- Email: [email protected]
Effect of melatonin on monochromatic light-induced T-lymphocyte proliferation in the thymus of chickens
Journal of Photochemistry & Photobiology, B: Biology 161 (2016) 9–16
Contents lists available at ScienceDirect
Journal of Photochemistry & Photobiology, B: Biology journal homepage: www.elsevier.com/locate/jphotobiol
Effect of melatonin on monochromatic light-induced T-lymphocyte proliferation in the thymus of chickens Fuju Chen a, Aikebaier Reheman a, Jing Cao a, Zixu Wang a, Yulan Dong a, Yuxian Zhang b, Yaoxing Chen a,⁎ a b
Laboratory of Veterinary Anatomy, College of Veterinary Medicine, China Agricultural University, Beijing 100193, China Department of Animal Husbandry and Veterinary, Beijing Vocational College of Agriculture, Beijing 102442, China
a r t i c l e
i n f o
Article history: Received 20 January 2016 Received in revised form 22 April 2016 Accepted 2 May 2016 Available online 03 May 2016 Keywords: Monochromatic light Melatonin Melatonin antagonists T-lymphocyte Thymus Chicken
a b s t r a c t A total of 360 post-hatching day 0 (P0) Arbor Acre male broilers, including intact, sham operation and pinealectomy groups, were exposed to white light (WL), red light (RL), green light (GL) and blue light (BL) from a lightemitting diode (LED) system until for P14. We studied the effects of melatonin and its receptors on monochromatic light-induced T-lymphocyte proliferation in the thymus of broilers. The density of proliferating cell nuclear antigen (PCNA) cells and the proliferation of T-lymphocytes in response to Concanavalin A (ConA) in GL significantly increased both in vivo and in vitro (from 9.57% to 32.03% and from 34.30% to 50.53%, respectively) compared with other lights (p b 0.005) and was strongly correlated with melatonin levels in plasma (p b 0.005). Pinealectomy reduced the levels of circulatory melatonin and the proliferation of T-lymphocytes and eliminated the differences between GL and other lights (p b 0.005). However, exogenous melatonin (10−9 M) significantly increased the proliferative activity of T-lymphocyte by 9.64% (p = 0.002). In addition, GL significantly increased mRNA expression levels of Mel1a, Mel1b and Mel1c receptors from 21.09% to 32.57%, and protein expression levels from 24.43% to 42.92% compared with RL (p b 0.05). However, these effects were blocked after pinealectomy. Furthermore, 4P-PDOT (a selective Mel1b antagonist) and prazosin (a selective Mel1c antagonist) attenuated GL-induced T-lymphocyte proliferation in response to ConA (p = 0.000). Luzindole (a nonselective Mel1a/ Mel1b antagonist), however, did not induce these effects (p = 0.334). These results suggest that melatonin may mediate GL-induced T-lymphocyte proliferation via the Mel1b and Mel1c receptors but not via the Mel1a receptor. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Light, being one of the most important environmental stimuli, may affect the immune response. For example, Mann et al. [1] and Ahmad and Haldar [2] reported that rodents had higher splenocyte proliferation in response to Concanavalin A (ConA) and greater number of lymphocytes, total leukocyte counts and thymus weight in the Indian palm Funambulus pennanti squirrel under a short-day photoperiod compared to a long-day photoperiod. Moore and Siopes [3] found that short day and long day juvenile birds had a higher cellular and humoral immune response compared with constant light juvenile birds. However, these studies on the effects of light on the immune response primarily focused on the effects of the photoperiod. Our recent previous studies indicated that combination monochromatic light could effectively enhance the spleen T-lymphocyte proliferation of broilers compared to single monochromatic lights [4]. These results suggested that light color can influence the immune response. However, little is known regarding the mechanisms underlying the effect of light color on the immune ⁎ Corresponding author at: Laboratory of Veterinary Anatomy, College of Veterinary Medicine, China Agricultural University, Haidian, Beijing 100193, China. E-mail address: [email protected] (Y. Chen).
http://dx.doi.org/10.1016/j.jphotobiol.2016.05.001 1011-1344/© 2016 Elsevier B.V. All rights reserved.
response. Increasing evidence suggests that alteration in specific immune parameters is correlated with the melatonin levels in plasma [5, 6], the release of which is mediated by the photoperiod [7,8]. Conversely, melatonin, as an endogenous mediator of environmental light information, is secreted primarily from the pineal gland and is involved in the regulation of the immune response [9,10]. Increasing evidence suggests that melatonin exerts its immunomodulation through specific G-protein coupled high-affinity membrane receptors (Mel1a/ Mel1b) [6,11] that are expressed on lymphoid cells and in the immune system (e.g., thymus) of several animal species [12,13]. In vitro melatonin enhanced lymphocyte proliferation through its receptors [14]. Our previous studies have shown that melatonin enhanced light-induced bursal B-lymphocyte proliferation in broilers via Mel1a and Mel1c receptors but not via the Mel1b receptor [15]. However, Drazen [16] reported that the Mel1b receptor but not the Mel1a receptor may be involved in the melatonin-induced splenocyte proliferation in mice, suggesting that lymphocytes that are derived from different sources (e.g., bursal B-lymphocyte vs. spleen T-lymphocyte) might respond differently to photoperiod and or melatonin [17]. Furthermore, previous studies also indicated that there is a tissue-specific pattern in the expression of melatonin receptor subtypes in lymphoid organs [18,19]. Interestingly, it is unknown whether the melatonin-mediated light-
10
F. Chen et al. / Journal of Photochemistry & Photobiology, B: Biology 161 (2016) 9–16
induced T-lymphocyte proliferation in the thymus follows the same pattern. Thus, the present study investigated whether melatonin mediates the monochromatic light-induced T-lymphocyte proliferation in the thymus of broilers and also identified the specific receptor subtypes that could be directly involved in these effects. 2. Materials and Methods
The plasma levels of melatonin were estimated using a commercial ELISA kit for chicken melatonin (Cloud-Clone Corp., Houston, USA) according to the manufacturer's protocol. The intra- and inter-assay variation for melatonin was 3.3% and 8.9%, respectively. The sensitivity for melatonin was 4.52 pg/mL. Each sample was measured in triplicate. The concentration of melatonin was expressed as pg/mL plasma. 2.4. Immunohistochemical Study
2.1. Animals and Treatments All animal procedures received the approval of the Animal Welfare Committee of the Agricultural Research Organization, China Agricultural University in Beijing. A total of 360 post-hatching day 0 (P0) Arbor Acre male broilers (Beijing Huadu Breeding Co., Beijing, China) were randomly housed in three separate rooms (120 birds/room). Each room contained four light cells (30 birds/cell), white light (WL, 400 to 760 nm), red light (RL, 660 nm), green light (GL, 560 nm) and blue light (BL, 480 nm), which were illuminated with a light-emitting diode (Hongli Tronic Co., Guangzhou, China) system until for P14. All of the light sources were equalized to an illuminance of 15 ± 0.3 lx at the bird-head level with a light period of 23 h daily (23 L:1 D, light off at 2300 h). Each cell contained three pens (10 birds/pen) and included the pinealectomy group, the sham-operated group and the intact group at a density of 11.5 birds/m2. The ambient temperature was maintained at approximately 32 °C for the first week and later reduced to 25 °C in the second week, and the relative humidity was maintained at 60% for the entire period. The broilers had ad libitum access to feed and water. The diet was formulated to meet or exceed the nutrient recommendations of the National Research Council for poultry [20]. Pinealectomy and sham operations were performed on each lighttreatment group at P3. Before each surgery, the birds were deeply anesthetized with intraperitoneal injections of Nembutal (30 to 40 μg/g). The operation procedures were carried as described by Karaganis et al. [21]. 2.2. Plasma and Tissue Preparations Three broilers from each pen per room in each of the intact, shamoperated and pinealectomy groups were selected at 800 h on P14. Blood samples were collected via a cardiac puncture for ELISA. Next, at 2200 h on P14, broilers were killed by exsanguination under anesthesia with Nembutal (30 to 40 μg/g), and the thymus was aseptically removed and divided into two parts; one part of the thymus was fixed in 4% paraformaldehyde in 0.1 M PBS (pH 7.4, 4 °C) for immunohistochemistry, and the other part was used to determine the expressions of mRNA and protein levels using RT-PCR and western blotting. In addition, the other three broilers from each pen per cell were used for a lymphocyte proliferation assay. 2.3. Melatonin Assays Plasma samples were collected and separated by centrifugation at 100 ×g for 30 min and stored at −80 °C for melatonin assays.
Paraffin sections of thymus (5 μm) were prepared and stained for proliferating cell nuclear antigen (PCNA). Briefly, sections were incubated with primary antibody (dilution 1:2000, Sigma, St. Louis, MO, USA) overnight at 4 °C, then washed in 0.01 M PBS (pH 7.4), and incubated with biotinylated donkey anti-mouse IgG secondary antibody (dilution 1:300, CoWin Biotech Co., Inc., Beijing, China) for 2 h at room temperature. After three washes for 5 min in PBS, samples were incubated with streptavidin-horseradish peroxidase (1:300, Vector Laboratories, Burlingame, CA, USA) for 2 h at room temperature in the dark. Next, the sections were incubated with 0.05% 3′,3-diaminobenzidine tetrahydrochloride (DAB, Sigma) in 0.05 M Tris-HCl (pH 7.4) and 0.003% hydrogen peroxide for 10 min in the dark. Finally, the sections were counterstained with hematoxylin, dehydrated and cover slipped. Brown-stained cells indicated a positive reaction to PCNA, slides that were treated similarly but without primary antibody treatment served as a negative control. The PCNA-positive cells per mm2 in the cortical and medulla zone of the thymus were counted in 5 random fields from 5 cross-sections of the 3 broilers from each pen. 2.5. Lymphocyte Proliferative Activity Assay Lymphocyte proliferative activity in response to Concanavalin A (ConA) was determined using a 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyl tetrazolium (MTT, Sigma) assay. At P14, the thymus of broilers was removed under sterile condition and a single-cell suspension was prepared with RPMI 1640 medium (Gibco BRL, Grand Island, NY, USA), and cell counts were adjusted to 107 cells/mL following a viability evaluation (number of viable cells exceeding 95%) using the trypan blue exclusion method. The cell suspension (106 cells/well) was added to 96well flat Bottom plates (Costar 3599; Corning Inc., Corning, NY, USA). Next, either ConA (25 μg/mL, Sigma) or melatonin (10−10 M–10−3 M, Sigma) was added, and the cells were incubated at 41 °C with 5% CO2. After 44 h, 10 μL of MTT (5 mg/mL in D-Hank's, pH 7.4) was added to each well and incubated for an additional 4 h, after which the cells were incubated with 100 μL of 10% SDS in 0.04 M HCl for 4 h. The optical density (OD) was determined with an automated ELISA reader (Model 680, Bio-Rad, St. Louis, MO, USA) at 570 nm. The proliferative activity of the T-lymphocyte was expressed as the stimulation index (SI) as follows: SI = OD570 (stimulated cells)/OD570 (unstimulated cells). Furthermore, cell suspensions of the GL intact group were prepared for preincubation with 10 μM of luzindole (a nonselective antagonist of both Mel1a and Mel1b; Santa Cruz Biotechnology Inc., Dallas, TX, USA), 0.1 μM of 4-phenyl-2-propionamidotetralin (4-P-PDOT; a selective antagonist of Mel1b; Tocris Bioscience, Bristol, UK) and 0.1 μM of prazosin (a selective antagonist of Mel1c; Santa Cruz) for 30 min prior to the
Table 1 Primer sequences for RT-PCR assays. Gene
Accession number
Primer sequence (5′-3′)
Product size (bp)
Accession no.
Mel1a
NM_205362.1
333
MTNR1A
Mel1b
XM_417201.2
259
MTNR1B
Mel1c
NM_205361.1
237
LOC396318
GAPDH
NM_204305
F: CAATGGATGGAATCTGGG A R: GCTATGGGAAGTATGAAGTGG F: TTTGCTGGGCAC CTC TAA AC F: TTTGCTGGGCAC CTC TAA AC F: TTTGCTGGGCAC CTC TAA AC F: TTTGCTGGGCAC CTC TAA AC F: ATCACAGCCACA CAG AAGACG F: ATCACAGCCACA CAG AAGACG
124
GAPDH
F. Chen et al. / Journal of Photochemistry & Photobiology, B: Biology 161 (2016) 9–16
11
Fig. 1. Effect of monochromatic lights on the expression of PCNA in the cortex (A–H) and medulla (I–P) of broiler thymus in intact (A–D and I–L) and pinealectomy groups (E–H and M–P) at P14. WL (white light): A, E, I and M; RL (red light): B, F, J and N; GL (green light): C, G, K and O; and BL (blue light): D, H, L and P. Arrows indicated the immunoreactive cells. Bar = 25 μm. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
addition of ConA (25 μg/mL, Sigma) and melatonin (10−9 M, Sigma). The suspensions were incubated at 41 °C with 5% CO2 for 44 h, and the OD value was later determined. The control cells were incubated with RPMI 1640 medium, luzindole, 4P-PDOT, prazosin, and 0.01% ethanol or 0.01% dimethylsulfoxide.
2.6. RT-PCR Total RNA was extracted from thymus, and cDNA synthesis was performed using a reverse transcription kit (Thermo Fisher Scientific, Boston, USA). For the reverse transcription reaction, 2 μg of RNA was used in a 20-μL reaction mixture containing 1 μL of random hexamer primer and 0.5 μL of RNasin ribonuclease and incubated at 65 °C for 5 min. A total of 1 μL of reverse transcriptase was added, and the tube was later incubated at 42 °C for 60 min. The reaction was terminated by heating at 70 °C for 5 min. PCR amplification was carried out as follows: an initial denaturation step at 95 °C for 5 min followed by 30–32 cycles at 95 °C for 30 s; 57 °C for 30 s and 72 °C for 30 s and a final extension step at 72 °C for 5 min. The PCR products were electrophoresed on a 1% agarose
gel, then the melatonin receptor 1a (Mel1a), Mel1b, Mel1c and corresponding glyceraldehydes-3-phosphate dehydrogenase (GAPDH) mRNA levels in the thymus were measured by professional image analysis software (Gel-pro analyzer 4.5, Media Cybernetics Inc., Bethesda, MD, USA) and shown as the maximum optical density (Max. OD). The results were expressed as the Max. OD of Mel1a, Mel1b and Mel1c vs. the Max. OD of corresponding GAPDH. The results were obtained from three separate experiments. The PCR primers are listed in Table 1.
2.7. Western Blot Analysis The thymus was extracted using RIPA lysis buffer and 80 μg of protein were separated using 10% SDS-PAGE and transferred to a PVDF membrane (Millipore, Billerica, MA USA). Next, the membranes were blocked with 5% skim milk for 2 h at room temperature. Subsequently, the membranes were incubated with monoclonal mouse anti-β-actin (1:4000, CoWin Biotech Co., Inc.) or polyclonal goat anti-Mel1a, Mel1b and Mel1c (1:200, sc-13,186, sc-13,177, and sc-18,574, respectively, Santa Cruz) for overnight at 4 °C, and then HRP-conjugated goat anti-
Table 2 Effect of monochromatic lights on the density of PCNA-positive cells (×102 cells/mm2) of broiler thymus in intact and pinealectomy groups at P14 (n = 9). Light treatments Parameter
Group WL
Cortex Medulla
Intact Pinealectomy Intact Pinealectomy
RL b
72.26 ± 1.16 52.48 ± 1.54⁎ 52.78 ± 1.39b 41.99 ± 1.49⁎
GL c
56.04 ± 0.42 51.03 ± 1.96⁎ 42.76 ± 1.46c 39.68 ± 1.21
BL a
79.91 ± 1.70 55.86 ± 2.46⁎ 68.87 ± 1.99a 44.97 ± 1.56⁎
64.79 ± 1.69bc 53.65 ± 1.49⁎ 46.81 ± 1.27c 39.45 ± 1.20⁎
Note: Values marked with the different letters represented significantly difference among four monochromatic lights in the intact and pinealectomy groups (p b 0.05). ⁎ p b 0.05 versus the intact group that underwent the same light treatment.
12
F. Chen et al. / Journal of Photochemistry & Photobiology, B: Biology 161 (2016) 9–16
mouse (1:4000, CoWin Biotech Co., Inc.) or donkey anti-goat (1:3000, CoWin Biotech Co., Inc.) for 2 h at room temperature. The bands obtained in the blots were scanned and analyzed using Gel-Pro Analyzer 4.5 software and expressed as the integral optical density (IOD) of the band. The date for the levels of the Mel1a, Mel1b, Mel1c protein was expressed as the IOD of the Mel1a, Mel1b, Mel1c bands vs. the IOD of the corresponding β-actin bands. The results were obtained from three separate experiments.
2.8. Statistical Analysis All data were expressed as means ± SEM. Significant differences were evaluated by two-way analysis of variance (ANOVA) followed by Duncan's multiple comparisons post-hoc test with SPSS 11.5 (SPSS Inc., Chicago, IL, USA). Analysis of correlation (Pearson) was performed between the plasma melatonin levels and the density of PCNA-positive cells and T-lymphocyte proliferation. The statistical difference between the intact and pinealectomy groups under the same light treatment was evaluated by independent sample t-test. Values of p b 0.05 were considered statistically significant.
3. Results 3.1. PCNA Expression in the Thymus The PCNA-positive cells were scattered in the thymic medulla (Fig. 1I–1P) and were more densely distributed throughout the cortex (Fig. 1A–1H). As shown in Table 2, the density of PCNA-positive cells in the thymic cortex was the highest (from 9.57% to 29.87%) in GL compared to other monochromatic lights (p = 0.000) followed by WL and BL. Moreover, the density of PCNA-positive cells in the thymic cortex in the sham-operated group showed no differences compared with the corresponding intact group (p = 0.269–0.970) (sham-operated group data not shown). Pinealectomy reduced the density of PCNA-positive cells in the thymic cortex, the density was significantly reduced (from 8.94% to 30.10%) compared to those of the intact group. However, no differences were observed among the various pinealectomy groups (p = 0.074–0.672), which may be the result of the pinealectomy blunting the differences in the density of PCNA-positive cells in the thymic cortex. Similar to the thymic cortex, the density of PCNA-positive cells in thymic medulla was the highest in GL intact group (from 23.36% to 37.91%) compared to the other monochromatic lights (p = 0.000) followed by WL and BL; however, there were no marked differences between RL and BL (p = 0.061). Pinealectomy reduced the density of PCNA-positive cells in the thymus. The density was significantly reduced by 20.44% in WL (p = 0.000), 34.70% in GL (p = 0.000) and 15.72% in BL (p = 0.000) compared with those of the intact group. In the pinealectomy group, the density of PCNA-positive cells was similar among WL-, RL-, GL-, and BL-treated groups (p = 0.144–0.997).
Fig. 2. Effect of monochromatic lights on thymus T-lymphocyte proliferation in response to ConA in the intact and pinealectomy groups at P14. a–c values for the intact or pinealectomy groups with no common letters are significantly different (p b 0.05). * Significant difference between the intact and pinealectomy groups under the same light treatment (p b 0.05). WL, white light; RL, red light; GL, green light; BL, blue light.
3.3. Melatonin Concentration in the Plasma As shown in Fig. 3, the broilers that were exposed to GL showed remarkably higher levels of circulatory melatonin compared to broilers reared under WL, RL and BL (p = 0.007–0.047). Compared to GL, the plasma melatonin concentration decreased by 23.83% in WL (p = 0.007), 23.62% in RL (p = 0.013) and 15.45% in BL (p = 0.047), however, no differences were observed among WL-, RL- and BL-treated groups (p = 0.352–1.000). Pinealectomy reduced the levels of circulatory melatonin. After pinealectomy, the plasma melatonin concentration was remarkably decreased by 37.75% in WL (p = 0.001), 44.87% in RL (p = 0.000), 50.16% in GL (p = 0.000) and 44.54% in BL (p = 0.002) compared with the intact group. However, no differences were observed among the pinealectomy groups (p = 0.491–1.000). In addition, the correlation analysis revealed a positive correlation between the plasma concentration of melatonin and the density of PCNA-positive cells (cortex: r = 8.390, p b 0.009; medulla: r = 0.815, p b 0.014) and T-lymphocyte proliferation (r = 0.784, p b 0.003).
3.4. Effect of Exogenous Melatonin on T-Lymphocyte Proliferation in Vitro The MTT assay was performed to determine the effect of 10−10 M to 10 M doses of melatonin on T-lymphocyte proliferation after 44 h of culture. Compared with the control cells, the proliferation of Tlymphocytes was increased by 9.64% (p = 0.002) when treated with melatonin (10−9 M) (Fig. 4). Although T-lymphocyte proliferative −3
3.2. T-Lymphocyte Proliferation in the Thymus in Vitro As shown in Fig. 2, T-lymphocyte proliferation in response to ConA was higher in GL intact group (from 34.30% to 50.53%) compared to the other monochromatic lights (p = 0.000–0.029) followed by WL and BL. However, there were no differences between WL and BL (p = 0.060). Pinealectomy inhibited the proliferation of T-lymphocytes. After pinealectomy, the proliferative activities were decreased by 11.84% in WL (p = 0.013), 2.42% in RL (p = 0.348), 15.61% in GL (p = 0.008) and 5.68% in BL (p = 0.053) compared with the intact group. However, there were no differences among the pinealectomy broilers exposed to various monochromatic lights (p = 0.113–0.740).
Fig. 3. Effect of monochromatic lights on melatonin plasma concentration in the intact and pinealectomy broilers reared with white light (WL), red light (RL), green light (GL) and blue light (BL) at P14. a–b values for the intact or pinealectomy groups with no common letters are significantly different (p b 0.05). * Significant difference between the intact and pinealectomy groups under the same light treatment (p b 0.05).
F. Chen et al. / Journal of Photochemistry & Photobiology, B: Biology 161 (2016) 9–16
13
3.5. mRNA Levels of Mel1a, Mel1b and Mel1c in the Thymus
Fig. 4. Effect of exogenous melatonin on T-lymphocyte proliferation in the thymus in response to ConA in the GL intact group. The lymphocytes were treated with 10−10 M to 10−3 M doses of melatonin after 44 h of culture. Data are means ± SEM. * p b 0.05 versus the control cells.
activity had a slight dose-dependent decrease across a range of concentrations (10−8 M to 10−3 M), melatonin (10− 8 M to 10− 5 M) augmented the T-lymphocyte proliferation from 5.88% to 9.35% compared with the control cells (p = 0.004–0.047), and melatonin (10−4 M to 10−3 M) did not further increase lymphocyte proliferation (p = 0.290–0.602).
As shown in Fig. 5, mRNA transcripts of the three melatonin receptor subtypes (Mel1a, Mel1b and Mel1c) were amplified in the thymus of broiler at P14, and relative levels of Mel1c were increased from 21.09% to 29.96% in the GL intact group compared with the other groups treated with monochromatic lights (p = 0.000–0.003). Similar to Mel1c, Mel1a mRNA levels were 23.19% higher in GL than in RL (p = 0.023) and were 25.70% higher in BL (p = 0.027), while Mel1b mRNA levels in GL were increased by 28.21% compared with WL (p = 0.027), and increased by 32.57% compared with RL (p = 0.005). After pinealectomy, mRNA levels of Mel1a, Mel1b and Mel1c were significantly reduced from 35.32% to 46.74% in Mel1a (p = 0.005– 0.032), from 33.88% to 50.36% in Mel1b (p = 0.013–0.150) and from 36.30% to 47.22% in Mel1c (p = 0.000–0.039), respectively. However, no differences were found among the pinealectomy broilers treated with various monochromatic lights (Mel1a, p = 0.914–0.997; Mel1b, p = 0.515–0.684; Mel1c, p = 0.502–0.993). 3.6. Protein Expression of Mel1a, Mel1b and Mel1c in the Thymus As shown in Fig. 6, the western blot analysis showed bands of approximately 39-kDa (Mel1a), 36-kDa (Mel1b) and 25-kDa (Mel1c) in the thymus of broilers at P14. Similar to the mRNA expression, GL in the intact group significantly upregulated Mel1c protein levels by
Fig. 5. Effect of monochromatic lights on mRNA levels of Mel1a, Mel1b and Mel1c in broiler thymus of intact and pinealectomy groups. a–b values for the intact or pinealectomy groups with no common letters are significantly different (p b 0.05). * Significant difference between the intact and pinealectomy groups under the same light treatment (p b 0.05). Mel1a, melatonin receptor subtype 1a; Mel1b, melatonin receptor subtype 1b; Mel1c, melatonin receptor subtype 1c; GAPDH, glyceraldehydes phosphate dehydrogenase. WL, white light; RL, red light; GL, green light; BL, blue light.
14
F. Chen et al. / Journal of Photochemistry & Photobiology, B: Biology 161 (2016) 9–16
47.80% (p = 0.001), 24.43% (p = 0.001) and 52.52% (p = 0.032) compared to that of WL, RL and BL (p = 0.003), respectively. Similar results were found for Mel1a and Mel1b receptors, although no differences were found between GL and WL (p = 0.836) for Mel1a, or between GL and BL for Mel1b (p = 0.153). Pinealectomy downregulated the protein levels of Mel1a, Mel1b and Mel1c (Mel1a, p = 0.004–0.019; Mel1b, p = 0.002–0.036; Mel1c, p = 0.000–0.038). However, there were no differences among the pinealectomy broilers exposed to various monochromatic lights (Mel1a, p = 0.180–0.957; Mel1b, p = 0.304–0.784; Mel1c, p = 0.274–0.998). 3.7. T-Lymphocytes Treated with Specific Melatonin Receptor Antagonists in Vitro The T-lymphocytes of the intact group exposed to GL were treated with specific melatonin receptor antagonists to assess whether the proliferation effect of melatonin on T-lymphocytes is directly mediated by the melatonin receptors and to determine which subtype mediated the proliferation response. As shown in Fig. 7, treatment with melatonin (10−9 M) or ConA (25 μg/mL) alone effectively increased T-lymphocyte proliferation when compared with the control cells (p = 0.000–0.015). Furthermore, the combination of ConA and melatonin significantly increased T-lymphocyte proliferation compared with ConA or melatonin alone (from 5.29% to 8.85%, p = 0.000–0.009). To investigate which subtype receptor mediated the proliferation response, cells were treated with 4P-PDOT (0.1 μM) or prazosin (0.1 μM) alone, as well as in combination with ConA and melatonin. The combination remarkably attenuated T-lymphocyte proliferation compared to the ConA and melatonin co-treated group (4P-PDOT: by 24.59%, p = 0.001; prazosin: by 41.35%, p = 0.000). Luzindole (10 μM), however, which was coincubated with ConA and melatonin, showed no statistical significance when compared with the ConA and melatonin co-treated group (p =
0.334), and there were no differences among the groups treated with luzindole, 4P-PDOT, prazosin, 0.01% ethanol or 0.01% dimethylsulfoxide alone compared to the control cells (p = 0.359–0.997). 4. Discussion 4.1. GL Enhanced T-Lymphocyte Proliferation in the Thymus Our previous studies showed that GL enhanced T-lymphocyte proliferation of the spleen [22] and B-lymphocyte proliferation of the bursal [23]. In the present study, we found that in broilers, GL better enhanced thymus T-lymphocyte proliferation compared to other light treatments. These results further confirmed our previous findings [22,23]. However, the results were discordant with those of Scott and Siopes [24] who reported that RL enhanced the cellular immune response compared to GL and BL after 15 weeks of exposure. This difference was probably due to the differences in the species, age of animal and light sources (e.g., 15 weeks turkey vs. 2 weeks broiler and fluorescent lamp vs. LED lamp) between the two studies. 4.2. The Effect of Melatonin on Light-Mediated T-Lymphocyte Proliferation in Response to ConA in the Thymus Li et al. [23] reported that GL promoted melatonin secretion and, in turn, enhanced B-lymphocyte proliferation. Our results found that GL increased the levels of circulatory melatonin; this effect was correlated with changes in T-lymphocyte proliferation in the thymus. Pinealectomy abolished the effect of GL on the melatonin secretion and reduced the levels of circulatory melatonin and the proliferative activity of Tlymphocytes. However, administration of exogenous melatonin (10− 9 M to 10− 5 M) enhanced T-lymphocyte proliferation dosedependently (Fig. 4). These findings suggested that melatonin mediated
Fig. 6. Effect of monochromatic lights on protein levels of Mel1a, Mel1b and Mel1c in the broiler thymus of intact and pinealectomy groups. a–c values for the intact or pinealectomy groups with no common letters are significantly different (p b 0.05). * Significant difference between the intact and pinealectomy groups under the same light treatment (p b 0.05). Mel1a, melatonin receptor subtype 1a; Mel1b, melatonin receptor subtype 1b; Mel1c, melatonin receptor subtype 1c. WL, white light; RL, red light; GL, green light; BL, blue light.
F. Chen et al. / Journal of Photochemistry & Photobiology, B: Biology 161 (2016) 9–16
15
Fig. 7. Effect of specific melatonin receptor antagonist luzindole, 4P-PDOT and prazosin on GL-induced T-lymphocyte proliferation in response to ConA in the GL intact group. The lymphocyte was treated with DMSO (dimethylsulfoxide), ethanol, ConA (25 μg/mL), Mel (melatonin, 10−9 M), luzindole (a nonselective antagonist both Mel1a and Mel1b, 10 μM), 4P-PDOT (4-phenyl-2-propionamidotetralin, a selective antagonist of Mel1b, 0.1 μM) and prazosin (a selective antagonist of Mel1c, 0.1 μM) alone, or luzindole, 4P-PDOT and prazosin in combination with Mel. a–d values with no common letters are significantly different (p b 0.05).
the GL-induced T-lymphocyte proliferation in the thymus of broiler chickens. Our results are in agreement with those of Haldar and Ahmad [2], who suggested that short days enhance melatonin secretion, which subsequently increase ConA-induced splenocyte proliferation in the Indian palm squirrel. In addition, the present results found that 10−9 M to 10−5 M melatonin enhanced T-lymphocyte proliferation. These observations are consistent with the results that melatonin (10−12 M to 10− 6 M) enhanced human peripheral blood mononuclear cell proliferation [25]. However, these results contradict the observation that melatonin (10−9 M to 10−2 M) inhibited Chinese hamster ovarian cell proliferation [26]. This difference may be due to the differences in the cell type and cell sensitivity to melatonin [27]. 4.3. The Melatonin Receptor Subtypes Mediate T-Lymphocyte Proliferation in Response to ConA in the Thymus Melatonin exhibits its immunomodulatory effect via specific receptors. In rodents, two subtypes of the G-protein coupled melatonin receptor subtypes, Mel1a (MT1) and Mel1b (MT2), have been identified within the thymus of several animal species [28,29]. However, Mel1c is only found in fish, chicken, and frog [30]. The present study demonstrated that three melatonin receptor subtypes (Mel1a, Mel1b and Mel1c) were expressed in the thymus of broilers. Similar findings were also reported in the Funambulus pennanti thymus, although these studies did not detect Mel1c [2,18]. Moreover, GL upregulated both mRNA and protein levels of Mel1a, Mel1b and Mel1c, while pinealectomy downregulated this expression. The plasma levels of melatonin and the proliferation of T-lymphocytes show the highest values under GL and decrease after pinealectomy, which suggests that melatonin enhanced T-lymphocyte proliferation may through melatonin receptor subtypes. This finding is supported by studies showing photoperiodic regulation of the expression of the Mel1a and Mel1b melatonin receptor is associated with the regulation of melatonin levels in the Funambulus pennant thymus [18]. However, the receptors that are involved in mediating the GL-induced T-lymphocyte proliferation remain unknown. Thus, in the present study, luzindole, 4P-PDOT and prazosin were used to investigate the melatonin-induced T-
lymphocyte proliferation. Based on a previously published study [15] and our preliminary investigation, 10 μM of luzindole, 0.1 μM of 4PPDOT and 0.1 μM of prazosin were applied. We observed that 4PPDOT and prazosin attenuated the GL-induced T-lymphocyte proliferation in response to ConA. The addition of luzindole, however, had no effect on T-lymphocyte proliferation. The present study suggested that Mel1b and Mel1c receptors could be, at least partly, involved in the GL-induced T-lymphocyte proliferation in response to ConA. However, the Mel1a receptor subtype may not be required for this effect. These results corroborated previous studies in mice that showed that MT2 but not MT1 may be involved in the enhancement of splenocyte proliferation, although that study did not detect Mel1c expression [16]. However, this finding is in contrast to the results of Markowska et al. [31], who found that Mel1b is involved in the decrease in PHA-stimulated chicken splenocyte proliferation. The authors explain that melatonin enhanced PHA-stimulated proliferation when the concentration of mitogen was suboptimal [32]. At present, the mechanism through which monochromatic light acts to enhance lymphocytes is still unclear. However, studies have shown that melatonin enhances lymphocyte proliferation by activating an intracellular signaling pathway. Yadav et al. [33] reported that melatonin regulates splenocyte proliferation via Mel1b-induced IP3-Ca2+ signaling in a seasonally breeding bird. In addition, Li et al. [15] suggested that melatonin regulates GL-induced bursal B-lymphocyte proliferation through the Mel1c and Mel1a receptor by activating the cAMP/PKA pathway. The precise signaling pathway through which melatonin, via the Mel1b and Mel1c receptor, regulates GL-induced T-lymphocyte proliferation in the thymus needs to be studied further. 5. Conclusions The present data showed that in response to ConA, GL enhanced Tlymphocyte proliferation in the thymus, which is under the control of circulating melatonin levels. The changes in the mRNA and protein levels in response to circulating melatonin levels indicate that melatonin enhances GL-induced T-lymphocyte proliferation through melatonin specific receptors. Furthermore, Mel1b and Mel1c receptors could be, at least partly, involved in the GL-induced T-lymphocyte
16
F. Chen et al. / Journal of Photochemistry & Photobiology, B: Biology 161 (2016) 9–16
proliferation in response to ConA, and Mel1a receptor subtype may not be required for this effect. Acknowledgments This work received the support of the National High Technology Research and Development Program of China (2013AA102306), the National Natural Science Foundation of China (31172277, 31272516 and 31472157), and the Chinese Specialized Research Fund for the Doctoral Program of Higher Education (20130008110031). References [1] D.R. Mann, M.A. Akinbami, K.G. Gould, A.A. Ansari, Seasonal variations in cytokine expression and cell-mediated immunity in male rhesus monkeys, Cell. Immunol. 200 (2000) 105–115. [2] R. Ahmad, C. Haldar, Photoperiod-testicular-immune interaction in a seasonal breeder Indian palm squirrel Funambulus pennanti during the reproductively inactive and active phases, J. Neuroendocrinol. 21 (2009) 2–9. [3] C.B. Moore, T.D. Siopes, Effects of lighting conditions and melatonin supplementation on the cellular and humoral immune responses in Japanese quail Coturnix coturnix japonica, Gen. Comp. Endocrinol. 119 (2000) 95–104. [4] Z. Zhang, J. Cao, Z. Wang, Y. Dong, Y. Chen, Effect of a combination of green and blue monochromatic light on broiler immune response, J. Photochem. Photobiol. B 138 (2014) 118–123. [5] D.K. Vishwas, C. Haldar, Photoperiodic induced melatonin regulates immunity and expression pattern of melatonin receptor MT1 in spleen and bone marrow mononuclear cells of male golden hamster, J. Photochem. Photobiol. B 128 (2013) 107–114. [6] S.K. Yadav, C. Haldar, Reciprocal interaction between melatonin receptors (Mel (1a), Mel (1b), and Mel (1c)) and androgen receptor (AR) expression in immunoregulation of a seasonally breeding bird, Perdicula asiatica: role of photoperiod, J. Photochem. Photobiol. B 122 (2013) 52–60. [7] C. Venegas, J.A. García, C. Doerrier, H. Volt, G. Escames, L.C. López, R.J. Reiter, D. Acuña-Castroviejo, Analysis of the daily changes of melatonin receptors in the rat liver, J. Pineal Res. 54 (2013) 313–321. [8] E. Jin, L. Jia, J. Li, G. Yang, Z. Wang, J. Cao, Y. Chen, Effect of monochromatic light on melatonin secretion and arylalkylamine N-acetyltransferase mRNA expression in the retina and pineal gland of broilers, Anat. Rec. 294 (2011) 1233–1241. [9] A. Carrillo-Vico, J.M. Guerrero, P.J. Lardone, R.J. Reiter, A review of the multiple action of melatonin on the immune system, Endocrine 27 (2005) 189–200. [10] R.M. Slominski, R.J. Reiter, N. Schlabritz-Loutsevitch, R.S. Ostrom, A.T. Slominski, Melatonin membrane receptors in peripheral tissues: distribution and functions, Mol. Cell. Endocrinol. 351 (2012) 152–166. [11] C. Haldar, R. Ahmad, Photoimmunomodulation and melatonin, J. Photochem. Photobiol. B 98 (2010) 107–117. [12] A. Carrillo-Vico, A. García-Pergañeda, L. Naji, J.R. Calvo, M.P. Romero, J.M. Guerrero, Expression of membrane and nuclear melatonin receptor mRNA and protein in the mouse immune system, Cell. Mol. Life Sci. 60 (2003) 2272–2278. [13] D.K. Vishwas, C. Haldar, MT1 receptor expression and AA-NAT activity in lymphatic tissue following melatonin administration in male golden hamster, Int. Immunopharmacol. 22 (2014) 258–265. [14] D.L. Drazen, D. Bilu, S.D. Bilbo, R.J. Nelson, Melatonin enhancement of splenocyte proliferation is attenuated by luzindole, a melatonin receptor antagonist, Am. J. Physiol. Regul. Integr. Comp. Physiol. 280 (2001) 1476–1482.
[15] J. Li, Z. Wang, J. Cao, Y. Dong, Y. Chen, Melatonin receptor subtypes Mel1a and Mel1c but not Mel1b are associated with monochromatic light-induced B-lymphocyte proliferation in broilers, Domest. Anim. Endocrinol. 45 (2013) 206–215. [16] D.L. Drazen, R.J. Nelson, Melatonin receptor subtype MT2 (Mel 1b) and not mt1 (Mel1a) is associated with melatonin-induced enhancement of cell-mediated and humoral immunity, Neuroendocrinology 74 (2001) 178–184. [17] B.J. Prendergast, S.M. Yellon, L.T. Tran, R.J. Nelson, Photoperiod modulates the inhibitory effect of in vitro melatonin on lymphocyte proliferation in female Siberian hamsters, J. Biol. Rhythm. 16 (2001) 224–233. [18] S. Gupta, C. Haldar, Nycthemeral variation in melatonin receptor expression in the lymphoid organs of a tropical seasonal breeder Funambulus pennant, J. Comp. Physiol. A Neuroethol. Sens. Neural Behav. Physiol. 200 (2014) 1045–1055. [19] Q. Guo, Y. Dong, J. Cao, Z. Wang, Z. Zhang, Y. Chen, Developmental changes of melatonin receptor expression in the spleen of the chicken, Gallus domesticus, Acta. Histochem. 117 (2015) 559–565. [20] D.H. Baker, Y. Han, Ideal amino acid profile for chicks during the first three weeks posthatching, Poult. Sci. 73 (1994) 1441–1447. [21] S.P. Karaganis, P.A. Bartell, V.R. Shende, A.F. Moore, V.M. Cassone, Modulation of metabolic and clock gene mRNA rhythms by pineal and retinal circadian oscillators, Gen. Comp. Endocrinol. 161 (2009) 179–192. [22] D. Xie, Z. Wang, J. Cao, Y. Dong, Y. Chen, Effects of monochromatic light on proliferation response of splenocyte in broilers, Anat. Histol. Embryol. 37 (2008) 332–337. [23] J. Li, J. Cao, Z. Wang, Y. Dong, Y. Chen, Melatonin plays a critical role in inducing B lymphocyte proliferation of the bursa of Fabricius in broilers via monochromatic lights, J. Photochem. Photobiol. B 142 (2015) 29–34. [24] R.P. Scott, T.D. Siopes, Light color: effect on blood cells, immune function and stress status in turkey hens, Comp. Biochem. Physiol. Comp. Physiol. 108 (1994) 161–168. [25] E. Kühlwein, M. Irwin, Melatonin modulation of lymphocyte proliferation and Th1/ Th2 cytokine expression, J. Neuroimmunol. 117 (2001) 51–57. [26] R.M. Sainz, J.C. Mayo, D.X. Tan, S. Lopez-Burillo, M. Natarajan, R.J. Reiter, Antioxidant activity of melatonin in Chinese hamster ovarian cells: changes in cellular proliferation and differentiation, Biochem. Biophys. Res. Commun. 302 (2003) 625–634. [27] K.M. Morrey, J.A. McLachlan, C.D. Serkin, O. Bakouche, Activation of human monocytes by the pineal hormone melatonin, J. Immunol. 153 (1994) 2671–2680. [28] S. Jimenez-Jorge, A.J. Jimenez-Caliani, J.M. Guerrero, M.C. Naranjo, P.J. Lardone, A. Carrillo-Vico, C. Osuna, P. Molinero, Melatonin synthesis and melatoninmembrane receptor (MT1) expression during rat thymus development: role of the pineal gland, J. Pineal Res. 39 (2005) 77–83. [29] M. Sánchez-Hidalgo, J.M. Guerrero Montávez, P. Carrascosa-Salmoral Mdel, C. Naranjo-Gutierrez Mdel, P.J. Lardone, C.A. de la Lastra Romero, Decreased MT1 and MT2 melatonin receptor expression in extrapineal tissues of the rat during physiological aging, J. Pineal Res. 46 (2009) 29–35. [30] S.M. Reppert, D.R. Weaver, V.M. Cassone, C. Godson, L.F. Kolakowski, Melatonin receptors are for the birds: molecular analysis of two receptor subtypes differentially expressed in chick brain, Neuron 15 (1995) 1003–1015. [31] M. Markowska, A. Mrozkowiak, J. Pawlak, K. Skwarło-Sońta, Intracellular second messengers involved in melatonin signal transduction in chicken splenocytes in vitro, J. Pineal Res. 37 (2004) 207–212. [32] C.A. Kliger, A.E. Gehad, R.M. Hulet, W.B. Roush, H.S. Lillehoj, M.M. Mashaly, Effects of photoperiod and melatonin on lymphocyte activities in male broiler chickens, Poult. Sci. 79 (2000) 18–25. [33] S. Kumar Yadav, C. Haldar, S. Kumar Singh, D. Dash, Melatonin regulates splenocytes proliferation via IP3-dependent intracellular Ca2+ release in seasonally breeding bird, Perdicula asiatica, J. Recept. Signal Transduct. Res. 34 (2014) 233–240.
Contents lists available at ScienceDirect
Journal of Photochemistry & Photobiology, B: Biology journal homepage: www.elsevier.com/locate/jphotobiol
Effect of melatonin on monochromatic light-induced T-lymphocyte proliferation in the thymus of chickens Fuju Chen a, Aikebaier Reheman a, Jing Cao a, Zixu Wang a, Yulan Dong a, Yuxian Zhang b, Yaoxing Chen a,⁎ a b
Laboratory of Veterinary Anatomy, College of Veterinary Medicine, China Agricultural University, Beijing 100193, China Department of Animal Husbandry and Veterinary, Beijing Vocational College of Agriculture, Beijing 102442, China
a r t i c l e
i n f o
Article history: Received 20 January 2016 Received in revised form 22 April 2016 Accepted 2 May 2016 Available online 03 May 2016 Keywords: Monochromatic light Melatonin Melatonin antagonists T-lymphocyte Thymus Chicken
a b s t r a c t A total of 360 post-hatching day 0 (P0) Arbor Acre male broilers, including intact, sham operation and pinealectomy groups, were exposed to white light (WL), red light (RL), green light (GL) and blue light (BL) from a lightemitting diode (LED) system until for P14. We studied the effects of melatonin and its receptors on monochromatic light-induced T-lymphocyte proliferation in the thymus of broilers. The density of proliferating cell nuclear antigen (PCNA) cells and the proliferation of T-lymphocytes in response to Concanavalin A (ConA) in GL significantly increased both in vivo and in vitro (from 9.57% to 32.03% and from 34.30% to 50.53%, respectively) compared with other lights (p b 0.005) and was strongly correlated with melatonin levels in plasma (p b 0.005). Pinealectomy reduced the levels of circulatory melatonin and the proliferation of T-lymphocytes and eliminated the differences between GL and other lights (p b 0.005). However, exogenous melatonin (10−9 M) significantly increased the proliferative activity of T-lymphocyte by 9.64% (p = 0.002). In addition, GL significantly increased mRNA expression levels of Mel1a, Mel1b and Mel1c receptors from 21.09% to 32.57%, and protein expression levels from 24.43% to 42.92% compared with RL (p b 0.05). However, these effects were blocked after pinealectomy. Furthermore, 4P-PDOT (a selective Mel1b antagonist) and prazosin (a selective Mel1c antagonist) attenuated GL-induced T-lymphocyte proliferation in response to ConA (p = 0.000). Luzindole (a nonselective Mel1a/ Mel1b antagonist), however, did not induce these effects (p = 0.334). These results suggest that melatonin may mediate GL-induced T-lymphocyte proliferation via the Mel1b and Mel1c receptors but not via the Mel1a receptor. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Light, being one of the most important environmental stimuli, may affect the immune response. For example, Mann et al. [1] and Ahmad and Haldar [2] reported that rodents had higher splenocyte proliferation in response to Concanavalin A (ConA) and greater number of lymphocytes, total leukocyte counts and thymus weight in the Indian palm Funambulus pennanti squirrel under a short-day photoperiod compared to a long-day photoperiod. Moore and Siopes [3] found that short day and long day juvenile birds had a higher cellular and humoral immune response compared with constant light juvenile birds. However, these studies on the effects of light on the immune response primarily focused on the effects of the photoperiod. Our recent previous studies indicated that combination monochromatic light could effectively enhance the spleen T-lymphocyte proliferation of broilers compared to single monochromatic lights [4]. These results suggested that light color can influence the immune response. However, little is known regarding the mechanisms underlying the effect of light color on the immune ⁎ Corresponding author at: Laboratory of Veterinary Anatomy, College of Veterinary Medicine, China Agricultural University, Haidian, Beijing 100193, China. E-mail address: [email protected] (Y. Chen).
http://dx.doi.org/10.1016/j.jphotobiol.2016.05.001 1011-1344/© 2016 Elsevier B.V. All rights reserved.
response. Increasing evidence suggests that alteration in specific immune parameters is correlated with the melatonin levels in plasma [5, 6], the release of which is mediated by the photoperiod [7,8]. Conversely, melatonin, as an endogenous mediator of environmental light information, is secreted primarily from the pineal gland and is involved in the regulation of the immune response [9,10]. Increasing evidence suggests that melatonin exerts its immunomodulation through specific G-protein coupled high-affinity membrane receptors (Mel1a/ Mel1b) [6,11] that are expressed on lymphoid cells and in the immune system (e.g., thymus) of several animal species [12,13]. In vitro melatonin enhanced lymphocyte proliferation through its receptors [14]. Our previous studies have shown that melatonin enhanced light-induced bursal B-lymphocyte proliferation in broilers via Mel1a and Mel1c receptors but not via the Mel1b receptor [15]. However, Drazen [16] reported that the Mel1b receptor but not the Mel1a receptor may be involved in the melatonin-induced splenocyte proliferation in mice, suggesting that lymphocytes that are derived from different sources (e.g., bursal B-lymphocyte vs. spleen T-lymphocyte) might respond differently to photoperiod and or melatonin [17]. Furthermore, previous studies also indicated that there is a tissue-specific pattern in the expression of melatonin receptor subtypes in lymphoid organs [18,19]. Interestingly, it is unknown whether the melatonin-mediated light-
10
F. Chen et al. / Journal of Photochemistry & Photobiology, B: Biology 161 (2016) 9–16
induced T-lymphocyte proliferation in the thymus follows the same pattern. Thus, the present study investigated whether melatonin mediates the monochromatic light-induced T-lymphocyte proliferation in the thymus of broilers and also identified the specific receptor subtypes that could be directly involved in these effects. 2. Materials and Methods
The plasma levels of melatonin were estimated using a commercial ELISA kit for chicken melatonin (Cloud-Clone Corp., Houston, USA) according to the manufacturer's protocol. The intra- and inter-assay variation for melatonin was 3.3% and 8.9%, respectively. The sensitivity for melatonin was 4.52 pg/mL. Each sample was measured in triplicate. The concentration of melatonin was expressed as pg/mL plasma. 2.4. Immunohistochemical Study
2.1. Animals and Treatments All animal procedures received the approval of the Animal Welfare Committee of the Agricultural Research Organization, China Agricultural University in Beijing. A total of 360 post-hatching day 0 (P0) Arbor Acre male broilers (Beijing Huadu Breeding Co., Beijing, China) were randomly housed in three separate rooms (120 birds/room). Each room contained four light cells (30 birds/cell), white light (WL, 400 to 760 nm), red light (RL, 660 nm), green light (GL, 560 nm) and blue light (BL, 480 nm), which were illuminated with a light-emitting diode (Hongli Tronic Co., Guangzhou, China) system until for P14. All of the light sources were equalized to an illuminance of 15 ± 0.3 lx at the bird-head level with a light period of 23 h daily (23 L:1 D, light off at 2300 h). Each cell contained three pens (10 birds/pen) and included the pinealectomy group, the sham-operated group and the intact group at a density of 11.5 birds/m2. The ambient temperature was maintained at approximately 32 °C for the first week and later reduced to 25 °C in the second week, and the relative humidity was maintained at 60% for the entire period. The broilers had ad libitum access to feed and water. The diet was formulated to meet or exceed the nutrient recommendations of the National Research Council for poultry [20]. Pinealectomy and sham operations were performed on each lighttreatment group at P3. Before each surgery, the birds were deeply anesthetized with intraperitoneal injections of Nembutal (30 to 40 μg/g). The operation procedures were carried as described by Karaganis et al. [21]. 2.2. Plasma and Tissue Preparations Three broilers from each pen per room in each of the intact, shamoperated and pinealectomy groups were selected at 800 h on P14. Blood samples were collected via a cardiac puncture for ELISA. Next, at 2200 h on P14, broilers were killed by exsanguination under anesthesia with Nembutal (30 to 40 μg/g), and the thymus was aseptically removed and divided into two parts; one part of the thymus was fixed in 4% paraformaldehyde in 0.1 M PBS (pH 7.4, 4 °C) for immunohistochemistry, and the other part was used to determine the expressions of mRNA and protein levels using RT-PCR and western blotting. In addition, the other three broilers from each pen per cell were used for a lymphocyte proliferation assay. 2.3. Melatonin Assays Plasma samples were collected and separated by centrifugation at 100 ×g for 30 min and stored at −80 °C for melatonin assays.
Paraffin sections of thymus (5 μm) were prepared and stained for proliferating cell nuclear antigen (PCNA). Briefly, sections were incubated with primary antibody (dilution 1:2000, Sigma, St. Louis, MO, USA) overnight at 4 °C, then washed in 0.01 M PBS (pH 7.4), and incubated with biotinylated donkey anti-mouse IgG secondary antibody (dilution 1:300, CoWin Biotech Co., Inc., Beijing, China) for 2 h at room temperature. After three washes for 5 min in PBS, samples were incubated with streptavidin-horseradish peroxidase (1:300, Vector Laboratories, Burlingame, CA, USA) for 2 h at room temperature in the dark. Next, the sections were incubated with 0.05% 3′,3-diaminobenzidine tetrahydrochloride (DAB, Sigma) in 0.05 M Tris-HCl (pH 7.4) and 0.003% hydrogen peroxide for 10 min in the dark. Finally, the sections were counterstained with hematoxylin, dehydrated and cover slipped. Brown-stained cells indicated a positive reaction to PCNA, slides that were treated similarly but without primary antibody treatment served as a negative control. The PCNA-positive cells per mm2 in the cortical and medulla zone of the thymus were counted in 5 random fields from 5 cross-sections of the 3 broilers from each pen. 2.5. Lymphocyte Proliferative Activity Assay Lymphocyte proliferative activity in response to Concanavalin A (ConA) was determined using a 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyl tetrazolium (MTT, Sigma) assay. At P14, the thymus of broilers was removed under sterile condition and a single-cell suspension was prepared with RPMI 1640 medium (Gibco BRL, Grand Island, NY, USA), and cell counts were adjusted to 107 cells/mL following a viability evaluation (number of viable cells exceeding 95%) using the trypan blue exclusion method. The cell suspension (106 cells/well) was added to 96well flat Bottom plates (Costar 3599; Corning Inc., Corning, NY, USA). Next, either ConA (25 μg/mL, Sigma) or melatonin (10−10 M–10−3 M, Sigma) was added, and the cells were incubated at 41 °C with 5% CO2. After 44 h, 10 μL of MTT (5 mg/mL in D-Hank's, pH 7.4) was added to each well and incubated for an additional 4 h, after which the cells were incubated with 100 μL of 10% SDS in 0.04 M HCl for 4 h. The optical density (OD) was determined with an automated ELISA reader (Model 680, Bio-Rad, St. Louis, MO, USA) at 570 nm. The proliferative activity of the T-lymphocyte was expressed as the stimulation index (SI) as follows: SI = OD570 (stimulated cells)/OD570 (unstimulated cells). Furthermore, cell suspensions of the GL intact group were prepared for preincubation with 10 μM of luzindole (a nonselective antagonist of both Mel1a and Mel1b; Santa Cruz Biotechnology Inc., Dallas, TX, USA), 0.1 μM of 4-phenyl-2-propionamidotetralin (4-P-PDOT; a selective antagonist of Mel1b; Tocris Bioscience, Bristol, UK) and 0.1 μM of prazosin (a selective antagonist of Mel1c; Santa Cruz) for 30 min prior to the
Table 1 Primer sequences for RT-PCR assays. Gene
Accession number
Primer sequence (5′-3′)
Product size (bp)
Accession no.
Mel1a
NM_205362.1
333
MTNR1A
Mel1b
XM_417201.2
259
MTNR1B
Mel1c
NM_205361.1
237
LOC396318
GAPDH
NM_204305
F: CAATGGATGGAATCTGGG A R: GCTATGGGAAGTATGAAGTGG F: TTTGCTGGGCAC CTC TAA AC F: TTTGCTGGGCAC CTC TAA AC F: TTTGCTGGGCAC CTC TAA AC F: TTTGCTGGGCAC CTC TAA AC F: ATCACAGCCACA CAG AAGACG F: ATCACAGCCACA CAG AAGACG
124
GAPDH
F. Chen et al. / Journal of Photochemistry & Photobiology, B: Biology 161 (2016) 9–16
11
Fig. 1. Effect of monochromatic lights on the expression of PCNA in the cortex (A–H) and medulla (I–P) of broiler thymus in intact (A–D and I–L) and pinealectomy groups (E–H and M–P) at P14. WL (white light): A, E, I and M; RL (red light): B, F, J and N; GL (green light): C, G, K and O; and BL (blue light): D, H, L and P. Arrows indicated the immunoreactive cells. Bar = 25 μm. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
addition of ConA (25 μg/mL, Sigma) and melatonin (10−9 M, Sigma). The suspensions were incubated at 41 °C with 5% CO2 for 44 h, and the OD value was later determined. The control cells were incubated with RPMI 1640 medium, luzindole, 4P-PDOT, prazosin, and 0.01% ethanol or 0.01% dimethylsulfoxide.
2.6. RT-PCR Total RNA was extracted from thymus, and cDNA synthesis was performed using a reverse transcription kit (Thermo Fisher Scientific, Boston, USA). For the reverse transcription reaction, 2 μg of RNA was used in a 20-μL reaction mixture containing 1 μL of random hexamer primer and 0.5 μL of RNasin ribonuclease and incubated at 65 °C for 5 min. A total of 1 μL of reverse transcriptase was added, and the tube was later incubated at 42 °C for 60 min. The reaction was terminated by heating at 70 °C for 5 min. PCR amplification was carried out as follows: an initial denaturation step at 95 °C for 5 min followed by 30–32 cycles at 95 °C for 30 s; 57 °C for 30 s and 72 °C for 30 s and a final extension step at 72 °C for 5 min. The PCR products were electrophoresed on a 1% agarose
gel, then the melatonin receptor 1a (Mel1a), Mel1b, Mel1c and corresponding glyceraldehydes-3-phosphate dehydrogenase (GAPDH) mRNA levels in the thymus were measured by professional image analysis software (Gel-pro analyzer 4.5, Media Cybernetics Inc., Bethesda, MD, USA) and shown as the maximum optical density (Max. OD). The results were expressed as the Max. OD of Mel1a, Mel1b and Mel1c vs. the Max. OD of corresponding GAPDH. The results were obtained from three separate experiments. The PCR primers are listed in Table 1.
2.7. Western Blot Analysis The thymus was extracted using RIPA lysis buffer and 80 μg of protein were separated using 10% SDS-PAGE and transferred to a PVDF membrane (Millipore, Billerica, MA USA). Next, the membranes were blocked with 5% skim milk for 2 h at room temperature. Subsequently, the membranes were incubated with monoclonal mouse anti-β-actin (1:4000, CoWin Biotech Co., Inc.) or polyclonal goat anti-Mel1a, Mel1b and Mel1c (1:200, sc-13,186, sc-13,177, and sc-18,574, respectively, Santa Cruz) for overnight at 4 °C, and then HRP-conjugated goat anti-
Table 2 Effect of monochromatic lights on the density of PCNA-positive cells (×102 cells/mm2) of broiler thymus in intact and pinealectomy groups at P14 (n = 9). Light treatments Parameter
Group WL
Cortex Medulla
Intact Pinealectomy Intact Pinealectomy
RL b
72.26 ± 1.16 52.48 ± 1.54⁎ 52.78 ± 1.39b 41.99 ± 1.49⁎
GL c
56.04 ± 0.42 51.03 ± 1.96⁎ 42.76 ± 1.46c 39.68 ± 1.21
BL a
79.91 ± 1.70 55.86 ± 2.46⁎ 68.87 ± 1.99a 44.97 ± 1.56⁎
64.79 ± 1.69bc 53.65 ± 1.49⁎ 46.81 ± 1.27c 39.45 ± 1.20⁎
Note: Values marked with the different letters represented significantly difference among four monochromatic lights in the intact and pinealectomy groups (p b 0.05). ⁎ p b 0.05 versus the intact group that underwent the same light treatment.
12
F. Chen et al. / Journal of Photochemistry & Photobiology, B: Biology 161 (2016) 9–16
mouse (1:4000, CoWin Biotech Co., Inc.) or donkey anti-goat (1:3000, CoWin Biotech Co., Inc.) for 2 h at room temperature. The bands obtained in the blots were scanned and analyzed using Gel-Pro Analyzer 4.5 software and expressed as the integral optical density (IOD) of the band. The date for the levels of the Mel1a, Mel1b, Mel1c protein was expressed as the IOD of the Mel1a, Mel1b, Mel1c bands vs. the IOD of the corresponding β-actin bands. The results were obtained from three separate experiments.
2.8. Statistical Analysis All data were expressed as means ± SEM. Significant differences were evaluated by two-way analysis of variance (ANOVA) followed by Duncan's multiple comparisons post-hoc test with SPSS 11.5 (SPSS Inc., Chicago, IL, USA). Analysis of correlation (Pearson) was performed between the plasma melatonin levels and the density of PCNA-positive cells and T-lymphocyte proliferation. The statistical difference between the intact and pinealectomy groups under the same light treatment was evaluated by independent sample t-test. Values of p b 0.05 were considered statistically significant.
3. Results 3.1. PCNA Expression in the Thymus The PCNA-positive cells were scattered in the thymic medulla (Fig. 1I–1P) and were more densely distributed throughout the cortex (Fig. 1A–1H). As shown in Table 2, the density of PCNA-positive cells in the thymic cortex was the highest (from 9.57% to 29.87%) in GL compared to other monochromatic lights (p = 0.000) followed by WL and BL. Moreover, the density of PCNA-positive cells in the thymic cortex in the sham-operated group showed no differences compared with the corresponding intact group (p = 0.269–0.970) (sham-operated group data not shown). Pinealectomy reduced the density of PCNA-positive cells in the thymic cortex, the density was significantly reduced (from 8.94% to 30.10%) compared to those of the intact group. However, no differences were observed among the various pinealectomy groups (p = 0.074–0.672), which may be the result of the pinealectomy blunting the differences in the density of PCNA-positive cells in the thymic cortex. Similar to the thymic cortex, the density of PCNA-positive cells in thymic medulla was the highest in GL intact group (from 23.36% to 37.91%) compared to the other monochromatic lights (p = 0.000) followed by WL and BL; however, there were no marked differences between RL and BL (p = 0.061). Pinealectomy reduced the density of PCNA-positive cells in the thymus. The density was significantly reduced by 20.44% in WL (p = 0.000), 34.70% in GL (p = 0.000) and 15.72% in BL (p = 0.000) compared with those of the intact group. In the pinealectomy group, the density of PCNA-positive cells was similar among WL-, RL-, GL-, and BL-treated groups (p = 0.144–0.997).
Fig. 2. Effect of monochromatic lights on thymus T-lymphocyte proliferation in response to ConA in the intact and pinealectomy groups at P14. a–c values for the intact or pinealectomy groups with no common letters are significantly different (p b 0.05). * Significant difference between the intact and pinealectomy groups under the same light treatment (p b 0.05). WL, white light; RL, red light; GL, green light; BL, blue light.
3.3. Melatonin Concentration in the Plasma As shown in Fig. 3, the broilers that were exposed to GL showed remarkably higher levels of circulatory melatonin compared to broilers reared under WL, RL and BL (p = 0.007–0.047). Compared to GL, the plasma melatonin concentration decreased by 23.83% in WL (p = 0.007), 23.62% in RL (p = 0.013) and 15.45% in BL (p = 0.047), however, no differences were observed among WL-, RL- and BL-treated groups (p = 0.352–1.000). Pinealectomy reduced the levels of circulatory melatonin. After pinealectomy, the plasma melatonin concentration was remarkably decreased by 37.75% in WL (p = 0.001), 44.87% in RL (p = 0.000), 50.16% in GL (p = 0.000) and 44.54% in BL (p = 0.002) compared with the intact group. However, no differences were observed among the pinealectomy groups (p = 0.491–1.000). In addition, the correlation analysis revealed a positive correlation between the plasma concentration of melatonin and the density of PCNA-positive cells (cortex: r = 8.390, p b 0.009; medulla: r = 0.815, p b 0.014) and T-lymphocyte proliferation (r = 0.784, p b 0.003).
3.4. Effect of Exogenous Melatonin on T-Lymphocyte Proliferation in Vitro The MTT assay was performed to determine the effect of 10−10 M to 10 M doses of melatonin on T-lymphocyte proliferation after 44 h of culture. Compared with the control cells, the proliferation of Tlymphocytes was increased by 9.64% (p = 0.002) when treated with melatonin (10−9 M) (Fig. 4). Although T-lymphocyte proliferative −3
3.2. T-Lymphocyte Proliferation in the Thymus in Vitro As shown in Fig. 2, T-lymphocyte proliferation in response to ConA was higher in GL intact group (from 34.30% to 50.53%) compared to the other monochromatic lights (p = 0.000–0.029) followed by WL and BL. However, there were no differences between WL and BL (p = 0.060). Pinealectomy inhibited the proliferation of T-lymphocytes. After pinealectomy, the proliferative activities were decreased by 11.84% in WL (p = 0.013), 2.42% in RL (p = 0.348), 15.61% in GL (p = 0.008) and 5.68% in BL (p = 0.053) compared with the intact group. However, there were no differences among the pinealectomy broilers exposed to various monochromatic lights (p = 0.113–0.740).
Fig. 3. Effect of monochromatic lights on melatonin plasma concentration in the intact and pinealectomy broilers reared with white light (WL), red light (RL), green light (GL) and blue light (BL) at P14. a–b values for the intact or pinealectomy groups with no common letters are significantly different (p b 0.05). * Significant difference between the intact and pinealectomy groups under the same light treatment (p b 0.05).
F. Chen et al. / Journal of Photochemistry & Photobiology, B: Biology 161 (2016) 9–16
13
3.5. mRNA Levels of Mel1a, Mel1b and Mel1c in the Thymus
Fig. 4. Effect of exogenous melatonin on T-lymphocyte proliferation in the thymus in response to ConA in the GL intact group. The lymphocytes were treated with 10−10 M to 10−3 M doses of melatonin after 44 h of culture. Data are means ± SEM. * p b 0.05 versus the control cells.
activity had a slight dose-dependent decrease across a range of concentrations (10−8 M to 10−3 M), melatonin (10− 8 M to 10− 5 M) augmented the T-lymphocyte proliferation from 5.88% to 9.35% compared with the control cells (p = 0.004–0.047), and melatonin (10−4 M to 10−3 M) did not further increase lymphocyte proliferation (p = 0.290–0.602).
As shown in Fig. 5, mRNA transcripts of the three melatonin receptor subtypes (Mel1a, Mel1b and Mel1c) were amplified in the thymus of broiler at P14, and relative levels of Mel1c were increased from 21.09% to 29.96% in the GL intact group compared with the other groups treated with monochromatic lights (p = 0.000–0.003). Similar to Mel1c, Mel1a mRNA levels were 23.19% higher in GL than in RL (p = 0.023) and were 25.70% higher in BL (p = 0.027), while Mel1b mRNA levels in GL were increased by 28.21% compared with WL (p = 0.027), and increased by 32.57% compared with RL (p = 0.005). After pinealectomy, mRNA levels of Mel1a, Mel1b and Mel1c were significantly reduced from 35.32% to 46.74% in Mel1a (p = 0.005– 0.032), from 33.88% to 50.36% in Mel1b (p = 0.013–0.150) and from 36.30% to 47.22% in Mel1c (p = 0.000–0.039), respectively. However, no differences were found among the pinealectomy broilers treated with various monochromatic lights (Mel1a, p = 0.914–0.997; Mel1b, p = 0.515–0.684; Mel1c, p = 0.502–0.993). 3.6. Protein Expression of Mel1a, Mel1b and Mel1c in the Thymus As shown in Fig. 6, the western blot analysis showed bands of approximately 39-kDa (Mel1a), 36-kDa (Mel1b) and 25-kDa (Mel1c) in the thymus of broilers at P14. Similar to the mRNA expression, GL in the intact group significantly upregulated Mel1c protein levels by
Fig. 5. Effect of monochromatic lights on mRNA levels of Mel1a, Mel1b and Mel1c in broiler thymus of intact and pinealectomy groups. a–b values for the intact or pinealectomy groups with no common letters are significantly different (p b 0.05). * Significant difference between the intact and pinealectomy groups under the same light treatment (p b 0.05). Mel1a, melatonin receptor subtype 1a; Mel1b, melatonin receptor subtype 1b; Mel1c, melatonin receptor subtype 1c; GAPDH, glyceraldehydes phosphate dehydrogenase. WL, white light; RL, red light; GL, green light; BL, blue light.
14
F. Chen et al. / Journal of Photochemistry & Photobiology, B: Biology 161 (2016) 9–16
47.80% (p = 0.001), 24.43% (p = 0.001) and 52.52% (p = 0.032) compared to that of WL, RL and BL (p = 0.003), respectively. Similar results were found for Mel1a and Mel1b receptors, although no differences were found between GL and WL (p = 0.836) for Mel1a, or between GL and BL for Mel1b (p = 0.153). Pinealectomy downregulated the protein levels of Mel1a, Mel1b and Mel1c (Mel1a, p = 0.004–0.019; Mel1b, p = 0.002–0.036; Mel1c, p = 0.000–0.038). However, there were no differences among the pinealectomy broilers exposed to various monochromatic lights (Mel1a, p = 0.180–0.957; Mel1b, p = 0.304–0.784; Mel1c, p = 0.274–0.998). 3.7. T-Lymphocytes Treated with Specific Melatonin Receptor Antagonists in Vitro The T-lymphocytes of the intact group exposed to GL were treated with specific melatonin receptor antagonists to assess whether the proliferation effect of melatonin on T-lymphocytes is directly mediated by the melatonin receptors and to determine which subtype mediated the proliferation response. As shown in Fig. 7, treatment with melatonin (10−9 M) or ConA (25 μg/mL) alone effectively increased T-lymphocyte proliferation when compared with the control cells (p = 0.000–0.015). Furthermore, the combination of ConA and melatonin significantly increased T-lymphocyte proliferation compared with ConA or melatonin alone (from 5.29% to 8.85%, p = 0.000–0.009). To investigate which subtype receptor mediated the proliferation response, cells were treated with 4P-PDOT (0.1 μM) or prazosin (0.1 μM) alone, as well as in combination with ConA and melatonin. The combination remarkably attenuated T-lymphocyte proliferation compared to the ConA and melatonin co-treated group (4P-PDOT: by 24.59%, p = 0.001; prazosin: by 41.35%, p = 0.000). Luzindole (10 μM), however, which was coincubated with ConA and melatonin, showed no statistical significance when compared with the ConA and melatonin co-treated group (p =
0.334), and there were no differences among the groups treated with luzindole, 4P-PDOT, prazosin, 0.01% ethanol or 0.01% dimethylsulfoxide alone compared to the control cells (p = 0.359–0.997). 4. Discussion 4.1. GL Enhanced T-Lymphocyte Proliferation in the Thymus Our previous studies showed that GL enhanced T-lymphocyte proliferation of the spleen [22] and B-lymphocyte proliferation of the bursal [23]. In the present study, we found that in broilers, GL better enhanced thymus T-lymphocyte proliferation compared to other light treatments. These results further confirmed our previous findings [22,23]. However, the results were discordant with those of Scott and Siopes [24] who reported that RL enhanced the cellular immune response compared to GL and BL after 15 weeks of exposure. This difference was probably due to the differences in the species, age of animal and light sources (e.g., 15 weeks turkey vs. 2 weeks broiler and fluorescent lamp vs. LED lamp) between the two studies. 4.2. The Effect of Melatonin on Light-Mediated T-Lymphocyte Proliferation in Response to ConA in the Thymus Li et al. [23] reported that GL promoted melatonin secretion and, in turn, enhanced B-lymphocyte proliferation. Our results found that GL increased the levels of circulatory melatonin; this effect was correlated with changes in T-lymphocyte proliferation in the thymus. Pinealectomy abolished the effect of GL on the melatonin secretion and reduced the levels of circulatory melatonin and the proliferative activity of Tlymphocytes. However, administration of exogenous melatonin (10− 9 M to 10− 5 M) enhanced T-lymphocyte proliferation dosedependently (Fig. 4). These findings suggested that melatonin mediated
Fig. 6. Effect of monochromatic lights on protein levels of Mel1a, Mel1b and Mel1c in the broiler thymus of intact and pinealectomy groups. a–c values for the intact or pinealectomy groups with no common letters are significantly different (p b 0.05). * Significant difference between the intact and pinealectomy groups under the same light treatment (p b 0.05). Mel1a, melatonin receptor subtype 1a; Mel1b, melatonin receptor subtype 1b; Mel1c, melatonin receptor subtype 1c. WL, white light; RL, red light; GL, green light; BL, blue light.
F. Chen et al. / Journal of Photochemistry & Photobiology, B: Biology 161 (2016) 9–16
15
Fig. 7. Effect of specific melatonin receptor antagonist luzindole, 4P-PDOT and prazosin on GL-induced T-lymphocyte proliferation in response to ConA in the GL intact group. The lymphocyte was treated with DMSO (dimethylsulfoxide), ethanol, ConA (25 μg/mL), Mel (melatonin, 10−9 M), luzindole (a nonselective antagonist both Mel1a and Mel1b, 10 μM), 4P-PDOT (4-phenyl-2-propionamidotetralin, a selective antagonist of Mel1b, 0.1 μM) and prazosin (a selective antagonist of Mel1c, 0.1 μM) alone, or luzindole, 4P-PDOT and prazosin in combination with Mel. a–d values with no common letters are significantly different (p b 0.05).
the GL-induced T-lymphocyte proliferation in the thymus of broiler chickens. Our results are in agreement with those of Haldar and Ahmad [2], who suggested that short days enhance melatonin secretion, which subsequently increase ConA-induced splenocyte proliferation in the Indian palm squirrel. In addition, the present results found that 10−9 M to 10−5 M melatonin enhanced T-lymphocyte proliferation. These observations are consistent with the results that melatonin (10−12 M to 10− 6 M) enhanced human peripheral blood mononuclear cell proliferation [25]. However, these results contradict the observation that melatonin (10−9 M to 10−2 M) inhibited Chinese hamster ovarian cell proliferation [26]. This difference may be due to the differences in the cell type and cell sensitivity to melatonin [27]. 4.3. The Melatonin Receptor Subtypes Mediate T-Lymphocyte Proliferation in Response to ConA in the Thymus Melatonin exhibits its immunomodulatory effect via specific receptors. In rodents, two subtypes of the G-protein coupled melatonin receptor subtypes, Mel1a (MT1) and Mel1b (MT2), have been identified within the thymus of several animal species [28,29]. However, Mel1c is only found in fish, chicken, and frog [30]. The present study demonstrated that three melatonin receptor subtypes (Mel1a, Mel1b and Mel1c) were expressed in the thymus of broilers. Similar findings were also reported in the Funambulus pennanti thymus, although these studies did not detect Mel1c [2,18]. Moreover, GL upregulated both mRNA and protein levels of Mel1a, Mel1b and Mel1c, while pinealectomy downregulated this expression. The plasma levels of melatonin and the proliferation of T-lymphocytes show the highest values under GL and decrease after pinealectomy, which suggests that melatonin enhanced T-lymphocyte proliferation may through melatonin receptor subtypes. This finding is supported by studies showing photoperiodic regulation of the expression of the Mel1a and Mel1b melatonin receptor is associated with the regulation of melatonin levels in the Funambulus pennant thymus [18]. However, the receptors that are involved in mediating the GL-induced T-lymphocyte proliferation remain unknown. Thus, in the present study, luzindole, 4P-PDOT and prazosin were used to investigate the melatonin-induced T-
lymphocyte proliferation. Based on a previously published study [15] and our preliminary investigation, 10 μM of luzindole, 0.1 μM of 4PPDOT and 0.1 μM of prazosin were applied. We observed that 4PPDOT and prazosin attenuated the GL-induced T-lymphocyte proliferation in response to ConA. The addition of luzindole, however, had no effect on T-lymphocyte proliferation. The present study suggested that Mel1b and Mel1c receptors could be, at least partly, involved in the GL-induced T-lymphocyte proliferation in response to ConA. However, the Mel1a receptor subtype may not be required for this effect. These results corroborated previous studies in mice that showed that MT2 but not MT1 may be involved in the enhancement of splenocyte proliferation, although that study did not detect Mel1c expression [16]. However, this finding is in contrast to the results of Markowska et al. [31], who found that Mel1b is involved in the decrease in PHA-stimulated chicken splenocyte proliferation. The authors explain that melatonin enhanced PHA-stimulated proliferation when the concentration of mitogen was suboptimal [32]. At present, the mechanism through which monochromatic light acts to enhance lymphocytes is still unclear. However, studies have shown that melatonin enhances lymphocyte proliferation by activating an intracellular signaling pathway. Yadav et al. [33] reported that melatonin regulates splenocyte proliferation via Mel1b-induced IP3-Ca2+ signaling in a seasonally breeding bird. In addition, Li et al. [15] suggested that melatonin regulates GL-induced bursal B-lymphocyte proliferation through the Mel1c and Mel1a receptor by activating the cAMP/PKA pathway. The precise signaling pathway through which melatonin, via the Mel1b and Mel1c receptor, regulates GL-induced T-lymphocyte proliferation in the thymus needs to be studied further. 5. Conclusions The present data showed that in response to ConA, GL enhanced Tlymphocyte proliferation in the thymus, which is under the control of circulating melatonin levels. The changes in the mRNA and protein levels in response to circulating melatonin levels indicate that melatonin enhances GL-induced T-lymphocyte proliferation through melatonin specific receptors. Furthermore, Mel1b and Mel1c receptors could be, at least partly, involved in the GL-induced T-lymphocyte
16
F. Chen et al. / Journal of Photochemistry & Photobiology, B: Biology 161 (2016) 9–16
proliferation in response to ConA, and Mel1a receptor subtype may not be required for this effect. Acknowledgments This work received the support of the National High Technology Research and Development Program of China (2013AA102306), the National Natural Science Foundation of China (31172277, 31272516 and 31472157), and the Chinese Specialized Research Fund for the Doctoral Program of Higher Education (20130008110031). References [1] D.R. Mann, M.A. Akinbami, K.G. Gould, A.A. Ansari, Seasonal variations in cytokine expression and cell-mediated immunity in male rhesus monkeys, Cell. Immunol. 200 (2000) 105–115. [2] R. Ahmad, C. Haldar, Photoperiod-testicular-immune interaction in a seasonal breeder Indian palm squirrel Funambulus pennanti during the reproductively inactive and active phases, J. Neuroendocrinol. 21 (2009) 2–9. [3] C.B. Moore, T.D. Siopes, Effects of lighting conditions and melatonin supplementation on the cellular and humoral immune responses in Japanese quail Coturnix coturnix japonica, Gen. Comp. Endocrinol. 119 (2000) 95–104. [4] Z. Zhang, J. Cao, Z. Wang, Y. Dong, Y. Chen, Effect of a combination of green and blue monochromatic light on broiler immune response, J. Photochem. Photobiol. B 138 (2014) 118–123. [5] D.K. Vishwas, C. Haldar, Photoperiodic induced melatonin regulates immunity and expression pattern of melatonin receptor MT1 in spleen and bone marrow mononuclear cells of male golden hamster, J. Photochem. Photobiol. B 128 (2013) 107–114. [6] S.K. Yadav, C. Haldar, Reciprocal interaction between melatonin receptors (Mel (1a), Mel (1b), and Mel (1c)) and androgen receptor (AR) expression in immunoregulation of a seasonally breeding bird, Perdicula asiatica: role of photoperiod, J. Photochem. Photobiol. B 122 (2013) 52–60. [7] C. Venegas, J.A. García, C. Doerrier, H. Volt, G. Escames, L.C. López, R.J. Reiter, D. Acuña-Castroviejo, Analysis of the daily changes of melatonin receptors in the rat liver, J. Pineal Res. 54 (2013) 313–321. [8] E. Jin, L. Jia, J. Li, G. Yang, Z. Wang, J. Cao, Y. Chen, Effect of monochromatic light on melatonin secretion and arylalkylamine N-acetyltransferase mRNA expression in the retina and pineal gland of broilers, Anat. Rec. 294 (2011) 1233–1241. [9] A. Carrillo-Vico, J.M. Guerrero, P.J. Lardone, R.J. Reiter, A review of the multiple action of melatonin on the immune system, Endocrine 27 (2005) 189–200. [10] R.M. Slominski, R.J. Reiter, N. Schlabritz-Loutsevitch, R.S. Ostrom, A.T. Slominski, Melatonin membrane receptors in peripheral tissues: distribution and functions, Mol. Cell. Endocrinol. 351 (2012) 152–166. [11] C. Haldar, R. Ahmad, Photoimmunomodulation and melatonin, J. Photochem. Photobiol. B 98 (2010) 107–117. [12] A. Carrillo-Vico, A. García-Pergañeda, L. Naji, J.R. Calvo, M.P. Romero, J.M. Guerrero, Expression of membrane and nuclear melatonin receptor mRNA and protein in the mouse immune system, Cell. Mol. Life Sci. 60 (2003) 2272–2278. [13] D.K. Vishwas, C. Haldar, MT1 receptor expression and AA-NAT activity in lymphatic tissue following melatonin administration in male golden hamster, Int. Immunopharmacol. 22 (2014) 258–265. [14] D.L. Drazen, D. Bilu, S.D. Bilbo, R.J. Nelson, Melatonin enhancement of splenocyte proliferation is attenuated by luzindole, a melatonin receptor antagonist, Am. J. Physiol. Regul. Integr. Comp. Physiol. 280 (2001) 1476–1482.
[15] J. Li, Z. Wang, J. Cao, Y. Dong, Y. Chen, Melatonin receptor subtypes Mel1a and Mel1c but not Mel1b are associated with monochromatic light-induced B-lymphocyte proliferation in broilers, Domest. Anim. Endocrinol. 45 (2013) 206–215. [16] D.L. Drazen, R.J. Nelson, Melatonin receptor subtype MT2 (Mel 1b) and not mt1 (Mel1a) is associated with melatonin-induced enhancement of cell-mediated and humoral immunity, Neuroendocrinology 74 (2001) 178–184. [17] B.J. Prendergast, S.M. Yellon, L.T. Tran, R.J. Nelson, Photoperiod modulates the inhibitory effect of in vitro melatonin on lymphocyte proliferation in female Siberian hamsters, J. Biol. Rhythm. 16 (2001) 224–233. [18] S. Gupta, C. Haldar, Nycthemeral variation in melatonin receptor expression in the lymphoid organs of a tropical seasonal breeder Funambulus pennant, J. Comp. Physiol. A Neuroethol. Sens. Neural Behav. Physiol. 200 (2014) 1045–1055. [19] Q. Guo, Y. Dong, J. Cao, Z. Wang, Z. Zhang, Y. Chen, Developmental changes of melatonin receptor expression in the spleen of the chicken, Gallus domesticus, Acta. Histochem. 117 (2015) 559–565. [20] D.H. Baker, Y. Han, Ideal amino acid profile for chicks during the first three weeks posthatching, Poult. Sci. 73 (1994) 1441–1447. [21] S.P. Karaganis, P.A. Bartell, V.R. Shende, A.F. Moore, V.M. Cassone, Modulation of metabolic and clock gene mRNA rhythms by pineal and retinal circadian oscillators, Gen. Comp. Endocrinol. 161 (2009) 179–192. [22] D. Xie, Z. Wang, J. Cao, Y. Dong, Y. Chen, Effects of monochromatic light on proliferation response of splenocyte in broilers, Anat. Histol. Embryol. 37 (2008) 332–337. [23] J. Li, J. Cao, Z. Wang, Y. Dong, Y. Chen, Melatonin plays a critical role in inducing B lymphocyte proliferation of the bursa of Fabricius in broilers via monochromatic lights, J. Photochem. Photobiol. B 142 (2015) 29–34. [24] R.P. Scott, T.D. Siopes, Light color: effect on blood cells, immune function and stress status in turkey hens, Comp. Biochem. Physiol. Comp. Physiol. 108 (1994) 161–168. [25] E. Kühlwein, M. Irwin, Melatonin modulation of lymphocyte proliferation and Th1/ Th2 cytokine expression, J. Neuroimmunol. 117 (2001) 51–57. [26] R.M. Sainz, J.C. Mayo, D.X. Tan, S. Lopez-Burillo, M. Natarajan, R.J. Reiter, Antioxidant activity of melatonin in Chinese hamster ovarian cells: changes in cellular proliferation and differentiation, Biochem. Biophys. Res. Commun. 302 (2003) 625–634. [27] K.M. Morrey, J.A. McLachlan, C.D. Serkin, O. Bakouche, Activation of human monocytes by the pineal hormone melatonin, J. Immunol. 153 (1994) 2671–2680. [28] S. Jimenez-Jorge, A.J. Jimenez-Caliani, J.M. Guerrero, M.C. Naranjo, P.J. Lardone, A. Carrillo-Vico, C. Osuna, P. Molinero, Melatonin synthesis and melatoninmembrane receptor (MT1) expression during rat thymus development: role of the pineal gland, J. Pineal Res. 39 (2005) 77–83. [29] M. Sánchez-Hidalgo, J.M. Guerrero Montávez, P. Carrascosa-Salmoral Mdel, C. Naranjo-Gutierrez Mdel, P.J. Lardone, C.A. de la Lastra Romero, Decreased MT1 and MT2 melatonin receptor expression in extrapineal tissues of the rat during physiological aging, J. Pineal Res. 46 (2009) 29–35. [30] S.M. Reppert, D.R. Weaver, V.M. Cassone, C. Godson, L.F. Kolakowski, Melatonin receptors are for the birds: molecular analysis of two receptor subtypes differentially expressed in chick brain, Neuron 15 (1995) 1003–1015. [31] M. Markowska, A. Mrozkowiak, J. Pawlak, K. Skwarło-Sońta, Intracellular second messengers involved in melatonin signal transduction in chicken splenocytes in vitro, J. Pineal Res. 37 (2004) 207–212. [32] C.A. Kliger, A.E. Gehad, R.M. Hulet, W.B. Roush, H.S. Lillehoj, M.M. Mashaly, Effects of photoperiod and melatonin on lymphocyte activities in male broiler chickens, Poult. Sci. 79 (2000) 18–25. [33] S. Kumar Yadav, C. Haldar, S. Kumar Singh, D. Dash, Melatonin regulates splenocytes proliferation via IP3-dependent intracellular Ca2+ release in seasonally breeding bird, Perdicula asiatica, J. Recept. Signal Transduct. Res. 34 (2014) 233–240.