Dual effect of WIN-34B on osteogenesis and osteoclastogenesis in cytokine-induced mesenchymal stem cells and bone marrow cells

Journal of Ethnopharmacology 193 (2016) 227–236

Contents lists available at ScienceDirect

Journal of Ethnopharmacology journal homepage: www.elsevier.com/locate/jep

Dual effect of WIN-34B on osteogenesis and osteoclastogenesis in cytokine-induced mesenchymal stem cells and bone marrow cells Byung-Kwan Seo a,1, Hee-Kyoung Ryu a,1, Yeon-Cheol Park a, Jeong-Eun Huh b, Yong-Hyeon Baek a,n a

Department of Clinical Korean Medicine, Graduate School, Kyung Hee University, 26, Kyungheedae-ro, Dongdaemun-gu, Seoul 02447, Republic of Korea Oriental Medicine Research Center for Bone & Joint Disease, East-West Bone & Joint Research Institute, Kyung Hee University, 892, Dongnam-ro, Gangdonggu, Seoul 05278, Republic of Korea b

art ic l e i nf o

a b s t r a c t

Article history: Received 6 February 2016 Received in revised form 1 July 2016 Accepted 7 July 2016 Available online 9 July 2016

Ethnopharmacological relevance: As an n-butanol fractionated extracted mixture of Lonicera japonica Thunb, dried flowers and Anemarrhena asphodeloides Bunge, root, WIN-34B has been reported the analgesic, anti-inflammatory, cartilage-repairing and protective effects in previous studies. Aim of the study: To investigate the effect of WIN-34B on osteogenesis and osteoclastogenesis in cytokine-induced mesenchymal stem cells and bone marrow cells. Materials and methods: To examine the effect of WIN-34B on osteogenic differentiation, human mesenchymal stem cells (hMSCs) were treated with WIN-34B (1 μg/mL and 10 μg/mL). Alkaline phosphatase (ALP) activity was evaluated and Von Kossa staining was conducted. Mice bone marrow macrophages (BMMs) were obtained and treated with receptor activator of nuclear factor-κB ligand (RANKL) and macrophage colony stimulating factor (m-CSF) to induce osteoclastogenesis. To investigate osteoclast differentiation, tartrate-resistant acid phosphatase (TRAP) staining was conducted after treatment with WIN-34B. Osteoclastogenic conditions were induced by stimulating the cells with interleukin (IL)-1α, IL17, and tumor necrosis factor (TNF-α) in hMSCs and BMMs co-culture systems. The expression levels of osteoprotegerin (OPG), RANKL, runt-related transcription factor 2 (RUNX2), IL-17, c-Fos, TNF-α, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were measured by reverse transcription polymerase chain reaction (RT-PCR). The expression levels of nuclear factor-kappaB (NF-κB), inhibitory kappa B-α (IκBα), phospho-NF-κB, phospho-IκBα, β-actin, p38 MAPK, phospho-c-Jun N-terminal kinase (JNK), phospho-extracellular-signal regulated kinase (ERK), phospho-p38 mitogen-activated protein kinase (MAPK), phospho-JNK, and phospho-ERK were measured by western blot analysis. Results: WIN-34B promoted ALP activity and mineralization of hMSCs. In TRAP-stained BMMs, the number of multinucleated cells decreased after WIN-34B treatment. WIN-34B increased the OPG/RANKL ratio and the expression of RUNX2, and suppressed the expression of IL-17, c-Fos, and TNF-α. It also suppressed the activation of NF-κB, IκBα, p38 MAPK, and JNK in a dose-dependent manner. Conclusions: These results demonstrated that WIN-34B increased osteogenesis and decreased osteoclastogenesis in cytokine-induced mesenchymal stem cells and bone marrow cells via inhibition of the NF-κB, JNK, and p38 MAPK pathways. & 2016 Elsevier Ireland Ltd. All rights reserved.

Keywords: WIN-34B Osteogenesis Osteoclastogenesis Mesenchymal stem cells Bone marrow cells Osteoporosis

1. Introduction Bone is a mineralized tissue that is continuously replaced by the processes of bone resorption and bone formation. Osteoclasts originating from bone marrow progenitor cells resorb bone tissue n Correspondence to: Department of Acupuncture & Moxibustion, College of Korean Medicine, Kyung Hee University, 26, Kyungheedae-ro, Dongdaemun-gu, Seoul 02447, Republic of Korea. E-mail address: [email protected] (Y.-H. Baek). 1 Equal contributors.

http://dx.doi.org/10.1016/j.jep.2016.07.022 0378-8741/& 2016 Elsevier Ireland Ltd. All rights reserved.

(Baron and Hesse, 2012; Lane and Yao, 2009). Osteoblasts derived from mesenchymal stem cells produce new bone matrix (PerezSayans et al., 2010). Imbalance of these factors leads to increased osteoclastogenesis or decreased osteogenesis, and may enhance the process of osteoporosis (Lane and Yao, 2009). Osteoporosis is characterized by low bone mass, disruption of bone structure, compromised bone strength, and increased risk of fracture at multiple skeletal sites—most often at the spine, hip, or wrist (Cosman et al., 2014). It has been estimated that more than 10.2 million Americans had osteoporosis in 2010 (Wright et al., 2014). Annually, 2 million fractures are attributed to osteoporosis,

228

B.-K. Seo et al. / Journal of Ethnopharmacology 193 (2016) 227–236

contributing to medical costs of nearly $17 billion in the US (Burge et al., 2007). The therapeutic options for osteoporosis are bisphosphonates, calcitonin, denosumab, parathyroid hormone (PTH), and for women, estrogens or selective estrogen receptor modulator (SERMs) (SW, 2013). The aim of these therapies is to inhibit bone resorption and/or stimulates bone formation (Baron and Hesse, 2012). Therefore, the regulation of osteogenesis and osteoclastogenesis plays a key role in bone metabolism. Lonicera japonica Thunb, dried flowers and Anemarrhena asphodeloides Bunge, root, have been used as an anti-angiogenic, anti-nociceptive, antipyretic, anti-inflammatory, antidiabetic, and antidepressant (Yoo et al., 2008; Sun et al., 2013). As an n-butanol fractionated extracted mixture of two herb, WIN-34B demonstrated anti-nociceptive and anti-inflammatory effects in osteoarthritis animal models (Kang et al., 2010). In rats, orally administered WIN-34B did not cause acute or chronic toxicity or gastric injury (Huh et al., 2011). WIN-34B reduces pain and inflammation by inhibiting the production of pro-inflammatory mediators such as interleukin (IL)-1β, tumor necrosis factor-α (TNF-α), prostaglandin E2 (PGE2), and nitric oxide (NO), and by regulating matrix metalloproteinases (MMPs), a disintegrin and metalloproteinase with thrombospondin-like motifs (ADAMTSs), and tissue inhibitors of metalloproteinases (TIMPs) via inhibitory kappa B-α (IκB-α) and mitogen-activated protein kinase (MAPK) signaling pathways in IL-1β-stimulated human OA fibroblast-like synoviocytes (Huh et al., 2012b). WIN-34B showed protective effects in cartilage through regulation of matrix proteinases (aggrecanases, MMPs, and TIMPs), inflammatory mediators (IL-1β, TNF-α, PGE2, and NO), and the MAPK pathways in IL-1β-stimulated cartilage explant culture and chondrocytes (Huh et al., 2012a). Additionally, the cartilage-repairing and protective effects of WIN-34B were confirmed through enhancing chondrogenic differentiation in the collagenase-induced osteoarthritis rabbit model and in progenitor cells from subchondral bone (Huh et al., 2013). Mesenchymal stem cells (MSCs) were considered important cells in previous bone metabolism studies. MSCs are multipotent stem cells that can differentiate into various cells such as osteoblasts, chondrocytes, and adipocytes (Bobis et al., 2006). Progenitor cells are the intermediate step between MSCs and differentiated cells (Jones et al., 2002). Several in vitro studies reported that progenitor cells from subchondral bone marrow have a multipotent differentiation capacity (Bobis et al., 2006; Jones et al., 2002; Kassem and Abdallah, 2008). WIN-34B increases differentiation of progenitor cells from subchondral bone (Huh et al., 2013). The objective of this study was to determine whether WIN-34B affects osteogenesis and osteoclastogenesis. In vitro experiments were conducted to demonstrate the effect of WIN-34B on osteoblast differentiation from human mesenchymal stem cells (hMSCs), osteoclast differentiation from bone marrow cells, and osteogenesis/osteoclastogenesis in cytokine-induced mesenchymal stem cells and bone marrow cells.

Research Institute, WhanIn Pharm. Co. Ltd. (Suwon, Korea). WIN-34B was prepared by extracting a mixture of 2 kg of L. japonica Thun, dried flowers and 1 kg of A. asphodeloides Bunge, root (2:1, w/w) with 10 L of 50% (v/v) ethanol for 4 h at 85 °C. After the extracted solution was filtered and evaporated in vacuo, the resulting concentrate was dissolved in 225 mL distilled water and partitioned with 195 mL n-butanol. The n-butanol layer was evaporated in vacuo and lyophilized for complete removal of the residual solvent, resulting in 7% yield of 11 g brown powder. The standardization of WIN-34B for quality control was performed by HPLC analysis. The standard compounds were mangiferin and chlorogenic acid.

2. Materials and methods

2.5. Alkaline phosphatase (ALP) staining

2.1. Preparation of WIN-34B extract and standardization

The cultured cells were washed twice with phosphate buffer saline (PBS) and fixed with citrate-acetone-formaldehyde fixative solution for 30 s at room temperature (18–26 °C). The fixed cells were rinsed gently in deionized water (DW) for 45 s, treated with alkaline-dye mixture according to the manufacturer's protocol for over 30 min at room temperature, and kept away from light. The plate was rinsed for 2 min in DW and observed under an optical microscope. The intensity of ALP was measured by the I-Solution software program.

Lonicera japonica Thunb, dried flowers and Anemarrhena asphodeloides Bunge, root were purchased from the Song Lim Pharmaceutical Company (Seoul, Korea) and identified by the Korea Pharmaceutical Trading Association (Seoul, Korea). Voucher specimens of L. japonica Thunb. (No. OA-LOJ-15) and A. asphodeloides Bunge (No. OA-ANA-11) were analyzed by high-performance liquid chromatography (HPLC) and deposited in the Central

2.2. Cell culture of human bone marrow-derived mesenchymal stem cells Human bone marrow-derived mesenchymal stem cells (hMSCs) were purchased from Lonza (Walkersville, MD, USA). Cells were grown in expansion media, Dulbecco's modified Eagle's medium (DMEM)-low glucose media supplemented with 10% fetal bovine, antibiotics (100 U/mL penicillin, 0.1 mg/mL streptomycin) at 37 °C in a humidified atmosphere of 5% CO2 in air. Media were changed every three days, and cells were subcultured upon reaching 80% confluence. 2.3. Cell viability assay To examine the cytotoxic effects of WIN-34B, cell viability assay was performed using Cell Counting Kit-8 (CCK-8). The cells were subcultured in 96-well plates at a concentration of 1  104 cells/ well in 100 μL of growth medium per well, and incubated at 37 °C in an atmosphere of 5% CO2 for 24 h. After 24 h, the medium was switched to growth medium and differentiation medium with or without WIN-34B (0, 0.01, 0.1, 1, 10, 50, and 100 μg/mL) for 48 h. After 48 h, 10 μL of CCK-8 Solution was carefully added to all wells (to avoid introducing bubbles), and the plate was incubated for 3 h. Absorbance readings of wells containing known numbers of living cells were taken at 450 nm using an enzyme-linked immunosorbent assay (ELISA) reader. 2.4. Osteogenic differentiation For osteoblast differentiation, hMSCs were seeded on 6-well plates (5  104 cells/well) and grown to 90% confluence. The culture medium was then changed to a fresh osteogenic medium containing 10 mM β-glycerolphosphate and 50 μg/mL ascorbic acid to initiate matrix mineralization. In some experiments, cells were treated with WIN-34B and the culture medium was changed every 3 d for 7, 14, and 18 d. Differentiation medium: Low glucoseDMEM media containing 10% fetal bovine serum supplemented with 10 mM β-glycerolphosphate and 50 μg/mL ascorbic acid.

B.-K. Seo et al. / Journal of Ethnopharmacology 193 (2016) 227–236

2.6. Von Kossa staining The cultured cells were washed twice with PBS and fixed for 30 s in citrate-acetone-formaldehyde fixative solution at room temperature (18–26 °C). The fixed cells were rinsed gently in DW and treated with silver nitrate solution for 1 h or until calcium turned brown-black under ultraviolet (UV) light. The plates was rinsed 3 times in DW and treated with sodium thiosulfate solution for 2 min to remove unreacted silver. The plate was rinsed in DW and treated with nuclear fast red solution for 5 min to counterstain nuclei. After staining, the plate was gently washed in running water and pictures were taken using a microscope. Uniformly stained photos were detected using the I-Solution software program. The deposits of calcium were counted and an average result was calculated. 2.7. Culture of primary bone marrow-derived macrophages as osteoclast precursors

229

Table 1 Primer design for quantitative RT-PCR analysis. Gene

Sequence

OPG

F: 5′ AAA gCA CCC TgT AgA AAA CA 3′ R: 5′ CCg TTT TAT CCT CTC TAC AC 3′ F: 5′ TCG TTG GAT CAC AGC ACA TCA 3′ R: 5′ TAT GGG AAC CAC ATG GGA TGT C 3′ F: 5′ GACTTCTGCCTCTGGCCTTC 3′ R: 5′ CTGGATAGTGCATTCGTGGG 3′ F: 5′ GGTCAACCTCAAAGTCTTTAACTC 3′ R: 5′ TTAAAAATGCAAGTAAGTTTGCTG 3′ F: 5′ Cgg gTT TCA ACg CCg ACT AC 3′ R: 5′ AAA gTT ggC ACT AgA gAC ggA CAg A 3′ F: 5′ CAC CAC TTA GAA ACC TGG AC 3′ R: 5′ TAG GTC TGG GTG ACA ACT TC 3′ F: 5′ ATC CCA TCA CCA TCT TCC AGG AG 3′ R: 5′ CCT GCT TCA CCA CCT TCT TGA TG 3′

RANKL RUNX2 IL-17 c-Fos TNF-α GAPDH

F, forward; R, reverse; OPG, osteopotegerin; RANKL, receptor activator of nuclear factor-κB ligand; RUNX2, runt-related transcription factor 2; TNF-α, tumor necrosis factor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase

Bone marrow macrophages (BMMs) were obtained by flushing the tibiae and femurs of 6-week-old ICR mice with α-minimum essential medium (α-MEM). After the red blood cells were removed using Ammonium-Chloride-Potassium (ACK) buffer, the bone marrow cells were suspended in α-MEM containing 10% (v/v) fetal bovine serum (FBS), 100 U/mL penicillin, and 100 μg/mL streptomycin, then incubated for 24 h in the presence of 10 ng/mL macrophage colony stimulating factor (m-CSF). Non-adherent cells were transferred and cultured in the presence of 30 ng/mL M-CSF for 3 d. Adherent cells were used as BMMs. To generate osteoclasts, BMMs were cultured in the presence of 30 ng/mL M-CSF and 100 ng/mL receptor activator of nuclear factor-κB ligand (RANKL) for 4 d. 2.8. Tartrate-resistant acid phosphatase (TRAP) staining BMMs (5  105 cells/well) were seeded in 12-well plates, stimulated with 100 ng/mL RANKL for 1 h, and treated with WIN-34B (1, 10, and 20 μL) in the presence of 30 ng/mL M-CSF. To confirm osteoclast generation, staining was performed using the Leukocyte Acid Phosphatase Assay Kit (Sigma-Aldrich), according to the manufacturer's instructions. Multinucleated cells staining positive for TRAP and containing three or more nuclei were considered osteoclasts. TRAP-positive multinucleated cells were counted under a light microscope. 2.9. Reverse transcription polymerase chain reaction (RT-PCR) Total cellular RNA was extracted using TRIZOL reagent according to the manufacturer's protocol. The cells in 6-well plates were treated with 1 mL of TRIZOL reagent per well. The required materials were chloroform, isopropyl alcohol, 70% ethanol, and diethylpryocarbonate (DEPC). To measure the quantity of RNA, a Nano-drop spectrophotometer was used. An equal amount of RNA samples was reverse-transcribed using a PCR kit according to the manufacturer's protocol for a total reaction time of about 75 min: 5 min at 95 °C, 60 min at 42 °C, and 5 min at 65 °C. Amplification of cDNA was carried out using Taq plus master mix and the genespecific primer sets as listed in Table 1. The thermal profile for all reactions was as follows: 5 min at 95 °C, 30–35 amplification cycles of 36 s at 95 °C, 30 s at 59 °C, 30 s at 72 °C, and finally 5 min at 72 °C. The PCR products were electrophoresed on 1.8% agarose gel stained with ethidium bromide (EtBr), and the gel was exposed to UV light to capture the image with Photo Doc-It™ imaging systems. All marker gene expression levels were determined by the intensity of the band and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH)

Fig. 1. Effects of WIN-34B on viability of hMSCs. Viability of hMSCs treated with WIN-34B was determined using CCK-8 (Cell Count Kit-8) assay.

expression. PCR band intensity was quantified by using Image J software. 2.10. Measurement of cytokine, RANKL, and OPG expression in the co-culture system BMMs (3  105 cells/well) and hMSCs (2.5  104 cells/well) were seeded in 48-well plates, prestimulated with 100 ng/mL RANKL for 1 h, and treated with WIN-34B (1 μg/mL and 10 μg/mL) in the presence of 30 ng/mL M-CSF for 48 h. The expression levels of osteoprotegerin (OPG), RANKL, runt-related transcription factor 2 (RUNX2), IL-17, c-Fos, TNF-α, and GAPDH were determined by RT-PCR. 2.11. Western blotting Cells were lysed with lysis buffer (Invitrogen). Protein concentrations were measured using the Bio-Rad protein assay with bovine serum albumin as a standard (Bio-Rad Laboratories, Mississauga, ON). Proteins (20 μg/lane) were size-fractionated using 10% sodium dodecyl sulfate (SDS)-polyacrylamide gel (Invitrogen) electrophoresis under reducing conditions and transferred onto Hybond-C nitrocellulose membranes (Amersham Biosciences, NJ, USA). After blocking with 5% skim milk, the membranes were reacted with primary antibodies (1:1000 dilution) against NF-κB/ p65, phospho-IκBα, IκBα, phospho-extracellular-signal regulated kinase (ERK), phospho-c-Jun N-terminal kinase (JNK), phosphop38 MAPK, ERK, JNK, p38 MAPK, β-actin, and non-immunized mouse IgG (Sigma-Aldrich Co.). The samples were then incubated with horseradish peroxidase-labeled anti-goat IgG or anti-mouse IgG, and immunoreactive bands were detected with ECL western blotting reagents (Amersham Biosciences).

230

B.-K. Seo et al. / Journal of Ethnopharmacology 193 (2016) 227–236

Fig. 2. Effects of WIN-34B on osteogenesis of hMSCs. (A) Histological analysis was performed by alkaline phosphatase (ALP) staining during osteogenesis of hMSCs. ALPpositive cells (shown as orange-red dots) were quantified by the I-solution program. (B) Histological analysis was performed by Von Kossa staining during osteogenesis of hMSCs. The number of mineralized nodules stained by Von Kossa (shown as black dots) was quantified by the I-solution program. All values are expressed as mean 7 SEM. ***p o 0.001 compared with control. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

2.12. Statistical analysis Data are expressed as the mean 7 standard error of the mean (S.E.M). Groups were compared using one-way analysis of variance (ANOVA), followed by Duncan's multiple range tests or Student's t-tests to compare two samples. P-value less than 0.05 was considered significant.

3. Results 3.1. Cytotoxicity of WIN-34B in hMSCs To examine the cytotoxicity of WIN-34B in hMSCs, a CCK-8 assay was performed. Cell viability was not affected in the presence of WIN-34B (0.01–100 μg/mL). Cytotoxic effects of WIN-34B on hMSCs were not observed during 48-h exposure to up to 100 μg/mL WIN-34B (Fig. 1). 3.2. WIN-34B promoted osteogenic differentiation of hMSCs To evaluate the effect of WIN-34B on osteoblast differentiation,

hMSCs were cultured in osteogenic medium (10 mM β-glycerolphosphate and 50 μg/mL ascorbic acid) and treated with WIN34B (1 μg/mL, 10 μg/mL, and 20 μg/mL). ALP activity, an early marker of osteoblasts, was determined. As shown in Fig. 2A, 1 μg/mL, 10 μg/mL, and 20 μg/mL of WIN-34B significantly increased ALP-positive cells, shown by orange-red dots, in dosedependent manner. To confirm the osteogenic effect of WIN-34B, Von Kossa staining was performed. As shown in Fig. 2B, 1 μg/mL, 10 μg/mL, and 20 μg/mL of WIN-34B increased mineralized nodules, shown by black-stained spots, in dose-dependent manner (Fig. 2B). 3.3. WIN-34B inhibited osteoclast differentiation in BMMs To induce osteoclast differentiation, a mixture of RANKL and M-CSF was used to stimulate BMMs. After WIN-34B (1 μg/mL, 10 μg/mL, and 20 μg/mL) treatment, TRAP staining was conducted. The formation of osteoclast-like cells was monitored by observing the formation of multinucleated cells ( 43 nuclei). WIN-34B at 10 μg/mL and 20 μg/mL inhibited the formation of TRAP-positive multinucleated cells in a dose-dependent manner (Fig. 3). Only the

B.-K. Seo et al. / Journal of Ethnopharmacology 193 (2016) 227–236

231

Fig. 3. Effects of WIN-34B on osteoclastogenesis of BMMs. Histological analysis was performed by tartrate-resistant acid phosphatase (TRAP) staining during osteoclastogenesis of BMMs. Multinucleated cells stained by TRAP were quantified by the I-solution program. All values are expressed as mean 7SEM. **p o 0.01 compared with control (RANKL and MCSF-stimulated BMMs without WIN-34B treatment).

20 μg/mL dose of WIN-34B significantly decreased the number of TRAP-positive multinucleated cells (p o0.01) compared with the control (RANKL- and M-CSF-stimulated BMMs without WIN-34B treatment).

34B significantly upregulated the expression of RUNX2 compared to the TNF-α-stimulated condition without WIN-34B treatment (p o0.001). WIN-34B significantly suppressed the expression of IL17, c-Fos, and TNF-α in a dose-dependent manner (Fig. 4C).

3.4. WIN-34B enhanced osteogenesis and suppressed osteoclastogenesis in inflammatory cytokine-induced hMSC and BMM co-culture systems

3.5. WIN-34B inhibited the activation of NF-κB in IL-1α-stimulated hMSC and BMM co-culture systems

BMM and hMSC co-culture systems were treated with WIN34B (1 mg/mL and 10 mg/mL) in the presence of IL-1α (5 ng/mL), IL-17 (10 ng/mL), and TNF-α (10 ng/mL). The expression levels of OPG, RANKL, RUNX2, IL-17, c-Fos, TNF-α, and GAPDH were investigated using RT-PCR (Fig. 4). Under the cytokine (IL-1α, IL-17, and TNF-α)-induced osteoclastogenetic condition in hMSC and BMM co-culture systems, the OPG/RANKL ratio and RUNX2 expression showed decreasing tendency, whereas IL-17, c-Fos, and TNF-α expression showed increasing tendency compared to the control after cytokine (IL-1α, IL-17, and TNF-α) stimulation (Fig. 4). After IL-1α stimulation, the OPG:RANKL ratio was significantly increased by WIN-34B treatment (1 mg/mL and 10 mg/mL) compared to the IL-1α-stimulated condition without WIN-34B (po0.001). WIN34B at 10 μg/mL significantly upregulated RUNX2 expression compared to the IL-1α-stimulated condition without WIN-34B treatment (po0.001). WIN-34B significantly suppressed the expression of IL-17, c-Fos, and TNF-α in a dose-dependent manner (Fig. 4A). After IL-17 stimulation, the OPG:RANKL ratio was significantly increased by WIN-34B treatment (10 mg/mL) compared to the IL17-stimulated condition without WIN-34B (p o0.001). The expression of RUNX2 was significantly upregulated by WIN-34 treatment (1 mg/mL and 10 mg/mL) compared with the IL-17-stimulated condition without WIN-34B (p o0.001). WIN-34B significantly suppressed the expression of IL-17, c-Fos, and TNF-α in a dose-dependent manner (Fig. 4B). After TNF-α stimulation, the OPG:RANKL ratio significantly increased with 1 μg/mL (p o0.01) and 10 μg/mL WIN-34B treatment (p o 0.001) compared to the TNF-α-stimulated condition without WIN-34B. Treatment with 1 μg/mL and 10 μg/mL of WIN-

To determine whether WIN-34B affects NF-κB activation, a western blot assay was conducted. 1 μg/mL and 10 μg/mL of WIN34B significantly suppressed IL-1α-induced phosphorylation of NF-κB (p o0.001) and Iκ-Bα in IL-1α-stimulated hMSC and BMM co-culture system (Fig. 5). 3.6. WIN-34B activated the MAPK signaling pathways in IL-1α-stimulated hMSC and BMM co-culture systems To evaluate the effect of WIN-34B on MAPKs in IL-1α-stimulated hMSC and BMM co-culture systems, the phosphorylation of p38 MAPK, JNK, and ERK was evaluated by western blot analysis. IL-1α upregulated the protein level of phospho-p38 MAPK and phospho-JNK, and suppressed the protein level of phospho-ERK. WIN-34B suppressed the protein level of phospho-p38 MAPK and phospho-JNK in a dose-dependent manner. WIN-34B upregulated the protein level of phospho-ERK (Fig. 6).

4. Discussion A decrease in bone density is the consequence of unbalanced bone resorption and bone formation (Baron and Hesse, 2012). Therefore, the regulation of osteogenesis and osteoclastogenesis is a key aim in the treatment of osteoporosis. Experimental evidence shows that the OPG/RANKL/RANK system is an important factor in pathophysiological bone remodeling (Theoleyre et al., 2004). RANKL induces osteoclastogenesis and bone resorption by binding to RANK on osteoclast progenitors. RANKL is inhibited by OPG, which blocks RANKL/RANK interaction (O’Brien et al., 2013; Theoleyre et al., 2004).

232

B.-K. Seo et al. / Journal of Ethnopharmacology 193 (2016) 227–236

2.0

RANKL

*** 1.0 0.5

RUNX2 / GAPDH

***

1.5

OPG/RANKL

OPG

1.00 0.75

*** 0.50

0.00

0.0

IL-1α WIN-34B

-

+ -

+ 1

+ 10 (μg/ml)

IL-1α WIN-34B

2

*** 1

-

TNF-α/GAPDH

3

TNF- α GAPDH

+ -

+ 1

1

+ 10 (μg/ml)

0

IL-1α WIN-34B

c -fos

-

+ -

+ 1

+ 10 (μg/ml)

1.5

***

**** RUNX2 / GAPDH

OPG/RANKL

1.00

)

0.75 0.50

0.00

IL-17

-

+

+

+

WIN-34B

-

-

1

10

*** 0.5

## #

0.0 (μg/ml)

IL-17 WIN-34B

-

c - fos /GAPDH

3

** 2

***

+ 1

+ 10

(μg/ml)

###

3

**

2

* **

1

1

IL-17 WIN-34B

+ -

4

###

-

2.5

TNF- α

+ -

+ 1

+ 10 (μg/ml)

IL-17

0

WIN-34B

-

+

+

+

-

-

1

110

(μg/ml)

###

2.0

TNF-α/GAPDH

GAPDH

1.0

4

0

+ 110 (μg/ml)

***

1.25

IL-17/GAPDH

IL-17

+ 1

1

0

RUNX2

+ -

*

0.25

RANKL

-

2

1.50

OPG

***

###

IL-1α WIN-34B

IL-17

+ 10 (μg/ml)

2

***

IL-1α WIN-34B

+ 1

**

3

0

c-fos

+ ###

4

c-fos/GAPDH

IL-17 / G APDH

IL-17

###

3

-

5

4

RUNX2

###

0.25

1.5

***

1.0

***

0.5 0.0

IL-17 WIN-34B

-

+ -

+ 1

+ 10

(μg/ml)

Fig. 4. Effects of WIN-34B on osteogenesis/osteoclatogenesis markers in inflammatory cytokine-induced hMSCs and BMMs co-culture systems. The mRNA expression of OPG, RANKL, RUNX2, IL-17, c-Fos, TNF-α, and GAPDH was measured by RT-PCR in inflammatory cytokine-induced hMSCs and BMMs co-culture systems. The ratio of OPG/ RANKL and RUNX2/GAPDH and the relative mRNA levels (IL-17, c-Fos, and TNF-α) were quantified by the I-solution program. (A) Effect of WIN-34B on IL-1α-stimulated hMSCs and BMMs co-culture systems. (B) Effect of WIN-34B on IL-17-stimulated hMSCs and BMMs co-culture systems. (C) Effect of WIN-34B on TNF-α-stimulated hMSCs and BMMs co-culture systems. All values are expressed as mean7 SEM. ###p o0.001 compared with control (no stimulation of cytokine and no treatment of WIN-34B). **p o 0.01 and ***po 0.001 compared with cytokine-stimulated hMSCs and BMMs co-culture systems without WIN-34B treatment.

B.-K. Seo et al. / Journal of Ethnopharmacology 193 (2016) 227–236

***

1.50

**

1.00

#

ll)

0.50 0.25 0.00

TNF-α WIN-34B

-

+ -

+ 1

1.5

RUNX2 / GAPDH

OPG/RANKL

1.25

0.75

233

+ 10 (μg/ml)

****

1.0

*** 0.5 ### 0.0

TNF-α WIN-34B

-

+ -

+ 1

+ 10 (μg/ml)

4 3

###

*

2

***

1 0

TNF-α WIN-34B

c- fos/G AP DH

IL-17/G AP DH

3

### 2

**

1

**** -

+ -

+ 1

+ 10 (μg/ml)

0

TNF-α WIN-34B

-

+ -

+ 1

+ 10 (μg/ml)

5

TNF -α /G APD H

### 4 3 2

***

1

***

0

TNF-α WIN-34B

-

+ -

+ 1

+ 10

(μg/ml)

Fig. 4. (continued)

In previous studies, WIN-34B demonstrated analgesic, anti-inflammatory effects (Huh et al., 2012b; Kang et al., 2010), cartilagerepairing, and protective effects (Huh et al., 2013, 2012a). WIN-34B increased chondrogenic differentiation by the induction of typical MSC-related cell surface antigens CD105 and CD73, and the enhancement of type II collagen and aggrecan (typical cartilage matrix molecules in vivo and in vitro) (Huh et al., 2013). This suggests that WIN-34B affects the multipotent differentiation of MSCs. The effect of WIN-34B on the osteoblast differentiation of hMSCs, osteoclast differentiation of BMMs, and osteogenesis/osteoclastogenesis in cytokine-induced mesenchymal stem cells and bone marrow cells was investigated. The effect of WIN-34B on osteogenesis in hMSCs was measured by ALP assay and Von Kossa staining. ALP is an important component in hard tissue formation, and is highly expressed in mineralized tissue cells. ALP has become the first marker for assessing osteogenesis (Golub and Boesze-Battaglia, 2007). Von Kossa staining is a possible indicator for quantitatively evaluating mineralization of primary osteoblasts and osteoblast-like cell lines (Bonewald et al., 2003). WIN-34B increased both ALP activity and the number of mineralized nodules in Von Kossa stained sections, suggesting that WIN-34B stimulates osteogenic differentiation of hMSCs. In vitro, osteoclast progenitor cells induced by RANKL and M-CSF became osteoclasts. TRAP is a representative osteoclast marker enzyme (Minkin, 1982). The number of TRAP-positive multinuclear cells suggested activation of osteoclasts or osteoclasts-like cells (Costa-Rodrigues and Fernandes, 2011). WIN-34B inhibited the formation of TRAP-positive multinucleated cells in a dose-dependent manner. These results show that WIN-34B inhibits osteoclastogenesis of BMMs. Only the 20 μg/mL dose of

WIN-34B was found to significantly decrease the number of TRAPpositive multinucleated cells. It was anticipated that a sufficient concentration of WIN-34B could control osteoclastogenesis. A co-culture of pre-osteoblast (hMSCs) and osteoclast precursors (BMMs) results in functional osteoclastogenesis (Theoleyre et al., 2004). RANKL, expressed on the surface of pre-osteoblasts, is bound to RANK on the osteoclast precursors. This process promotes differentiation and activation of mature osteoclasts. In addition, cytokines modulate this system by directly increasing RANKL expression (Khosla, 2001). RANKL expression was increased by inflammatory cytokines, such as IL-1, IL-7, IL-17, and TNF-α (Bandeira et al., 2014; Theoleyre et al., 2004). Among several factors affecting osteoblast and osteoclast formation, RANKL is an important factor of osteoclastogenesis. In contrast, OPG is a bone-protecting factor that inhibits RANKL, and therefore, osteoclastogenesis (Theoleyre et al., 2004). The ratio of OPG: RANKL is a critical indicator of the regulation of osteogenesis or osteoclastogenesis. An increase in this ratio indicates inhibited osteoclast formation (Fu et al., 2014; Oshita et al., 2011). RUNX2 is a transcriptional regulator that plays an important role in osteoblast differentiation (Enomoto et al., 2003; Zhang et al., 2006). Osteoclastogenic conditions were induced by IL-1α (5 ng/mL), IL17 (10 ng/mL), and TNF-α (10 ng/mL) to stimulate hMSC and BMM co-culture systems. Then, inflammatory cytokine-induced hMSC and BMM co-culture systems were treated with WIN-34B (1 μg/mL and 10 μg/mL). WIN-34B significantly increased the OPG: RANKL ratio and the expression level of RUNX2, suggesting a dual effect of osteogenesis and anti-osteoclastogenesis in cytokine-induced hMSC and BMM co-culture systems. RANKL binds to RANK on osteoclast precursors, and RANK signaling begins by the binding of RANK to the TNF receptor-

234

B.-K. Seo et al. / Journal of Ethnopharmacology 193 (2016) 227–236

Fig. 5. Effects of WIN-34B on activation of NF-κB in IL-1α-stimulated hMSCs and BMMs co-culture systems. The expression of pNF-κB, NF-κB, pIκ-Bα, Iκ-Bα, and β-actin was detected by western blot analysis in IL-1α-stimulated hMSCs and BMMs co-culture systems. The ratio of pNF-κB/β-actin, NF-κB/β-actin, Iκ-Bα/β-actin, and pIκ-Bα/β-actin was quantified by the I-solution program. All values are expressed as mean 7SEM. ###p o0.001 compared with control (no stimulation of cytokine and no treatment of WIN34B). ***p o 0.001 compared with IL-1α-stimulated hMSCs and BMMs co-culture systems without WIN-34B treatment.

associated factor (TRAF) 6 adapter proteins within the cytoplasm of osteoclast precursors. Activated TRAF 6 induces downstream transcription of NF-κB and MAPKs such as p38 MAPK, JNK, and ERK, which appears to be essential to osteoclast differentiation and activation (Theoleyre et al., 2004). The activation of NF-κB is critical for RANKL-induced osteoclastogenesis. NF-κB is bound to IκBα in its inactive state, and is activated when IκBα is phosphorylated. IL-1α not only stimulates osteoclastogenesis, but also mediates activation of NF-κB (Yang et al., 2003). To determine whether WIN-34B affects NF-κB activation in IL-1α-stimulated hMSC and BMM co-culture systems, NF-κB activation was investigated by western blot assay using specific antibodies. WIN34B significantly suppressed IL-1α-induced phosphorylation of NF-κB and decreased phosphorylation of IκBα in hMSC and BMM co-culture systems. These results indicate that the anti-

osteoclastogenic effect of WIN-34B is related to the inhibition of the NF-κB-dependent pathway. Besides the NF-κB pathway, activation of MAPK (p38 MAPK, JNK, and ERK) pathways is a key process in osteoclastogenesis. While JNK and p38 MAPK are only involved in osteoclast differentiation, ERK plays a functional role in both osteoclast differentiation and survival (Miyazaki et al., 2000; Theoleyre et al., 2004). To evaluate the effect of WIN-34B on MAPKs in IL-1α-stimulated co-culture systems, the phosphorylation of p38 MAPK, JNK, and ERK was measured by western blot analysis. WIN-34B suppressed the expression of phospho-p38 MAPK and phosphoJNK in a dose-dependent manner, but increased the expression of phospho-ERK. These results indicate that WIN-34B may have antiosteoclastogenic effects through the inhibition of JNK and p38 MAPK pathways.

B.-K. Seo et al. / Journal of Ethnopharmacology 193 (2016) 227–236

pp38 p38 pJNK JNK pERK ERK

-

+ -

+ 1

+ 10 (μg/ml) pp38 pJNK pERK

10 Relative ratio of MAPKs expression

IL-1α α WIN-34B

235

IL-1α

8 6 4 2 0

WIN-34B

-

+ -

+ + 1 10

-

+ -

+ + 1 10

-

+ -

+ + 1 10 (μg/ml)

Fig. 6. Effects of WIN-34B on activation of the MAPK signaling pathways in IL-1α-stimulated hMSCs and BMMs co-culture systems. The protein level of pp38, p38, pJNK, JNK, pERK, and ERK was detected by western blot analysis in inflammatory cytokine-induced hMSCs and BMMs co-culture systems. The relative mRNA level of pp38, pJNK, and pERK was quantified by the I-solution program.

In summary, the present study suggests that WIN-34B could promote osteogenesis and suppress osteoclastogenesis in cytokine-induced hMSC and BMM co-culture systems via the inhibition of the NF-κB, JNK, and p38 MAPK pathways.

Conflict of interest None declared.

Authors' contributions BKS and HKR collected and analyzed data and wrote the manuscript. YCP and JEH analyzed data and revised the manuscript. YHB designed the study, supervised experimental procedures and drafted the manuscript. All authors have read, revised and approved the final manuscript. Byung-Kwan Seo: [email protected]; Hee-Kyoung Ryu: [email protected]; Yeon-Cheol Park: [email protected]; Jeong-Eun Huh: [email protected]; Yong-Hyeon Baek: [email protected].

Acknowledgments This research was supported by the Basic Science Research Program, through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (NRF-2013R1A1A2010049) and the Traditional Korean Medicine R&D program funded by the Ministry of Health & Welfare through the Korea Health Industry Development Institute (KHIDI) (HI15C0117).

References Bandeira, F., Costa, A.G., Soares Filho, M.A., Pimentel, L., Lima, L., Bilezikian, J.P., 2014. Bone markers and osteoporosis therapy. Arq. Bras. Endocrinol. Metabol. 58, 504–513. Baron, R., Hesse, E., 2012. Update on bone anabolics in osteoporosis treatment: rationale, current status, and perspectives. J. Clin. Endocrinol. Metab. 97, 311–325.

Bobis, S., Jarocha, D., Majka, M., 2006. Mesenchymal stem cells: characteristics and clinical applications. Folia histochemica et cytobiologica/Polish Academy of Sciences, Polish Histochemical and Cytochemical Society 44, pp. 215–230. Bonewald, L.F., Harris, S.E., Rosser, J., Dallas, M.R., Dallas, S.L., Camacho, N.P., Boyan, B., Boskey, A., 2003. von Kossa staining alone is not sufficient to confirm that mineralization in vitro represents bone formation. Calcif. Tissue Int. 72, 537–547. Burge, R., Dawson-Hughes, B., Solomon, D.H., Wong, J.B., King, A., Tosteson, A., 2007. Incidence and economic burden of osteoporosis-related fractures in the United States, 2005–2025. J. Bone Miner. Res.: Off. J. Am. Soc. Bone Miner. Res. 22, 465–475. Cosman, F., de Beur, S.J., LeBoff, M.S., Lewiecki, E.M., Tanner, B., Randall, S., Lindsay, R., 2014. Clinician's Guide to Prevention and Treatment of Osteoporosis. Osteoporos. Int.: J. Establ. Result Coop. Eur. Found. Osteoporos. Natl. Osteoporos. Found. USA 25, 2359–2381. Costa-Rodrigues, J., Fernandes, M.H., 2011. Paracrine-mediated differentiation and activation of human haematopoietic osteoclast precursor cells by skin and gingival fibroblasts. Cell Prolif. 44, 264–273. Enomoto, H., Shiojiri, S., Hoshi, K., Furuichi, T., Fukuyama, R., Yoshida, C.A., Kanatani, N., Nakamura, R., Mizuno, A., Zanma, A., Yano, K., Yasuda, H., Higashio, K., Takada, K., Komori, T., 2003. Induction of osteoclast differentiation by Runx2 through receptor activator of nuclear factor-kappa B ligand (RANKL) and osteoprotegerin regulation and partial rescue of osteoclastogenesis in Runx2-/mice by RANKL transgene. J. Biol. Chem. 278, 23971–23977. Fu, W.M., Zhu, X., Wang, H., Wei-Mao, W., Chen, J.Y., Liang, Y., Zhang, J.F., Kung, H.F., 2014. Staphylococcal enterotoxin C2 promotes osteogenesis and suppresses osteoclastogenesis of human mesenchymal stem cells. Exp. Cell Res. 322, 202–207. Golub, E.E., Boesze-Battaglia, K., 2007. The role of alkaline phosphatase in mineralization. Curr. Opin. Orthop. 18, 444–448. Huh, J.E., Lee, W.I., Seo, B.K., Baek, Y.H., Lee, J.D., Choi, D.Y., Park, D.S., 2011. Gastroprotective and safety effects of WIN-34B, a novel treatment for osteoarthritis, compared to NSAIDs. J. Ethnopharmacol. 137, 1011–1017. Huh, J.E., Park, Y.C., Seo, B.K., Lee, J.D., Baek, Y.H., Choi, D.Y., Park, D.S., 2013. Cartilage protective and chondrogenic capacity of WIN-34B, a new herbal agent, in the collagenase-induced osteoarthritis rabbit model and in progenitor cells from subchondral bone. Evid.-based Complement. Altern. Med. 2013, 527561. Huh, J.E., Seo, B.K., Baek, Y.H., Lee, S., Lee, J.D., Choi, D.Y., Park, D.S., 2012a. Standardized butanol fraction of WIN-34B suppresses cartilage destruction via inhibited production of matrix metalloproteinase and inflammatory mediator in osteoarthritis human cartilage explants culture and chondrocytes. BMC Complement. Altern. Med. 12, 256. Huh, J.E., Seo, B.K., Park, Y.C., Kim, J.I., Lee, J.D., Choi, D.Y., Baek, Y.H., Park, D.S., 2012b. WIN-34B, a new herbal medicine, inhibits the inflammatory response by inactivating IkappaB-alpha phosphorylation and mitogen activated protein kinase pathways in fibroblast-like synoviocytes. J. Ethnopharmacol. 143, 779–786. Jones, E.A., Kinsey, S.E., English, A., Jones, R.A., Straszynski, L., Meredith, D.M., Markham, A.F., Jack, A., Emery, P., McGonagle, D., 2002. Isolation and characterization of bone marrow multipotential mesenchymal progenitor cells. Arthritis Rheum. 46, 3349–3360. Kang, M., Jung, I., Hur, J., Kim, S.H., Lee, J.H., Kang, J.Y., Jung, K.C., Kim, K.S., Yoo, M.C., Park, D.S., Lee, J.D., Cho, Y.B., 2010. The analgesic and anti-inflammatory effect of WIN-34B, a new herbal formula for osteoarthritis composed of Lonicera japonica Thunb and Anemarrhena asphodeloides BUNGE in vivo. J.

236

B.-K. Seo et al. / Journal of Ethnopharmacology 193 (2016) 227–236

Ethnopharmacol. 131, 485–496. Kassem, M., Abdallah, B.M., 2008. Human bone-marrow-derived mesenchymal stem cells: biological characteristics and potential role in therapy of degenerative diseases. Cell Tissue Res. 331, 157–163. Khosla, S., 2001. Minireview: the OPG/RANKL/RANK system. Endocrinology 142, 5050–5055. Lane, N.E., Yao, W., 2009. Developments in the scientific understanding of osteoporosis. Arthritis Res. Ther. 11, 228. Minkin, C., 1982. Bone acid phosphatase: tartrate-resistant acid phosphatase as a marker of osteoclast function. Calcif. Tissue Int. 34, 285–290. Miyazaki, T., Katagiri, H., Kanegae, Y., Takayanagi, H., Sawada, Y., Yamamoto, A., Pando, M.P., Asano, T., Verma, I.M., Oda, H., Nakamura, K., Tanaka, S., 2000. Reciprocal role of ERK and NF-kappaB pathways in survival and activation of osteoclasts. J. Cell Biol. 148, 333–342. O’Brien, C.A., Nakashima, T., Takayanagi, H., 2013. Osteocyte control of osteoclastogenesis. Bone 54, 258–263. Oshita, K., Yamaoka, K., Udagawa, N., Fukuyo, S., Sonomoto, K., Maeshima, K., Kurihara, R., Nakano, K., Saito, K., Okada, Y., Chiba, K., Tanaka, Y., 2011. Human mesenchymal stem cells inhibit osteoclastogenesis through osteoprotegerin production. Arthritis Rheum. 63, 1658–1667. Perez-Sayans, M., Somoza-Martin, J.M., Barros-Angueira, F., Rey, J.M., Garcia-Garcia, A., 2010. RANK/RANKL/OPG role in distraction osteogenesis. Oral Surg. Oral Med. Oral Pathol. Oral. Radiol. Endod. 109, 679–686.

Sun, Y.G., Du, Y.F., Yang, K., Chang, L., Cao, L., Ren, Y.P., Sun, Q., Wang, Q., Zhang, L.T., Lv, P.T., 2013. A comparative study on the pharmacokinetics of a traditional Chinese herbal preparation with the single herb extracts in rats by LC-MS/MS method. J. Pharm. Biomed. Anal. 81–82, 34–43. SW, K., 2013. Management of osteoporosis: who to treat, what to use, and for how long? Korean J. Med 85 (4), 364–373. Theoleyre, S., Wittrant, Y., Tat, S.K., Fortun, Y., Redini, F., Heymann, D., 2004. The molecular triad OPG/RANK/RANKL: involvement in the orchestration of pathophysiological bone remodeling. Cytokine Growth Factor Rev. 15, 457–475. Wright, N.C., Looker, A.C., Saag, K.G., Curtis, J.R., Delzell, E.S., Randall, S., DawsonHughes, B., 2014. The recent prevalence of osteoporosis and low bone mass in the United States based on bone mineral density at the femoral neck or lumbar spine. J. Bone Miner. Res.: Off. J. Am. Soc. Bone Miner. Res. 29, 2520–2526. Yang, F., Tang, E., Guan, K., Wang, C.Y., 2003. IKK beta plays an essential role in the phosphorylation of RelA/p65 on serine 536 induced by lipopolysaccharide. J. Immunol. (Baltimore Md: 1950) 170, 5630–5635. Yoo, H.J., Kang, H.J., Song, Y.S., Park, E.H., Lim, C.J., 2008. Anti-angiogenic, antinociceptive and anti-inflammatory activities of Lonicera japonica extract. J. Pharm. Pharmacol. 60, 779–786. Zhang, X., Yang, M., Lin, L., Chen, P., Ma, K.T., Zhou, C.Y., Ao, Y.F., 2006. Runx2 overexpression enhances osteoblastic differentiation and mineralization in adipose – derived stem cells in vitro and in vivo. Calcif. Tissue Int. 79, 169–178.