not only are wide-spread environmental pollutants, but also possess much higher direct-acting mutagenicity and carcinogenicity than the parent PAHs, especially related to the development of lung, skin and bladder cancer (Yang et al., 2010; Wang et al., 2011; IARC, 2014). 1-Nitropyrene (1-NP), a representative of NPAHs and the most abundant NPAH, has been detected in many
⁎
environmental samples including air particulate, coal combustion fly ash, diesel engine exhaust, cigarette smoke (Albinet et al., 2007; Ding et al., 2012; IARC, 2013). It has been listed as an IARC Group 2A carcinogen (IARC, 2016), indicating it is possibly carcinogenic to humans and has potential respiratory health risks. From laboratory experimental data, 1-NP was found to be mutagenic in mutagenicity test using bacteria and mammalian cells (Varga and Szendi, 2006; Watt et al., 2007), and mammary tumors were induced in rats treated with 1-NP for 86 weeks (Imaida et al., 1995). 1-NP enhanced pro-inflammatory gene expression in cultured BEAS-2B cells and generated excessive 8-hydroxydeoxyguanosine (8-OH-dG) and reactive oxygen species (ROS) in A549 cells (Kim et al., 2005; Park and Park, 2009). Genotoxicity is refers to the property of chemical agents that may damage the genetic information (such as DNA or chromosome) within a cell, causing mutations (which may lead to cancer). However, to our best knowledge, studies on the genotoxicity roles of 1-NP are relatively shortage, therefore evaluating the genotoxicity of 1-NP and investigating the related mechanisms are vital to reveal the environmental health hazards of 1-NP.
Corresponding author at: Institute of Environmental Science, Shanxi University, 92 Wucheng Road, Taiyuan 030006, Shanxi Province, PR China. Corresponding author at: State Key Laboratory of Environmental and Biological Analysis, Department of Chemistry, Hong Kong Baptist University, Kowloon Tong, Kowloon, Hong Kong Special Administrative Region, PR China. E-mail addresses: [email protected] (C. Dong), [email protected] (Z. Cai). ⁎⁎
http://dx.doi.org/10.1016/j.etap.2017.06.009 Received 17 March 2017; Received in revised form 17 May 2017; Accepted 19 June 2017 Available online 20 June 2017 1382-6689/ © 2017 Published by Elsevier B.V.
Environmental Toxicology and Pharmacology 54 (2017) 14–20
R. Li et al.
respectively every other day for 10 days. The research revealed that no histopathological abnormalities were observed in lung tissues of the control mice after administration of 5% DMSO (Martínez-González et al., 2014). All animal procedures were approved by the Shanxi University Animal Investigational Committee and performed in accordance with the Guide for the Care and Use of Laboratory Animals published by Ministry of Health People’s Republic of China. In this study, the concentration of 3.04 ng/m3 of 1-NP, which was detected in PM2.5 sample in Taiyuan of China (Ma et al., 2015), was used to estimate the 1-NP instillation dosage for each rat every 2 days as about 1.0 × 10−5 mg/kg b.w. by taking the respiratory volume limit of an adult rat (200 mL/min, 200 g/rat) into account. Moreover, according to the orange alert criterion of haze PM2.5 in China (500 μg/m3) and the approximate proportion of mass concentration of NPAHs in wintertime PM2.5 ranging from 9 × 10−6 to 1 × 10−4 (Lin et al., 2015a), 4.0 × 10−5 mg/kg b.w. of 1-NP dosage was used when 2.7 × 10−5 of 1-NP proportions in PM2.5 were chosen. Based on above considerations and requirement of dose-response relationship experiment design, three concentrations of 1-NP were selected to be 1.0 × 10−5, 4.0 × 10−5 and 1.6 × 10−4 mg/kg b.w. in this study. After the last treatment, rats in different groups were euthanized and sacrificed, and then a piece of fresh lung tissue per rat was minced and grinded for comet assay, another part was homogenized for ELISA and biochemical analysis, and the rest lung tissue was quickly frozen in liquid nitrogen and then stored at −80 °C for mRNA and protein measurement.
Lung is a target organ that encounters most environmental chemicals. Previous studies indicated that the genotoxicity of environmental pollutants was linked to oxidative stress and DNA damage caused by the chemicals (Risom et al., 2005; Hanot-Roy et al., 2016), and related to the upregulation of metabolic enzymes (Shah et al., 2016). Generally, phase I xenobiotic-metabolizing enzymes like in particular cytochromes P450 (CYP450) and phase II enzymes including glutathione S-transferase (GST) may undergo a process of biotransformation and catalysis, accompanied by the formation of metabolites or intermediates, in which some metabolic active intermediates may mediate oxidative and reactive with DNA highly (Huang and Hu, 2014). In some cases, intermediates like ROS are produced in the process of metabolic bioactivation mediated by CYP450, triggering oxidative stress and leading to DNA damage if it is not repaired before replication (Moller et al., 2014; Hrycay and Bandiera, 2015). Notably, DNA repair genes play important roles in DNA damage repair processes. If normal DNA repair processes fail, DNA damage may occur (Sugasawa, 2016). Taken together, lung genotoxicity induced by chemicals is comprehensive and complex, in which DNA damage, oxidative stress, and metabolic disturbance are interrelated. As a PM2.5-bound NPAH component, 1-NP could be oxidized by human P450 2A13 to form mono- and di-oxygenated products (Shimada et al., 2016). It could generate ROS in A549 cells and induce DNA damage along with the slower rate of DNA repair (Kim et al., 2005; Andersson et al., 2009). However, the detailed mechanisms of DNA damage and repair, oxidative stress and metabolic activation in laboratory animals induced by 1-NP have not fully been investigated so far. Accordingly, in this study, we focused on the DNA damage markers like DNA strand breaks, 8-OH-dG and DNA-protein cross-link (DPC), and multiple DNA damage repair genes, such as 8-Oxoguanine DNA glycosylase (OGG1), MutT Homolog 1 (MTH1) and X-ray repair crosscomplementing group 1 (XRCC1), which were have been demonstrated to play key roles in DNA repair processes and be involved in mammalian nucleotide excision repair (Thacker and Zdzienicka, 2003; Nakabeppu, 2001). Meanwhile, growth arrest- and DNA damage-inducible gene 153 (GADD153) can be highly promoted when DNA damage or oxidative stress is initiated by envionmental pollutants (Fontanier-Razzaq et al., 2001; Tang et al., 2002), while heme oxygenase 1 (HMOX-1), superoxide dismutase (SOD) and malonaldehyde (MDA) may be obviously induced when oxidative stress occurs in the cells under the oxide stimulus (Takahashi et al., 2004; Tsikas, 2016). So GADD153, HMOX-1, SOD and MDA were used as the inducible and typical factors to explore the oxidative stress in rat lungs induced by 1NP. In addition, the changes of phase I enzymes CYP450s isoforms (CYP1A1 and 1A2) and phase II enzyme GST in rat lungs were investigated to indicate the lung metabolic characteristic of 1-NP. Our data will clarify the toxicological roles in DNA damage and repair, oxidative stress and metabolic activation induced by 1-NP in depth and will provide new insight into evaluation the genotoxicity of atmospheric 1-NP exposure.
2.2. Comet assay
2. Materials and methods
The alkaline comet assay was performed as follows. (1) Single cell suspensions were prepared in ice-cold phosphate-buffered saline (PBS) from a piece of lung (See “2.1” Section). (2) Preparation of “sandwich gel”. First layer was 1% normal melting-point agarose (NMA) in a slide; second layer was the mixture of cell/0.65% molten low melting-point agarose (LMA), third layer was 0.65% LMA. (3) The slides containing “sandwich gel” were transferred to cold lysis solution (2.5 mM NaCl, 100 mM EDTA, 1% sodium sarcosinate and 10 mM Tris, pH 10.0, to which 1% Triton X-100 and 10% DMSO were freshly added) for 60 min at 4 °C to cause denaturation. (4) The slides were then subjected to electrophoresis with cold electrophoreses buffer (300 mM NaOH, 1 mM EDTA, pH 13.0) at 25 V for 30 min at 4 °C, and immersed in Tris buffer (0.4 M Tris, pH 7.5) to neutralize the excess alkali. Subsequently the slides were air dried. (5) DNA was stained with 100 μL 4S Red Plus (Shengon, Shanghai, China, 1:10,000) for 20 min and immediately rinsed with Milli-Q water and air dried. (6) Slides were examined at 400× magnification using an Olympus BX51 fluorescence microscope (Olympus, Tokyo, Japan). 20–30 randomly acquired images of microscopic fields compared to each sample were recorded to enable analysis of 100–150 cells. (7) DNA damage indexes including comet tail DNA%, tail length, and olive tail moment (OTM) were assessed by a Comet Assay Software Project (CASP, CASP, version 1.2.3 beta1).
2.1. Animal and treatment protocols
2.3. Real time quantitative RT-PCR
Male Wistar rats (body weight 180–200 g) were obtained from Animal Center of Hebei Medical University (Shijiazhuang, China) and bred in an animal house in Institute of Environmental Science of Shanxi University (Taiyuan, China) under standard conditions (24 °C ± 2 °C and 50% ± 5% humidity). Animals received food and water ad labium, except during the exposure period. Rats were divided randomly into four equal groups with five animals for each group: (1) the control (5% dimethyl sulfoxide, DMSO), (2) low dose 1-NP group (1.0 × 10−5 mg/kg b.w. 1-NP in DMSO), (3) medium dose 1-NP group (4.0 × 10−5 mg/kg b.w. 1-NP in DMSO, and (4) high dose 1-NP group (1.6 × 10−4 mg/kg b.w. 1-NP in DMSO). The rats were administered using 5% DMSO and 1-NP solutions by intratracheal instillation
Lung tissues (See “2.1” Section) in different group rats were used to mRNA extraction and quantitative RT-PCR analysis of tested genes and housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was referenced as described previously (Li et al., 2015). Expression levels were assessed by real-time PCR in an iCycler iQ Real Time PCR Detection System (Bio-Rad, Richmond, CA, USA) with the Quantitect SYBRGreen I PCR kit. The GenBank accession numbers and the primer sequences of the tested genes with the PCR product amplified fragments and annealing temperature are listed in Table 1. The relative quantification of the expression of the target genes was measured using GAPDH mRNA as an internal control. The copy numbers of target gene/GAPDH mRNA ratio were measured in all samples. 15
Environmental Toxicology and Pharmacology 54 (2017) 14–20
R. Li et al.
Table 1 Primer sequences and the PCR product amplified fragments used in real-time RT-PCR. Genes
Accession No.
Sequence
MTH1 Products GADD153 Products XRCC1 Products OGG1 Products HO-1 Products CYP1A1 Products CYP1A2 Products GAPDH Products
NM_057120 148 bp, 60 °C RNU30186 110 bp, 60 °C NM_053435 195 bp, 60 °C NM_030870 195 bp, 60 °C BC091164 77 bp, 58 °C NM_012540 109 bp, 56 °C NM_012541 99 bp, 56 °C NM_017008 78 bp, 56 °C
Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer Forward primer Reverse primer
5′-AGTGAAGAAATGCGCCCTCA-3′ 5′- TGAGGATGGTGTCCTGACCA -3′ 5′-GTCACAAGCACCTCCCAAAG-3′ 5′-CCACTCTGTTTCCGTTTCCT-3′ 5′- GATGGGGAACAGTCAGAAGGAC-3′ 5′- AATTGGCAGGTCAGCCTCTG-3′ 5′-CAACATTGCTCGCATCACTGG-3′ 5′-ATGGCTTTAGCACTGGCACATACA-3′ 5′-GTCAAGCACAGGGTGACAGA-3′ 5′-ATCACCTGCAGCTCCTCAAA-3′ 5′-TAACTCTTCCCTGGATGCCTTCAA-3′ 5′-GTCCCGGATGTGGCCCTTCTCAAA-3′ 5′-ACCCTGAGTGAGAAGGTGAT-3′ 5′-GAGGATGGCTAAGAAGAGGA-3′ 5′-ATGTATCCGTTGTGGATCTGAC-3′ 5′-CCTGCTTCACCACCTTCTTG-3′
DNA (free DNA plus DPC) was calculated. The results were expressed as percentage (DPC coefficient) of DPC on total DNA.
2.4. Western blotting Total proteins for MTH1, GADD153, XRCC1 and actin from frozen lung tissues were respectively extracted with protein extraction kit (Beyotime, Shanghai, China) according to the manufacturer’s instructions. Samples were mixed with loading buffer and boiled for 5 min. Western blot analysis of MTH1, GADD153, XRCC1 and actin was performed, and the rabbit polyclonal primary antibodies for rat MTH1 (Sc67291, dilution ratio 1:100), GADD153 (Sc-575, dilution ratio 1:100), XRCC1 (Sc-11429, dilution ratio 1:100) (Santa Cruz, CA, USA) and actin (AB10024, dilution ratio 1:3000, Sangon, Shanghai, China) were incubated overnight at 4 °C, whereas the infrared-labeled goat antirabbit secondary antibody (AlexaFlor 680 goat anti-rabbit IgG (H + L), USA) at a concentration of 1:20,000 were added to membranes and incubated for 1.5 h at room temperature. The membranes were scanned and the band densities were quantified using the Odyssey Infrared Imaging System (Li-COR Biosciences, USA). The blank tests in which PBS replaced specific antibodies were performed, and no false positive protein bands were found.
2.7. Statistical analysis Data were expressed as means ± SD and evaluated for statistical significance with one-way ANOVA using the SPSS19.0. Post hoc tests were conducted to determine the difference between the groups, followed by Fisher’s least significant difference (LSD) test. A level of P < 0.05 was accepted as statistically significant. The correlations of lung damage effects between 1-NP concentrations and DNA damage or metabolic enzyme responses were evaluated by using correlation analysis. A positive correlation is indicated by correlation coefficient (r) > 0.8. 3. Results 3.1. DNA damage effects induced by 1-NP in rat lungs As shown in Table 2, 1-NP at all doses tested significantly increased the values of three DNA damage markers in lung cells compared with the control (P < 0.01). 1-NP at all doses tested caused significant increases in Tail DNA%, OTM and Tail length values of lung cells in a dose-dependent manner (correlation coefficient, r = 0.87–0.98). Fig. 1 displays that 1-NP at higher doses (4 × 10−5 mg/kg b.w. and 1.6 × 10−4 mg/kg b.w.) significantly increased DPC levels in the lungs compared with the control (P < 0.05), and such increases induced by 1-NP had an obvious positive concentration-effect relationship (r = 0.73). In addition, 8-OH-dG levels were statistically raised in lungs of rats treated with the highest dose 1-NP (P < 0.01). No significant differences were observed in present of 1-NP at the dosages of 1.0 × 10−5 mg/kg and 4.0 × 10−5 mg/kg. 1-NP caused an increase of 8-OH-dG formation with a concentration-dependent property (r = 0.94).
2.5. ELISA assay The lung tissue was weighed and homogenized in ice-cold 0.9% physiological saline. After the homogenized solutions were centrifuged for 10 min at 3000 rpm (4 °C), the lung supernatants were collected. The levels of CYP1A1, CYP1A2, OGG1, HMOX-1 and 8-OH-dG in lung supernatants were measured using rat ELISA kit (R & D Systems, Minneapolis, MN, USA), and the level of CYP450s was detected using rat ELISA kit from the Beijing Fangcheng Biochemistry, China, according to the manufacturer’s instructions. 2.6. Measurement of SOD, MDA, GST and DPC The levels of SOD, MDA and GST in lung tissue homogenates were measured using the corresponding kits from the Nanjing Jiancheng Biochemistry, China according to the manufacturer’s protocols. DPC levels were detected as described previously (Xie et al., 2007). In brief, DPC was detected using sodium dodecylsulphate (SDS)-KCl fluorescence spectrometry. Lung supernatant was treated with SDS-KCl system, and then centrifuged. The new supernatant contains the unbound fraction of DNA (free DNA) while the SDS-KCl precipitate contains the protein and DPC complexes. After Hoechst 33258 was added to the free DNA sample and DPC sample, fluorescence signals of free DNA and DPC samples were measured at an excitation wavelength of 350 nm and an emission wave length of 460 nm (Hitachi F-4500, Tokyo, Japan). The ratio of the fluorescence of DPC to that of the total
3.2. DNA repair gene expression induced by 1-NP in rat lungs On the basis of our data in Fig. 2A, 1-NP at the higher dosages (4 × 10−5 and 1.6 × 10−4 mg/kg b.w.) significantly increased the OGG1 mRNA levels whereas decreased MTH1 and XRCC1 mRNA levels in the lungs of rats compared with the control (P < 0.05 or P < 0.01). In Fig. 2B, the elevation of OGG1 protein levels and the reduction of MTH1 and XRCC1 protein levels had a similar variation tendency to the mRNA changes in response to the higher dose exposure to 1-NP (4.0 × 10−5 and/or 1.6 × 10−4 mg/kg b.w.) compared to the control (P < 0.05 or P < 0.01). Gene expressions of 3 genes above were not 16
Environmental Toxicology and Pharmacology 54 (2017) 14–20
R. Li et al.
Table 2 Tail DNA%, tail length and OTM results in the lungs of rats from different groups. The values are expressed as means ± SD from three individual samples. Using one-way ANOVA, comparing with control group, significant difference is indicated by bP < 0.01. Groups (mg/kg b.w1-NP)
Tail DNA (%)
Tail length (μm)
OTM
0 1.0 × 10−5 4.0 × 10−5 1.6 × 10−4 Correlation coefficient (r) 0
0.60 ± 0.26 2.33 ± 1.15b 3.08 ± 0.99b 5.8 ± 2.28b 0.95 1.0 × 10−5
3.09 ± 0.38 4.07 ± 1.34b 5.40 ± 1.88b 8.59 ± 2.66b 0.98 4.0 × 10−5
0.17 ± 0.06 0.76 ± 0.14b 1.12 ± 0.55b 1.55 ± 0.48b 0.87 1.6 × 10−4 mg/kg 1-NP
Fig. 1. Levels of 8-OHdG and DPC in the lungs of rats of different groups. The values are expressed as means ± SD from five individual samples. Using one-way ANOVA, comparing with control group, significant difference is indicated by *P < 0.05 and **P < 0.01.
significant in the presence of 1-NP at dose of 1.0 × 10−5 mg/kg b.w. (P > 0.05). 1-NP caused the increases in OGG1 expressions in lungs in a dose-dependent manner (r = 0.81 and 0.97), while 1-NP caused the decreases in MTH1 and XRCC1 expressions with a concentration-dependent property (r = 0.76–0.90). 3.3. Effects of 1-NP on markers of oxidative stress in rat lungs In Fig. 3, compared with the control, the higher doses of 1-NP (4.0 × 10−5 and/or 1.6 × 10−4 mg/kg b.w.) markedly enhanced mRNA and protein expressions of GADD153 and HMOX-1 as well as MDA levels, and decreased the SOD activities (P < 0.05 or P < 0.01). The level changes of GADD153 and HMOX-1, MDA and SOD in the presence of 1-NP (1.0 × 10−5 mg/kg b.w.) were not statistically significant compared with the control group (P > 0.05). 1-NP increased GADD153 and HMOX-1 levels and decrease SOD activity in dose-dependent manner, respectively (r = 0.70–0.94).
Fig. 2. Expression of mRNA (A) and protein (B) of OGG1, MTH1, and XRCC1 in rat lungs treated with 1-NP. Mean expression of mRNA in each treated group is shown as increase compared to mean expression in control group which has been ascribed an arbitrary value of 1. The values are expressed as means ± SD from five individual samples. Using oneway ANOVA, comparing with control group, significant difference is indicated by *P < 0.05 and **P < 0.01.
3.4. Effects of 1-NP on metabolic enzymes in lungs of rats
alterations of GST activities in lungs induced by 1.0 × 10−5 and 4.0 × 10−5 mg/kg b.w 1-NP were not significant. 1-NP increased phase I enzyme CYP450 and phase II enzyme GST activities in dose-dependent manner (r = 0.89 and 0.99). Also, in Table 3, CYP1A1 and 1A2 mRNA levels in lungs of rats were obviously raised in the presence of 1-NP at doses of 4.0 × 10−5 and 1.6 × 10−4 mg/kg b.w. compared to the control (P < 0.05 or P < 0.01), and two gene protein levels induced by 1.6 × 10−4 mg/kg
As shown in Table 3, CYP450 activities in the presence of 1-NP at 4.0 × 10−5 and 1.6 × 10−4 mg/kg b.w. concentration were statistically high versus the control (P < 0.01), whereas no statistic changes of CYP450 activity in lung at 1.0 × 10−5 mg/kg b.w 1-NP were observed compared with the control. GST activity was 53.3 U per mg protein in the present of 1.6 × 10−4 mg/kg b.w. 1-NP, and such change was significantly higher than that of control (P < 0.01). The 17
Environmental Toxicology and Pharmacology 54 (2017) 14–20
R. Li et al.
were elevated, 1-NP caused obvious DNA damage responses, which underlying mechanisms may be linked with DNA repair inhibition, oxidative stress and dysfunction of metabolic enzymes. Firstly, multiple DNA repair genes such as OGG1, MTH1 and XRCC1 have been emonstrated to play important roles in DNA repair processes and be involved in mammalian nucleotide excision repair (Nakabeppu, 2001; Thacker and Zdzienicka, 2003). They are able to repair massive amounts of DNA damage and considered to be the good biomarkers involved in the early biological effects of DNA-damaging agents. If the DNA damage is not repaired before replication, the accumulation of DNA damage such as DNA strand breaks and 8-OH-dG formation along with the unrepaired or mispairing bases can cause mutations, leading to possibly disease (Clancy, 2008). Among DNA repair genes, for example, OGG1, as a DNA glycosylase, is a base excision repair (BER) enzyme that may recognize and remove the altered base like 8-OH-dG in the BER pathway (Boiteux and Radicella, 2000). MTH1 protein may effectively catalyze the hydrolysis of 8-oxo-dGTP to 8-oxodGMP, thereby preventing 8-oxo-dGTP misincorporation into DNA (Svensson et al., 2011). As a scaffolding protein, XRCC1 plays a major role in BER and single strand break repair pathways via an ability to interact with multiple enzymatic components of repair reactions such as DNA polymerase beta, DNA ligase III and Poly (ADP-ribose) polymerases (PARP) (Hanssen-Bauer et al., 2012), which have a positive regulation role in DNA repair process. Based on our results, higher dosage 1-NP induced OGG1 over-expression in lungs of rats in order to enhance the capability of removing 8-OH-dG, but inhibited MTH1 and XRCC1 to suppress the roles of catalyzing the hydrolysis from 8-oxo-dGTP to 8-oxodGMP and repairing BER and SSBR, leading to DNA strand breaks and 8-OH-dG formation. It suggests the inhibition roles induced by 1-NP on MTH1 and XRCC1 are greater than the enhancement roles did by 1-NP on OGG1. Considering that the complicated roles of DNA repair genes in the regulation of DNA damage responses, further in-depth work is needed to investigate the underlying molecular mechanisms of 1-NP on DNA damage and repair. Secondly, GADD153 can be highly promoted when endoplasmic reticulum stress and oxidative stress and DNA damage are initiated by chemicals (Fontanier-Razzaq et al., 2001; Tang et al., 2002; Oyadomari and Mori, 2004), and it may be a valuable prognostic factor of earlystage non-small cell lung cancer in patients and has potentially clinical significance (Lee et al., 2012). It was reported that ambient PM2.5 exposure activated GADD153 in lungs of mice (Laing et al., 2010), whereas whether 1-NP may enhance GADD153 is still not clear. In this study, accompanied with DNA damage response, the GADD153 expression in rat lungs was obviously induced by higher concentration 1NP (4.0 × 10−5 and 1.6 × 10−4 mg/kg b.w.). It suggests that severe 1NP pollution can mount an active response of GADD153 along with DNA damage and GADD153 can be used as a sensitive marker for the evaluation of DNA damage induced by 1-NP. It is a remarkable fact that the redox status has close links with DNA damage response (Weiss and Ito, 2014). Among the influential factors of cellular redox status, the inducible antioxidant enzyme HMOX-1, the rate-limiting enzyme in charge of heme degradation, exerts
Fig. 3. GADD153 and HMOX-1 mRNA and protein levels, SOD activities and MDA contents in rat lungs treated with 1-NP. Mean expression of mRNA in each treated group is shown as increase compared to mean expression in control group which has been ascribed an arbitrary value of 1. The values are expressed as means ± SD from five individual samples. Using one-way ANOVA, comparing with control group, significant difference is indicated by *P < 0.05 and **P < 0.01.
b.w. of 1-NP were significantly elevated compared with the control (P < 0.05 or P < 0.01). 1-NP increased CYP1A1 and CYP1A2 mRNA and protein levels in dose-dependent manner (r = 0.70–0.99). No significant changes of the CYP1A1 and CYP1A2 levels were observed in the rats exposed to 1-NP at the concentration of 1.0 × 10−5 mg/kg b.w. compared to that in the control (P > 0.05). 4. Discussion NPAHs in PM2.5 are released from the incomplete combustion of fossil fuel and from the photochemistry reaction of PAHs with nitrogen dioxide. Some of them have been proven to have mutagenicity and potential carcinogenicity, thus NPAHs-induced health risks have aroused general concern. 1-NP is a typical biomarker of PM2.5-bound NPAHs because of its higher exposure levels. As an IARC Group 2A carcinogen (IARC, 2016), the genotoxicity of 1-NP was assessed though detecting DNA strand breaks and DNA adducts in previous studies (Watt et al., 2007; Andersson et al., 2009). However, the more detailed mechanisms of genotoxictiy of 1-NP remain unclear. In the present study, we selected the typical markers about DNA damage, DNA repair genes, oxidative stress, and metabolic enzymes as the endpoints to characterize genotoxicity in lungs of rats treated with 1-NP, which aims to clarify 1-NP genotoxicty in depth and provide important experimental data for human health. Our present results revealed, under the experimental conditions, higher dosage 1-NP could induce DNA damage including DNA strand break, formation of DPC and 8-OH-dG in lung of rats, whereas no significant difference was observed in the presence of 1-NP at the dosage of 1.0 × 10−5 mg/kg. It implies, under 10 days of exposure of 1-NP with the actual ambient exposure levels, 1NP didn’t induce DNA damage. However, when the exposure doses
Table 3 Activities of CYP450s and GSTs and mRNA and protein levels of CYP1A1 and 1A2 in rat lungs treated with 1-NP. Mean expression of mRNA in each treated group is shown as increase compared to mean expression in control group which has been ascribed an arbitrary value of 1. The values are expressed as means ± SD from five individual samples. Using one-way ANOVA, comparing with control group, significant difference is indicated by aP < 0.05 and bP < 0.01. Groups (mg/kg b.w 1NP)
CYP450 (U/mg prot)
0 1.0 × 10−5 4.0 × 10−5 1.6 × 10−4 Correlation coefficient (r)
0.085 0.107 0.122 0.143 0.89
± ± ± ±
0.012 0.018 0.025b 0.017b
GST (U/mg prot)
33.2 ± 6.37 33.8 ± 6.78 39 ± 8.29 53.3 ± 12.2b 0.99
CYP1A1 mRNA (fold changed)
CYP1A2 mRNA (fold changed)
CYP1A1 protein (ng/mg prot)
CYP1A2 protein (ng/mg prot)
1.00 1.25 1.33 1.46 0.81
1.00 1.23 1.32 1.36 0.70
22.7 23.8 25.3 29.3 0.99
2 ± 0.14 2.23 ± 0.21 2.3 ± 0.27 2.55 ± 0.33b 0.91
± ± ± ±
0.2 0.21 0.26a 0.15b
18
± ± ± ±
0.1 0.25 0.15a 0.28a
± ± ± ±
3.9 3.5 3.5 5.6a
Environmental Toxicology and Pharmacology 54 (2017) 14–20
R. Li et al.
metabolic enzyme activity in lungs of rats. We propose that these effects are derived from three mechanisms: (1) the inhibition effects of MTH1 and XRCC1 expression induced by 1-NP exceed the scavenging role of OGG1 to damaged DNA, (2) 1-NP significantly induces the levels of oxidative stress factors like GADD153, HMOX-1 and MDA, along with SOD suppression, leading to oxidative stress, and (3) 1-NP markedly activates GST and CYP450 as well as CYP1A1 and CYP1A2, disturbing the biotransformation. Notably, our research clearly confirmed that 1NP induced a significant increase of lung DNA damage accompanied by decreasing DNA repair capacity, and promoting oxidative stress and metabolic enzyme activation, finally contributing to lung genotoxicity. At the same time, we realize that there is more work to be studied further. (1) Except for DNA strand breaks, DPC and 8-OH-dG, other markers to assess genotoxicity such as MN, chromosomal aberration (CA), sister chromatid exchange (SCE) induced by 1-NP need to be measured. (2) It is necessary to explore the regulation mechanisms of oxidative stress and xenobiotic-metabolizing enzyme on DNA damage caused by 1-NP. (3) More attention should be paid to the contributions of 1-NP or other NPAHs on PM2.5 lung toxicity. Accumulating more basic data will be very important to health risk of 1-NP.
cytoprotective effects in various cells (Takahashi et al., 2004), for excess of heme can catalyze ROS formation. The high-expression of HMOX-1 means, to some extent, the ROS increases and the stress response. SOD, another anti-oxidative enzyme, can scavenge superoxide radicals. When superoxide exceeds the clearance capacity of SOD and other ROS scavengers or SOD activity is inhibited, it will initiate oxidative stress or pathologic responses (Valdivia et al., 2009). Importantly, NPAHs including 1-NP were proven to generate the reactive intermediates including ROS (singlet oxygen and superoxide) and free radicals during UVA irradiation and mediate the formation of lipid peroxidation (Xia et al., 2013). ROS can be represented a molecular marker of oxidative stress related to the development of lung tumor. Additionally, 1-NP produced excessive ROS and weakened the ability to neutralize free radicals, resulting in oxidative stress. ROS can further induce DNA strand breaks, DNA oxidative damage and formation of DPC (Evans et al., 2004), which prevents chromatin development and blocks replication and transcription, in turn increasing the risk of inducing genotoxicity and involving in the aetiology of cancer (Donkena et al., 2010). As observed in Fig. 3 and Table 2, SOD was inhibited whereas HMOX-1 was activated in the lungs of rats in the presence of 1NP, along with the accumulation of the typical lipid peroxidation product MDA and DNA strand breaks, suggesting that 1-NP induced lung oxidative stress, which related to DNA damage. Thirdly, the biotransformation, which may be categorized into phase I and phase II reactions, possesses important toxicological significances, because it may either detoxify the compounds, or may produce more toxic intermediate metabolites than the parents compounds themselves. For instance, cytochrome P450 1A1 and 1A2 (CYP1A1 and 1A2) are the phase I enzymes, which can first activate xenobiotics like drugs, environmental pollutants, toxins, etc (Guengerich, 2007). It has been reported that CYP450 enzyme, CYP1A1 and 1A2 can mediate PAHs oxidation to epoxide and diol-epoxides intermediates, and convert PAHs into full carcinogens (Shimada and Fujii-Kuriyama, 2004; He and Feng, 2015). As the phase II enzymes, GSTs may catalyze the conjugation of glutathione together with the intermediates of xenobiotics from phase I reaction and produce inactive glutathione conjugates, which have more water soluble and likely eliminate from the organism (Nakamura et al., 2003). If the toxic xenobiotics could not be conjugated with glutathione and eliminated, they would attack the cellular DNA, RNA and proteins (Abraham and Singh, 1999). From another direction, the GST high expression partly means the harmful metabolite accumulation. Importantly, the literatures showed that the increases of CYP1A enzyme activity were associated with the elevated benzo(a)pyrene-DNA adduct levels (Arlt et al., 2015), while the significant increases of the DNA damage (DNA strand breaks and 8-OH-dG formation) in hepatocytes of mice induced by ulcerative colitis were accompanied with GST high-expression (Trivedi and Jena, 2013), suggesting the changes of phase I and II enzyme activities are related to DNA damage. As for 1-NP, it highly induced CYP1A1 and CYP1A2 expression in various human tissue-derived cell lines (Iwanari et al., 2002), and significantly increased hepatic GST activities in rats (Pegram and Chou, 1989). Especially, the mono- and di-oxygenated metabolites of 1-NP via CYP450 activation and adducts [N-(deoxyguanosin-8-yl)-1-aminopyrene (C8-AP-dG)] of 1-NP metabolites may be formed in the mouse lung and in mammalian cells (Watt et al., 2007; Shimada et al., 2016). In the present study, high dosage 1NP markedly increased the activities of CYP450s and GST as well as gene expression of CYP1A1 and CYP1A2 in rat lung compared with the control (See Table 3), which are consistent with the reports above. Combining this result with the responses of oxidative damage and DNA damage mediated by metabolic enzymes (Shah et al., 2016Huang et al., 2014), it implied that 1-NP may activate phase I and phase II enzymes and disturb lung metabolic process, further promoting the lung oxidative DNA damage. In conclusion, this study suggests that 1-NP exposure may cause the significant increases in the levels of DNA damage, oxidative stress, and
Conflict of interest None. Acknowledgments This research was supported by the National Natural Science Foundation of China (No. 91543202 and 21575084), HKBU Strategic Development Fund (15-1012-P04), Nature Science Foundation of Shanxi Province in China (No. 2014011036-2), and Foundation of Educational Committee of Shanxi Province in China (No. 2014110). References Abraham, S.K., Singh, S.P., 1999. Anti-genotoxicity and glutathione S-transferase activity in mice pretreated with caffeinated and decaffeinated coffee. Food Chem. Toxicol. 37, 733–739. Albinet, A., Leoz-Garziandia, E., Budzinski, H., Viilenave, E., 2007. Polycyclic aromatic hydrocarbons (PAHs), nitrated PAHs and oxygenated PAHs in ambient air of the Marseilles area (South of France): concentrations and sources. Sci. Total. Environ. 384, 280––292. Andersson, H., Piras, E., Demma, J., Hellman, B., Brittebo, E., 2009. Low levels of the air pollutant 1-nitropyrene induce DNA damage, increased levels of reactive oxygen species and endoplasmic reticulum stress in human endothelial cells. Toxicology 262, 57–64. Arlt, V.M., Krais, A.M., Godschalk, R.W., Riffo-Vasquez, Y., Mrizova, I., Roufosse, C.A., Corbin, C., Shi, Q., Frei, E., Stiborova, M., van Schooten, F.J., Phillips, D.H., Spina, D., 2015. Pulmonary inflammation impacts on CYP1A1-mediated respiratory tract DNA damage induced by the carcinogenic air pollutant benzo[a]pyrene. Toxicol. Sci. 146, 213–225. Boiteux, S., Radicella, J.P., 2000. The human OGG1 gene: structure, functions, and its implication in the process of carcinogenesis. Arch. Biochem. Biophys. 377, 1–8. Clancy, S., 2008. DNA damage & repair: mechanisms for maintaining DNA integrity. Nat. Educ. 1, 103. Ding, J., Zhong, J., Yang, Y., Li, B., Shen, G., Su, Y., Wang, C., Li, W., Shen, H., Wang, B., Wang, R., Huang, Y., Zhang, Y., Cao, H., Zhu, Y., Simonich, S.L.M., Tao, S., 2012. Occurrence and exposure to polycyclic aromatic hydrocarbons and their derivatives in a rural Chinese home through biomass fuelled cooking. Environ. Pollut. 169, 160–166. Donkena, K.V., Young, C.Y., Tindall, D.J., 2010. Oxidative stress and DNA methylation in prostate cancer. Obstet. Gynecol. Int. 302051. Evans, M.D., Dizdaroglu, M., Cooke, M.S., 2004. Oxidative DNA damage and disease: induction repair and significance. Mutat. Res. 567, 1–61. Fontanier-Razzaq, N., McEvoy, T.G., Robinson, J.J., Rees, W.D., 2001. DNA damaging agents increase gadd153 (CHOP–10) messenger RNA levels in bovine preimplantation embryos cultured in vitro. Biol. Reprod. 64 (5), 1386–1391. Guengerich, F.P., 2007. Cytochrome P450 and chemical toxicology. Chem. Res. Toxicol. 21, 70–83. Hanot-Roy, M., Tubeuf, E., Guilbert, A., Bado-Nilles, A., Vigneron, P., Trouiller, B., Braun, A., Lacroix, G., 2016. Oxidative stress pathways involved in cytotoxicity and genotoxicity of titanium dioxide (TiO2) nanoparticles on cells constitutive of alveolo-capillary barrier in vitro. Toxicol. In Vitro 33, 125–135. Hanssen-Bauer, A., Solvang-Garten, K., Akbari, M., Otterlei, M., 2012. X-ray repair cross complementing protein 1 in base excision repair. Int. J. Mol. Sci. 13, 17210––17229.
19
Environmental Toxicology and Pharmacology 54 (2017) 14–20
R. Li et al.
stress. Cell Death Differ. 11, 381–389. Park, E.J., Park, K., 2009. Induction of pro-inflammatory signals by 1-nitropyrene in cultured BEAS-2B cells. Toxicol. Lett. 184, 126–133. Pegram, R.A., Chou, M.W., 1989. Effect of nitro-substitution of environmental polycyclic aromatic hydrocarbons on activities of hepatic phase II enzymes in rats. Drug Chem. Toxicol. 12, 313–326. Ringuet, J., Albinet, A., Leoz-Garziandia, E., Budzinski, H., Villenave, E., 2012. Diurnal/ nocturnal concentrations and sources of particulate–bound PAHs, OPAHs and NPAHs at traffic and suburban sites in the region of Paris (France). Sci. Total. Environ. 437, 297–305. Risom, L., Møller, P., Loft, S., 2005. Oxidative stress-induced DNA damage by particulate air pollution. Mutat. Res. 592, 119–137. Shah, U.K., Seager, A.L., Fowler, P., Doak, S.H., Johnson, G.E., Scott, S.J., Scott, A.D., Jenkins, G.J., 2016. A comparison of the genotoxicity of benzo[a]pyrene in four cell lines with differing metabolic capacity. Mutat. Res. 808, 8–19. Shimada, T., Fujii-Kuriyama, Y., 2004. Metabolic activation of polycyclic aromatic hydrocarbons to carcinogens by cytochromes P450 1A1 and 1B1. Cancer Sci. 95, 1–6. Shimada, T., Takenaka, S., Murayama, N., Kramlinger, V.M., Kim, J.H., Kim, D., Liu, J., Foroozesh, M.K., Yamazaki, H., Guengerich, F.P., Komori, M., 2016. Oxidation of pyrene, 1-hydroxypyrene, 1-nitropyrene and 1-acetylpyrene by human cytochrome P450 2A13. Xenobiotica 46, 211–224. Sugasawa, K., 2016. Molecular mechanisms of DNA damage recognition for mammalian nucleotide excision repair. DNA Repair (Amst). 44, 110–117. Svensson, L.M., Jemth, A.S., Desroses, M., Loseva, O., Helleday, T., Högbom, M., Stenmark, P., 2011. Crystal structure of human MTH1 and the 8-oxo-dGMP product complex. FEBS Lett. 585, 2617–2621. Takahashi, T., Morita, K., Akagi, R., Sassa, S., 2004. Heme oxygenase-1: a novel therapeutic target in oxidative tissue injuries. Curr. Med. Chem. 11, 1545–1561. Tang, J.R., Nakamura, M., Okura, T., Takata, Y., Watanabe, S., Yang, Z.H., Liu, J., Kitami, Y., Hiwada, K., 2002. Mechanism of oxidative stress-induced GADD153 gene expression in vascular smooth muscle cells. Biochem. Biophys. Res. Commun. 290, 1255––1259. Thacker, J., Zdzienicka, M.Z., 2003. The mammalian XRCC genes: their roles in DNA repair and genetic stability. DNA Repair (Amst). 2, 655–672. Trivedi, P.P., Jena, G.B., 2013. Ulcerative colitis-induced hepatic damage in mice: studies on inflammation, fibrosis, oxidative DNA damage and GST-P expression. Chem. Biol. Interact. 201, 19–30. Tsikas, D., 2016. Assessment of lipid peroxidation by measuring malondialdehyde (MDA) and relatives in biological samples: analytical and biological challenges. Anal. Biochem. 30357–30358 S0003-2697. Valdivia, A., Pérez-Alvarez, S., Aroca-Aguilar, J.D., Ikuta, I., Jordán, J., 2009. Superoxide dismutases: a physiopharmacological update. J. Physiol. Biochem. 65, 195–208. Varga, C., Szendi, K., 2006. In vivo mutagenicity of the carcinogenic 1–nitropyrene: a model of a potential asbestos exposure. Magy. Onkol. 50, 337–340. Wang, W., Jariyasopit, N., Schrlau, J., Jia, Y., Tao, S., Yu, T.W., Dashwood, R.H., Zhang, W., Wang, X., Simonich, S.L., 2011. Concentration and photochemistry of PAHs NPAHs, and OPAHs and toxicity of PM2.5 during the Beijing Olympic Games. Environ. Sci. Technol. 45, 6887–6895. Watt, D.L., Utzat, C.D., Hilario, P., Basu, A.K., 2007. Mutagenicity of the 1-nitropyreneDNA adduct N-(deoxyguanosin-8-yl)-1-aminopyrene in mammalian cells. Chem. Res. Toxicol. 20, 1658–1664. Weiss, C.N., Ito, K., 2014. DNA damage response, redox status and hematopoiesis. Blood Cells Mol. Dis. 52, 12–18. Xia, Q., Yin, J.J., Zhao, Y., Wu, Y.S., Wang, Y.Q., Ma, L., Chen, S., Sun, X., Fu, P.P., Yu, H., 2013. UVA photoirradiation of nitro-polycyclic aromatic hydrocarbons-induction of reactive oxygen species and formation of lipid peroxides. Int. J. Environ. Res. Public Health 10, 1062–1084. Xie, J., Fan, R., Meng, Z., 2007. Protein oxidation and DNA-protein crosslink induced by sulfur dioxide in lungs livers, and hearts from mice. Inhal. Toxicol. 19, 759–765. Yang, X., Igarashi, K., Tang, N., Lin, J.M., Wang, W., Kameda, T., Toriba, A., Hayakawa, K., 2010. Indirect- and direct-acting mutagenicity of diesel: coal and wood burningderived particulates and contribution of polycyclic aromatic hydrocarbons and nitropolycyclic aromatic hydrocarbons. Mutat. Res. 695, 29–34.
Hayakawa, K., 2016. Environmental behaviors and toxicities of polycyclic aromatic hydrocarbons and nitropolycyclic aromatic hydrocarbons. Chem. Pharm. Bull. (Tokyo) 64, 83––94. He, X., Feng, S., 2015. Role of metabolic enzymes P450 (CYP) on activating procarcinogen and their polymorphisms on the risk of cancers. Curr. Drug Metab. 16, 850–863. Hrycay, E.G., Bandiera, S.M., 2015. Involvement of cytochrome P450 in reactive oxygen species formation and cancer. Adv. Pharmacol. 74, 35–84. Huang, S., Hu, J., 2014. Oxidative stress induced by exogenous chemicals mediated by oxidative metabolic enzymes. Chin. J. Ind. Hyg. Occup. Dis. 2, 549–554. IARC, 2013. 1-Nitropyrene. IARC Monogr. Eval. Carcinog. Risks Hum. 105, 621––688. IARC, 2017. Working group on the evaluation of carcinogenic risks to humans. diesel and gasoline engine exhausts and some nitroarenes. IARC Monogr. Eval. Carcinog. Risks Hum. 105, 9–699. IARC, 2016. Agents Classified by the IARC Monographs 1–115. pp. 10. Imaida, K., Lee, M.S., Land, S.J., Wang, C.Y., King, C.M., 1995. Carcinogenicity of nitropyrenes in the newborn female rat. Carcinogenesis 16, 3027–3030. Iwanari, M., Nakajima, M., Kizu, R., Hayakawa, K., Yokoi, T., 2002. Induction of CYP1A1, CYP1A2, and CYP1B1 mRNAs by nitropolycyclic aromatic hydrocarbons in various human tissue-derived cells: chemical- cytochrome P450 isoform-, and cell-specific differences. Arch. Toxicol. 76, 287–298. Jariyasopit, N., Zimmermann, K., Schrlau, J., Arey, J., Atkinson, R., Yu, T.W., Dashwood, R.H., Tao, S., Simonich, S.L., 2014. Heterogeneous reactions of particulate matterbound PAHs and NPAHs with NO3/N2O5 OH radicals, and O3 under simulated longrange atmospheric transport conditions: reactivity and mutagenicity. Environ. Sci. Technol. 48, 10155–10164. Kim, Y.D., Ko, Y.J., Kawamoto, T., Kim, H., 2005. The effects of 1-nitropyrene on oxidative DNA damage and expression of DNA repair enzymes. J. Occup. Health 47, 261–266. Laing, S., Wang, G., Briazova, T., Zhang, C., Wang, A., Zheng, Z., Gow, A., Chen, A.F., Rajagopalan, S., Chen, L.C., Sun, Q., Zhang, K., 2010. Airborne particulate matter selectively activates endoplasmic reticulum stress response in the lung and liver tissues. Am. J. Physiol. Cell Physiol. 299, C736–C749. Lee, C.Y., Lee, M.G., Choi, K.C., Kang, H.M., Chang, Y.S., 2012. Clinical significance of GADD153 expression in stage I non-small cell lung cancer. Oncol. Lett. 4, 408–412. Li, R., Kou, X., Geng, H., Xie, J., Yang, Z., Zhang, Y., Cai, Z., Dong, C., 2015. Effect of ambient PM2.5 on lung mitochondrial damage and fusion/fission gene expression in rats. Chem. Res. Toxicol. 28, 408–418. Lin, Y., Ma, Y., Qiu, X., Li, R., Fang, Y., Wang, Y., Zhu, Y., Hu, D., 2015a. Sources, transformation, and health implications of PAHs and their nitrated hydroxylated, and oxygenated derivatives in PM2.5 in Beijing. J. Geophys. Res. Atmos. 120, 7219–7228. Lin, Y., Qiu, X., Ma, Y., Ma, J., Zheng, M., Shao, M., 2015b. Concentrations and spatial distribution of polycyclic aromatic hydrocarbons (PAHs) and nitrated PAHs (NPAHs) in the atmosphere of North China, and the transformation from PAHs to NPAHs. Environ. Pollut. 196, 164–170. Ma, N., Bian, W., Li, R., Geng, H., Zhang, J., Dong, C., Shuang, S., Cai, Z., 2015. Quantitative analysis of nitro-polycyclic aromatic hydrocarbons in PM2.5 samples with graphene as a matrix by MALDI–TOF MS. Anal. Methods 7, 3967–3971. Martínez-González, I., Cruz, M.J., Moreno, R., Morell, F., Muñoz, X., Aran, J.M., 2014. Human mesenchymal stem cells resolve airway inflammation, hyperreactivity, and histopathology in a mouse model of occupational asthma. Stem Cells Dev. 23, 2352–2363. Moller, P., Danielsen, P.H., Karottki, D.G., Jantzen, K., Roursgaard, M., Klingberg, H., Jensen, D.M., Christophersen, D.V., Hemmingsen, J.G., Cao, Y., Loft, S., 2014. Oxidative stress and inflammation generated DNA damage by exposure to air pollution particles. Mutat. Res. 762, 133–166. Nakabeppu, Y., 2001. Regulation of intracellular localization of human MTH1, OGG1, and MYH proteins for repair of oxidative DNA damage. Prog. Nucleic Acid Res. Mol. Biol. 68, 75–94. Nakamura, Y., Miyamoto, M., Murakami, A., Ohigashi, H., Osawa, T., Uchida, K.A., 2003. Phase II detoxification enzyme inducer from lemongrass: identification of citral and involvement of electrophilic reaction in the enzyme induction. Biochem. Biophys. Res. Commun. 302, 593–600. Oyadomari, S., Mori, M., 2004. Roles of CHOP/GADD153 in endoplasmic reticulum
20