Effects of dietary amino acid patterns on growth, feed utilization and hepatic IGF-I, TOR gene expression levels of hybrid grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂) juveniles

Aquaculture 468 (2017) 508–514

Contents lists available at ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aquaculture

Effects of dietary amino acid patterns on growth, feed utilization and hepatic IGF-I, TOR gene expression levels of hybrid grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂) juveniles Mingjuan Wu, Senda Lu, Xiaoyi Wu ⁎, Shuntian Jiang, Yuan Luo, Wei Yao, Zibo Jin State Key Laboratory of Marine Resource Utilization in South China Sea, Haikou 570228, China Department of Aquaculture, Ocean College of Hainan University, Haikou 570228, China

a r t i c l e

i n f o

Article history: Received 13 June 2016 Received in revised form 11 November 2016 Accepted 12 November 2016 Available online 13 November 2016 Keywords: Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂ Amino acid pattern Growth Feed utilization

a b s t r a c t A 7-week growth trial was conducted to evaluate effects of dietary amino acid patterns on growth, feed utilization and hepatic IGF-I, TOR genes expression levels of hybrid grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂) juveniles. Four isoenergetic (350 kcal per 100 g dry matter), isoproteic (53.5% of dry matter) and isolipidic (7% of dry matter) experimental diets were formulated with crystalline-amino acids (AAs) replacing approximately 42% fishmeal protein-bound nitrogen to keep dietary AA patterns in line with the overall AA patterns of whole-egg protein (WEPAA), whole-body protein (WBPAA), muscle protein (MCPAA) of hybrid grouper and fishmeal (anchovy) protein (FMPAA), respectively. Each experimental diet was fed to triplicate groups of 15 hybrid grouper juveniles (average initial weight of 10.8 g/fish) which were stocked into small floating cages (L 120 cm × W 70 cm × H 50 cm). Experimental cages were labeled and located in four connective 6-m3 indoor concrete tanks (L 3 m × W 2 m × H 1 m) with 3 cages occurring in each tank. Weight gain (WG) of fish fed the FMPAA diet was significantly (P b 0.05) higher than that of fish fed the WEPAA diet or the WBPAA diet but did not significantly differ (P ≥ 0.05) from that of fish fed the MCPAA diet. Values of daily feed intake (DFI) of fish fed the WEPAA diet or the WBPAA diet was significantly higher than that of fish fed the MCPAA diet or the FMPAA diet. Fish fed the FMPAA diet had significantly lower feed conversion ratios (FCRs), higher protein efficiency ratio (PER) and higher protein productive value (PPV) compared to fish fed other experimental diets. Whole-body protein content of fish fed the FMPAA diet was significantly higher than that of fish fed the WEPAA diet or the WBPAA diet. Muscle amino acid compositions were influenced by dietary amino acid pattern. Plasma total protein (TP) concentration of fish fed the FMPAA diet was significantly higher than that of fish fed the WEPAA diet or the WBPAA diet. The relative mRNA expression levels of insulin like growth factor-I (IGF-I) gene in liver of fish fed the FMPAA diet and the MCPAA diet were significantly higher than those of fish fed the WEPAA diet and the WBPAA diet. Fish fed the FMPAA diet showed significantly higher hepatic target of rapamycin (TOR) gene expression level than fish fed other experimental diets. Results of this study indicated that the amino acid pattern of fishmeal (anchovy) protein was more suitable as a reference amino acid pattern in diets of juvenile hybrid grouper compared to the amino acid pattern of whole-egg protein, whole-body protein or muscle protein of this fish species. © 2016 Elsevier B.V. All rights reserved.

1. Introduction Protein is an important and expensive ingredient in most fish feed (Fan et al., 2013; Bai et al., 2015), and it plays a key role in maintaining fish optimal growth and reproduction (Martínez-Palacios et al., 2007; Deng et al., 2011). The live weight (biomass) gain in fish is mainly dependent on protein deposition which is determined by the balance between protein synthesis and degradation (Dumas et al., 2007; Tu et al., ⁎ Corresponding author at: State Key Laboratory of Marine Resource Utilization in South China Sea, Haikou 570228, China. E-mail address: [email protected] (X. Wu).

http://dx.doi.org/10.1016/j.aquaculture.2016.11.019 0044-8486/© 2016 Elsevier B.V. All rights reserved.

2015), and in growing animals, protein synthesis exceeds degradation (Millward, 1998). Proteins also have numerous structural and metabolic functions, and thus protein is an essential component for every type of cell in the body, including muscles, bones, organs, tendons, and ligaments (NRC, 2011). All dietary proteins are not identical in their nutritive value, which is a function of their digestibility and amino acid profile (NRC, 2011), and the quality of dietary protein is usually assessed by amino acid (AA) compositions, protein digestibility and protein utilization efficiency (Bodin et al., 2012). An “ideal protein” has been defined as the amino acid profile that meets exactly the requirement of the animal with no excess or deficit (Wang and Fuller, 1989; Emmert and Baker, 1997), and so defining the ideal dietary

M. Wu et al. / Aquaculture 468 (2017) 508–514

amino acid profile has been the focus of a significant number of studies. In some studies, researchers based the ideal amino acid profile on EAA profile of the whole body or egg of the species of interest (Wilson and Cowey, 1985), and in other studies, amino acid patterns of whole-egg protein (Halver et al., 1959; Ketola, 1982), whole-body protein (Kim and Lall, 2000) and muscle protein (Goff and Gatlin, 2004; Whiteman and Gatlin, 2005; Zhou et al., 2012) of fish of interest as well as that of fishmeal protein (Berg et al., 1997) were used as reference for the formulation of feeds in the absence of information on amino acid requirements. Up to now, although the requirements of all essential AAs are known for a number of fish species (NRC, 2011), for some grouper species such as hybrid grouper, giant grouper and so on, the data are much more absent. Amino acids are not only the important substrates for the synthesis of proteins and other nitrogenous compounds, but also involved in the regulation of major metabolic pathways (NRC, 2011), and hence they are considered as signaling molecules (Jobgen et al., 2006). Amino acids can directly affect regulation of protein synthesis for which they are the substrate, and they can also mediate transcription and translation of protein synthesis by activating TOR nutrient signaling pathway in common with GH/IGF system (Fafournoux et al., 2000; Van Sluijters et al., 2000; Kimball and Jefferson, 2006; Avruch et al., 2009; Fuentes et al., 2013). Hepatic gene expression of IGF-I in salmonids has been observed to respond to nutritional status (Chauvigné et al., 2003; Hevrøy et al., 2011) and stimulate in vitro nutrients uptake and protein synthesis of rainbow trout and gilthead sea bream (Castillo et al., 2004; Codina et al., 2008; Montserrat et al., 2012). Results from previous studies (Ghigo et al., 2001; Dawson-Hughes et al., 2007; Stanley, 2012) indicated that different groups of amino acids had effects on IGF-I. Hybrid grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂) is a marine carnivorous fish which has been widely cultured in China due to its delicious taste and important commercial value. Up to now, limited nutrition information on juvenile hybrid grouper (Jiang et al., 2015; Rahimnejad et al., 2015; Luo et al., 2016; Jiang et al., 2016) were available, and the reference dietary AA pattern of hybrid grouper juveniles has not been reported yet. Therefore, the present study aimed to compare effects of dietary amino acid patterns of whole-egg protein, whole-body protein, muscle protein of hybrid grouper and fishmeal (anchovy) protein on growth, feed utilization and expressing of hepatic IGF-I, TOR genes of hybrid grouper.

509

Table 1 Formulations and analyzed composition of experimental diets (dry-matter basis).f Dietary amino acid patterns WEPAA

WBPAA

MCPAA

FMPAA

Peruvian fishmeal (anchovy)a Mixed amino acidb Chile fish oil (salmon)c Corn starch Vitamin mixtured Mineral mixturee Soybean lecithin Cellulose

45.45 22.47 2.91 18.25 1 0.5 1 8.43

45.45 22.47 2.91 18.25 1 0.5 1 8.43

45.45 22.47 2.91 18.25 1 0.5 1 8.43

45.45 22.47 2.91 18.25 1 0.5 1 8.43

Composition analysis Dry matter % Crude protein % Crude lipid % Ash %

90 52.8 7.0 9.03

93.4 53.8 7.1 8.95

92.2 51.3 7.2 9.43

92.5 53.5 7.1 8.78

a Yongsheng Feed Corporation, Binzhou, China; super prime grade; proximate composition (% dry matter): moisture, 7.43; crude protein, 68.28; crude lipid, 6.8. b Lanji Tech Co. Ltd, Shanghai, China. c High Fortune (Fujian) Bio-Tech Co. Ltd, Fuzhou, China. d Vitamin mixture (mg/g mixture): thiamin hydrochloride, 2.5; riboflavin, 10; calcium pantothenate, 25; nicotinic acid, 37.5; pyridoxine hydrochloride, 2.5; folic acid, 0.75; inositol, 100; ascorbic acid, 50; choline chloride, 250; menadione, 2; alpha-tocopheryl acetate, 20; retinol acetate, 1; cholecalciferol, 0.0025; biotin, 0.25; vitamin B12, 0.05. All ingredients were diluted with alpha-cellulose to 1 g (from Lin and Shiau, 2003). e Mineral mixture (mg/g mixture): calcium lactate, 327; K2PO4, 239.8; CaHPO4·2H2O, 135.8; MgSO4·7H2O, 132; Na2HPO4·2H2O, 87.2; NaCl, 43.5; ferric citrate, 29.7; ZnSO4·7H2O, 3; CoCl2·6H2O, 1; MnSO4·H2O, 0.8; KI, 0.15; AlCl3·6H2O, 0.15; CuCl2, 0.1 (from Lin and Shiau, 2003). f Values represent means of duplicate samples.

ingredients. The diets were produced in a noodle-like shape of 3-mm in diameter using a twin-screw extruder (Institute of Chemical Engineering, South China University of Technology, Guangzhou, PR China) and then pelletized. All diets were air-dried at 25 °C for 24 h, sieved and then packaged and stored frozen (−20 °C).

Table 2 Analyzed amino acid profiles (% of total amino acids) of whole-egg protein, whole-body protein and muscle protein of hybrid grouper as well as anchovy fishmeal protein. WEPc

WBPd

MCPe

FMPf

EAA Lysine Arginine Methionine Threonine Isoleucine Leucine Phenylalanine Valine Histidine ∑EAA

8.10 5.74 2.69 4.77 5.81 9.64 3.95 5.89 2.45 49.03

7.45 6.50 2.64 4.46 3.96 7.35 3.83 4.28 1.78 42.25

9.20 6.05 3.00 4.73 4.88 8.89 4.16 4.46 2.03 47.39

8.45 6.61 2.97 4.60 4.86 8.66 3.98 5.04 2.43 47.58

NEAAb Aspartic acid Serine Glutamic acid Glycine Alanine Cystine Tyrosine Proline ∑NEAA ∑AA

6.37 5.31 14.48 3.50 8.41 1.41 4.87 6.61 50.97 100

9.01 3.96 17.07 9.79 7.39 1.02 2.81 6.70 57.75 100

10.25 3.97 18.71 5.23 5.99 1.03 3.30 4.14 52.61 100

9.70 4.12 17.22 6.00 6.46 1.29 3.27 4.37 52.42 100

2. Materials and methods a

2.1. Experimental diets Four experimental diets were formulated to be isoproteic (53.5% crude protein) and isolipidic (7% crude lipid) with crystalline-AA replacing approximately 42% fishmeal protein-bound nitrogen (Table 1). The 53.5% dietary protein level and the 7% dietary lipid level designed in this study was according to results of our previous studies (Jiang et al., 2015; Jiang et al., 2016). Since digestible energy coefficients for the ingredients used are not available for hybrid grouper, gross energy was calculated using physiological fuel values of 4.0, 4.0 and 9.0 kcal/g (16.7, 16.7 and 37.7 kJ/g) for carbohydrate, protein and lipid, respectively (Lee and Putnam, 1973; Garling and Wilson, 1977). All experimental diets had the same gross energy of 350 kcal per 100 g dry matter. The AA patterns of experimental diets were adjusted to the overall AA patterns (Table 2) of whole-egg protein (WEPAA), whole-body protein (WBPAA), muscle protein (MCPAA) of hybrid grouper and fishmeal (anchovy) protein (FMPAA) by supplementing crystalline-AA (Table 3). Amino acid compositions of experimental diets were shown in Table 4. Fishmeal was well ground, and all dry ingredients were carefully weighed and mixed in a Hobart mixer (A-200 T Mixer Bench Model unit, Resell Food Equipment Ltd., Ottawa, Canada) for 30 min, then added lipid gradually, and mixed all constantly. After that, 30–50 mL of water per 100 g of dry matter was slowly blended into the premixed

a b c d e f

EAA: essential amino acids. NEAA: nonessential amino acids. WEP: whole-egg protein of hybrid grouper. WBP: whole-body protein of hybrid grouper. MCP: muscle protein of hybrid grouper. FMP: fishmeal (anchovy) protein.

510

M. Wu et al. / Aquaculture 468 (2017) 508–514

Table 3 Amino acid contents (g/100 g dry matter) of dietary fishmeal protein and the supplementation (g/100 g dry matter) of CAA in different diets to simulate amino acid patterns of WEP, WBP, MCP and FMP. Amino acid

Dietary fishmeal protein CAA addedg WEPAAc WBPAAd MCPAAe FMPAAf

a

EAA Lysine Arginine Methionine Threonine Isoleucine Leucine Phenylalanine Valine Histidine ∑EAA

2.592 2.027 0.912 1.410 1.490 2.657 1.220 1.545 0.744 14.60

1.711 1.026 0.516 1.124 1.599 2.465 0.880 1.584 0.556 11.46

1.366 1.427 0.494 0.958 0.616 1.249 0.815 0.731 0.201 7.86

2.298 1.188 0.682 1.102 1.105 2.066 0.990 0.824 0.332 10.59

1.899 1.485 0.668 1.033 1.091 1.946 0.893 1.132 0.545 10.69

NEAAb Aspartic acid Serine Glutamic acid Glycine Alanine Cystine Tyrosine Proline ∑NEAA ∑AA

2.974 1.263 5.282 1.840 1.981 0.396 1.003 1.341 16.08 30.68

0.414 1.560 2.414 0.022 2.490 0.351 1.584 2.174 11.009 22.47

1.816 0.840 3.789 3.364 1.945 0.149 0.490 2.218 14.611 22.47

2.475 0.845 4.663 0.937 1.204 0.149 0.750 0.859 11.882 22.47

2.179 0.925 3.869 1.348 1.451 0.290 0.735 0.982 11.779 22.47

a

EAA: essential amino acids. NEAA: nonessential amino acids. c WEPAA: the AA pattern of whole-egg protein. d WBPAA: the AA pattern of whole-body protein. e MCPAA: the AA pattern of muscle protein. f FMPAA: the AA pattern of fishmeal (anchovy) protein. g CAA were added to simulate dietary amino acid patterns to those of WEP, WBP, MCP and FMP (Table 2). b

2.2. Experimental procedure Hybrid grouper juveniles were obtained from a commercial hatchery (Changjiang, Hainan, China). Prior to the trial, experimental fish were acclimated with a commercial diet for 15 days and then, groups of 15 fish (average initial weight of 10.80 g/fish) were randomly distributed into 12 small floating cages (L 120 cm × W 70 cm × H 50 cm)

Table 4 Amino acid profiles (%) of dietary proteins in the experiment.a AA/∑AA

WEPAA

WBPAA

MCPAA

FMPAA

EAA Lysine Arginine Methionine Threonine Isoleucine Leucine Phenylalanine Valine Histidine ∑EAA

7.80 5.89 2.76 4.74 5.78 10.16 3.53 5.37 2.32 48.35

7.08 6.49 2.51 4.51 3.94 7.63 3.40 4.20 1.85 41.61

8.87 6.17 3.05 4.76 4.93 8.92 4.08 4.48 2.03 47.29

8.24 6.60 2.95 4.62 4.85 8.75 3.95 4.95 2.38 47.29

NEAA Aspartic acid Serine Glutamic acid Glycine Alanine Cystine Tyrosine Proline ∑NEAA ∑AA

6.06 5.00 14.81 3.44 8.22 1.37 5.16 6.22 50.28 98.63

9.19 4.01 16.7 8.98 7.18 1.06 2.89 6.44 56.45 98.06

10.35 3.92 18.31 5.78 5.56 1.05 3.16 4.23 52.36 99.65

9.92 4.10 17.02 5.85 6.13 1.15 3.31 4.36 51.84 99.13

a

Values represent means of duplicate samples.

which were labeled and located in four connective 6-m3 indoor concrete tanks (L 3 m × W 2 m × H 1 m) with 3 cages occurring in each tank. All tanks received flowing sea water (salinity: 33.1 g/L) from the same reservoir at a rate of 3 L/min. During the rearing period, each dietary treatment had three replicates, and each replicate cage was in different ponds. Throughout the trial, dissolved oxygen content was measured in the tanks every other day with a portable meter (HATCH HQ30d, Hatch Lange GMBH; http://www.hach-lange.es) and values ranged at 5.9–6.3 mg/L. Ammonia (0–0.20 mg/L) was measured with a portable spectrophotometer (HATCH DR 2800, Hatch Lange GMBH; http://www.hach-lange.es). Water temperature was daily registered using maximum–minimum thermometers and maintained at 27–28 °C. Fish were exposed to a 12 h: 12 h light: dark cycle and fed each dietary treatment twice daily (08:00 h and 16:00 h) to apparent satiation. Feed intake was recorded daily. Fish in each cage were weighed weekly, and then experimental tanks and cages were cleaned. The growth trial was continued for 7 weeks.

2.3. Sampling and analysis At the beginning of this trial, 10 fish were sampled and stored at − 20 °C for analysis of initial whole-body proximate composition. At the end of the trial, two fish per cage were collected for whole-body composition analysis, and other three fish per cage were individually weighed and dissected to obtain liver, intestine and intraperitoneal fat (IPF) weights for computing body condition indices including hepatosomatic index (HSI) and IPF ratio, respectively. Samples for muscle compositional analysis were also obtained at this dissecting. Intraperitoneal fat was obtained by removing and weighing adipose tissue in the abdominal cavity as well as that adhering to the intestine of the fish. For the biochemical analysis of plasma, another three fish from each cage were separately bled from the caudal vasculature using 1-mL heparinized (H6279, SIGMA, St. Louis, MO) syringes. After centrifugation (3000 g, 15 min, 4 °C) (centrifuge 5417R; Eppendorf, Hamburg, Germany), plasma was separated and stored at − 80 °C until analysis. For genes expression assays of liver samples, another three individuals were randomly collected from each cage, and liver samples were immediately frozen in liquid nitrogen and then stored at −80 °C. Crude protein (N × 6.25) was determined by the Kjeldahl method after acid digestion using an auto Kjeldahl System (FOSS Tecator, Haganas, Sweden). Crude lipid was determined by ether extraction using a Soxtec System HT (Soxtec System HT6, Haineng SOX406, Shandong, China). Dry matter was determined by heating ~ 2 g samples at 125 °C for 3 h, and ash was quantified after heating ~ 2 g samples at 650 °C for 3 h according to Association of Official Analytical Chemists (AOAC, 1990). The amino acid levels of the diets and muscle were determined after acid hydrolysis using the L-8900 amino acid analyzer (Hitachi, Japan) (Unnikrishnan and Paulraj, 2010). Plasma total protein (TP), glucose (GLU), total triglyceride (TG) and cholesterol (CHOL) were determined using an automatic blood analyzer (Hitachi 7170A, Hitachi, Tokyo, Japan).

2.4. Total RNA extraction and reverse transcription Total RNA was extracted from grouper liver using Trizol Reagent (Invitrogen, America) followed by quality measurement on a 1.0% denaturing agarose gel and yield determination on NanoDrop® ND-1000 (Wilmington, DE). The RNA was treated with RNA-Free DNase (Takara, Japan) to remove DNA contaminant and reversely transcribed to cDNA by RevertAid First Stand cDNA Synthesis kit (Thermo Scientific, America) following the instructions provided by the manufacturer.

M. Wu et al. / Aquaculture 468 (2017) 508–514

2.5. Real-time quantitative PCR analysis of IGF-I and TOR Real-time RT-PCR was carried out in a quantitative thermal cycler (Mastercyclereprealplex, Eppendorf, Germany). The amplification was performed in a total volume of 20 μL containing 10 μL power SYBR® Green PCR Master Mix (Applied Biosystems, America), 1 μL of each primer (10 μmol/L), 6 μL nuclease-free water and 2 μL of cDNA mix. The real-time RT-PCR program was as follows: 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s, 60 °C for 60 s, and 68 °C for 20 s. The real-time RT-PCR primer pairs for IGF-I, TOR and β-actin were designed by Primer Premier 5.0 based on the published nucleotide sequences. At the end of each PCR reaction, melting curve analysis of amplification products was carried out to confirm that a single PCR product was present in these reactions. Standard curves were made with five different dilutions (in triplicate) of the cDNA samples and amplification efficiency was analyzed according to the following equation E = 10(−1/slope) − 1. The expression levels of the target genes were calculated followed the 2−△△t method described by Yao et al. (2009) and listed in (Table 5). 2.6. Statistic analysis All statistical computations were presented as means ± SEM (standard error of the mean) of three replications and analyzed using oneway analysis of variance (ANOVA). Differences among means were determined by Tukey's test. The difference was considered significant at P b 0.05. Analyses were performed using the SPSS 18.0 (SPSS Inc., Michigan Avenue, Chicago, IL, USA).

511

Table 6 Growth performance, feed utilization and morphometric parameters of juvenile hybrid grouper Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂ fed diets with different amino acid patterns for 7 weeks.1

2

IBW FBW3 WG %4 Daily FI5 FCR6 PER7 PPV8 Survival %

WEPAA

WBPAA

MCPAA

FMPAA

10.8 ± 0.0 48.8 ± 0.8c 352.8 ± 7.6b 2.35 ± 0.06b 1.15 ± 0.03b 1.65 ± 0.04c 29.4 ± 0.8c 100

10.8 ± 0.1 53.3 ± 0.5b 391.9 ± 5.6b 2.78 ± 0.08a 1.27 ± 0.04a 1.46 ± 0.05d 24.8 ± 0.5d 100

10.8 ± 0.1 59.3 ± 1.2a 448.1 ± 14.3a 2.06 ± 0.04c 0.98 ± 0.01c 1.99 ± 0.02b 34.4 ± 0.5b 97.8 ± 2.2

10.8 ± 0.0 63.4 ± 1.2a 484.8 ± 13.6a 1.72 ± 0.03d 0.82 ± 0.01d 2.28 ± 0.03a 39.4 ± 0.5a 100

3.33 ± 0.10 2.22 ± 0.15

3.41 ± 0.21 2.42 ± 0.05

3.12 ± 0.10 2.33 ± 0.10

Morphometric parameters HSI %9 3.37 ± 0.13 2.27 ± 0.14 IPF ratio %10

1 Values are means (±SEM) of three replicate cages, and values within the same row with different letters are significantly (P b 0.05) different. 2 IBW (g per fish): initial mean body weight. 3 FBW (g per fish): final mean body weight. 4 Weight gain: 100 × (final mean weight − initial mean weight) / initial mean weight. 5 Daily feed intake (g kg−1 ABW day−1): g feed intake / g weight gain (final body weight − initial body weight) / days. 6 Feed conversion ratio: g dry feed / g weight gain. 7 Protein efficiency ratio: g weight gain / g protein fed. 8 Protein productive value: g protein gain / g protein fed. 9 Hepatosomatic index: 100 × liver weight / fish weight. 10 Intraperitoneal fat ratio: 100 × intraperitoneal fat weight / fish weight.

3.2. Whole-body and muscle as well as plasma biochemical compositions 3. Results 3.1. Growth performance, feed utilization and morphometric parameters Results of growth performance, feed utilization and morphometric parameters for hybrid grouper juveniles fed different dietary AA patterns for 7 weeks were shown in Table 6, respectively. Weight gain (WG) of fish fed the FMPAA diet or the MCPAA diet were significantly higher than that of fish fed the WEPAA diet or the WBPAA diet (P b 0.05). There were no significant differences in WG values between fish fed the MCPAA diet and fish fed the FMPAA diet as well as between fish fed the WEPAA diet and fish fed the WBPAA diet (P ≥ 0.05). Daily feed intake (DFI) of fish fed the FMPAA diet was significantly lower than that of fish fed any of other experimental diets. Feed conversion ratio (FCR) of fish fed the FMPAA diet was significantly lower than that of fish fed other experimental diets. Fish fed the WBPAA diet had the highest FCR among all treatments. Fish fed the FMPAA diet has significantly higher protein efficiency ratio (PER) and protein productive values (PPV) than fish fed other experimental diets (P b 0.05). Fish fed the WBPAA diet had the lowest PER and PPV values among all experimental groups. Survival rates of fish showed no significant difference among all experimental treatments. Hepatosomatic index (HSI) and intraperitoneal fat ratio (IPF ratio) were not significantly different among all experimental groups. Table 5 Primers used for quantitative RT-PCR (qPCR). Used for

Gene name

Genbank accession no.

Primer sequence(5′-3′)

qPCR

TORa

JN850959.1

IGF-Id

AY776159.1

β-Actin

AY510710.2

F:TCTCCCTGTCCAGAGGCAATAAb R:CAGTCAGCGGGTAGATCAAAGCc F:TATTTCAGTAAACCAACAGGCTATG R:TGAATGACTATGTCCAGGTAAAGG F:CTCTGGGCAACGGAACCTCT R:GTGCGTGACATCAAGGAGAAGC

a b c d

TOR: Target of rapamycin. F: forward sequence. R: reverse sequence. IGF-I: insulin like growth factor-I.

Fish fed the FMPAA diet had significantly higher whole-body protein content than fish fed the WEPAA diet or the WBPAA diet (Table 7), and whole-body protein contents were not significantly different between fish fed the FMPAA diet and fish fed the MCPAA diet (P N 0.05). There were no significant differences in whole-body lipid and whole-body ash contents among all experimental treatments. Whole-body moisture of fish fed the WBPAA diet was significantly higher than that of fish fed the FMPAA diet but did not display significant differences compared to fish fed the WEPAA diet or the MCPAA diet. Muscle protein contents of fish fed the MCPAA diet or the FMPAA diet were significantly higher than that of fish fed the WEPAA diet. No significant differences were observed in muscle lipid contents among all experimental treatments. Muscle moisture content of fish fed the FMPAA diet was significantly lower than that of fish fed the WEPAA diet or the WBPAA diet. Fish fed the FMPAA diet had significantly higher muscle lysine, threonine, isoleucine, leucine, and histidine contents than fish fed the WBPAA diet (Table 8). Fish fed the WBPAA diet exhibited significantly higher muscle proline content than fish fed other experimental diets.

Table 7 Whole-body and muscle compositions (fresh weight) of juvenile hybrid grouper Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂ fed diets with different amino acid patterns for 7 weeks.1 WBPAA

MCPAA

FMPAA

Whole-body composition Moisture % 71.7 ± 0.4ab Protein % 17.1 ± 0.2b Lipid % 5.6 ± 0.3 Ash % 4.1 ± 0.1

WEPAA

71.8 ± 0.1a 17.0 ± 0.21b 6.0 ± 0.1 3.9 ± 0.1

70.6 ± 0.3ab 17.6 ± 0.1ab 6.1 ± 0.2 4.2 ± 0.0

70.5 ± 0.1b 17.8 ± 0.1a 6.2 ± 0.1 4.0 ± 0.1

Muscle composition Moisture % 76.9 ± 0.2ab Protein % 19.8 ± 0.2b Lipid % 0.91 ± 0.04

77.1 ± 0.1a 19.8 ± 0.1ab 0.84 ± 0.01

76.4 ± 0.1bc 20.4 ± 0.0a 0.92 ± 0.10

76.2 ± 0.1c 20.4 ± 0.1a 0.93 ± 0.09

1 Values are means (±SEM) of three replicate fish in each of three replicate tanks, and values within the same row with different letters are significantly (P b 0.05) different.

Table 8 Dorsal muscle amino acids (g/100 g wet weight) of juvenile hybrid grouper Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂ fed diets with different amino acid patterns for 7 weeks.1 WEPAA

WBPAA

MCPAA

FMPAA

EAA Lysine Arginine Methionine Threonine Isoleucine Leucine Phenylalanine Valine Histidine ∑EAA

1.84 1.17 0.60 0.88 1.02 1.81 0.77 0.92 0.41 9.42

± ± ± ± ± ± ± ± ± ±

0.02 0.03b 0.00 0.00ab 0.01ab 0.01ab 0.01 0.01 0.00ab 0.06b

1.75 1.26 0.59 0.85 0.99 1.77 0.80 0.91 0.36 9.27

± ± ± ± ± ± ± ± ± ±

0.02 0.03ab 0.02 0.01b 0.01b 0.04b 0.02 0.02 0.03b 0.08b

1.87 1.22 0.57 0.90 1.00 1.84 0.79 0.91 0.37 9.46

± ± ± ± ± ± ± ± ± ±

0.02 0.03ab 0.01 0.01ab 0.01ab 0.03ab 0.02 0.01 0.00ab 0.09b

1.93 1.29 0.61 0.91 1.10 1.89 0.81 0.96 0.43 9.87

± ± ± ± ± ± ± ± ± ±

0.02 0.01a 0.02 0.01a 0.01a 0.04a 0.02 0.01 0.01a 0.09a

NEAA Aspartic acid Serine Glutamic acid Glycine Alanine Cystine Tyrosine Proline ∑NEAA

2.01 0.70 2.85 1.03 1.24 0.17 0.62 0.80 9.43

± ± ± ± ± ± ± ± ±

0.02 0.01 0.03b 0.02b 0.01 0.01a 0.02 0.03b 0.09bc

2.00 0.72 2.88 1.17 1.27 0.14 0.52 1.07 9.78

± ± ± ± ± ± ± ± ±

0.02 0.01 0.04ab 0.01a 0.03 0.01ab 0.03 0.00a 0.03a

2.02 0.74 2.95 1.12 1.24 0.12 0.57 0.57 9.31

± ± ± ± ± ± ± ± ±

0.02 0.02 0.04ab 0.01a 0.02 0.01b 0.03 0.02c 0.08c

2.07 0.73 3.03 1.13 1.21 0.17 0.65 0.74 9.73

± ± ± ± ± ± ± ± ±

0.07 0.03 0.02a 0.02a 0.02 0.00a 0.03 0.01b 0.06ab

ab

b

a

a

1 Values are means (±SEM) of three replicate fish in each of three replicate tanks, and values within the same row with different letters are significantly (P b 0.05) different.

Plasma total protein (TP) of fish fed the FMPAA diet was significantly higher than that of fish fed the WEPAA diet or the WBPAA diet (Table 9). There were no significant differences in values of plasma glucose (GLU), total triglyceride (TG) and cholesterol (CHOL) concentrations among all experimental groups. 3.3. The relative mRNA expression levels of hepatic IGF-I and TOR genes The relative mRNA expression levels of hepatic IGF-I gene in fish fed the FMPAA and MCPAA diets were significantly higher than those of values in fish fed the WEPAA and WBPAA diets (P b 0.05) (Fig. 1). There were no significant differences in the relative mRNA expression levels of hepatic IGF-I gene between fish fed the FMPAA diet and fish fed the MCPAA diet as well as between fish fed the WEPAA diet and the WBPAA diet. Fish fed the FMPAA diet had a significantly higher relative mRNA expression level of hepatic TOR gene compared to fish fed other experimental diets (Fig. 2). Fish fed the MCPAA diet had a significantly higher relative mRNA expression level of hepatic TOR gene than fish fed the WEPAA diet or the WBPAA diet, and this value was not significantly different between fish fed the WEPAA diet and fish fed the WBPAA diet. 4. Discussion Results of the present study demonstrated that hybrid grouper fed the diet with an amino acid pattern of FMPAA had better growth

Table 9 Biochemical indices in plasma of juvenile hybrid grouper Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂ fed diets with different amino acid patterns for 7 weeks.1

TP (g L−1) −1

GLU (mmol L ) TG (mmol L−1) CHOL (mmol L−1)

WEPAA

WBPAA

MCPAA

FMPAA

33.30 ± 1.50c 2.60 ± 0.40 1.60 ± 0.32 4.50 ± 0.46

35.85 ± 0.95bc 2.53 ± 0.53 1.27 ± 0.19 4.77 ± 0.24

40.67 ± 0.23ab 2.90 ± 0.23 1.90 ± 0.40 4.67 ± 0.15

41.53 ± 1.32a 2.35 ± 0.05 1.80 ± 0.17 5.07 ± 0.20

1 Values are means (±SEM) of three replicate fish in each of three replicate tanks, and values within the same row with different letters are significantly (P b 0.05) different.

Relative mRNA expression of hepatic IGF-I(fold)

M. Wu et al. / Aquaculture 468 (2017) 508–514 3.0 a

2.5

a

2.0 1.5 1.0

b

b

0.5 0.0 WEPAA

WBPAA MCPAA Dietary amino acid patterns

FMPAA

Fig. 1. Relative mRNA expression of hepatic IGF-I gene of juvenile hybrid grouper Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂ fed diets with different amino acid patterns. Columns represented the mean ± SEM (Columns sharing a common superscript = 6). Columns sharing a common superscript letter were not significantly different (P N 0.05).

performance and feed utilization compared to fish fed the diet with the amino acid pattern of WEPAA, WBPAA or MCPAA, indicating that dietary amino acid pattern of FMPAA was better to reflect the EAA requirement profile of hybrid grouper compared to that of WEPAA, WBPAA or MCPAA. The WEPAA diet had 6% lower lysine, 12.1% lower arginine, 7% lower methionine, 11.9% lower phenylalanine than the FMPAA diet, and the WBPAA diet had 16.4% lower lysine, 17.5% lower methionine, 23.1% lower isoleucine, 14.7% lower leucine, 16.2% lower phenylalanine, 17.9% lower valine, 28.6% lower histidine than the FMPAA diet. Thus, the differences of the lysine, arginine, methionine, and phenylalanine between the FMPAA diet and the WEPAA diet could lead to the variation in WG of fish fed the two diets, and similarly, the poorer growth of fish fed the WBPAA diet compared to fish fed the FMPAA diet was attributed to the lower contents of lysine, methionine, isoleucine, leucine, phenylalanine, valine, histidine. In Japanese flounder (Alam et al., 2002) and large yellow croaker (Li et al., 2013), similar results were also observed when comparing effects of dietary amino acid patterns of FMPAA, WEPAA, WBPAA and MCPAA on fish growth performance. However, some other previous studies (Wilson and Poe, 1985; Mambrini and Kaushik, 1995) showed that whole-body amino acid profile best reflects the ideal pattern of a reference protein. In the study of Wilson and Poe (1985), whole-body and egg amino acids patterns were compared, and in the study of Mambrini and Kaushik (1995), the amino acid profile as a guideline for formulating feeds or for studying amino acid requirements of fish was examined using a multivariate analytical procedure. The different results above maybe attributed to different fish species, or different experimental designs, or different analytical methods. In the present study, higher relative mRNA expression levels of hepatic IGF-I gene were observed in FMPAA or MCPAA fed fish which had better growth performance compared to fish fed the WEPAA or WBPAA diet, indicating a positive relationships between growth performance and relative mRNA expression levels of hepatic IGF-I gene. This revealed that the mRNA expression level of hepatic IGF-I gene partially contributed to fish growth in this study. It is generally accepted that growth of fish is primarily mediated through the GH/IGF system Relative mRNA expression of hepatic TOR (fold)

512

1.8 1.6 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0

a b c c

WEPAA

WBPAA MCPAA Dietary amino acid patterns

FMPAA

Fig. 2. Relative mRNA expression of hepatic TOR gene of juvenile hybrid grouper Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂ fed diets with different amino acid patterns. Columns represented the mean ± SEM (n = 6). Columns sharing a common superscript letter were not significantly different (P N 0.05).

M. Wu et al. / Aquaculture 468 (2017) 508–514

(Reindl and Sheridan, 2012). IGF-I is the major anabolic agent responsible for tissue growth in mammals and teleost fish, and alteration in IGF-I gene expression can partly account for changes in growth rate (Duan, 1998). The imbalance of dietary amino acids was reported to possibly decrease the expression level of hepatic IGF-I gene of cobia (Luo et al., 2012) and Japanese seabass (Men et al., 2014). Hepatic TOR gene had the similar varying trend as hepatic IGF-I gene. The relative mRNA expression levels of hepatic TOR gene differed among different experimental groups and fish fed the FMPAA diet had significantly higher mRNA expression levels than fish fed the WEPAA diet, the WBPAA diet or the MCPAA diet, indicating that dietary amino acid patterns could influence TOR gene expressing. TOR pathway is a key regulator of balance between protein synthesis and degradation in response to nutrition quality and quantity, and the central in TOR signaling pathway is TOR protein (Wullschleger et al., 2006). Results obtained in this study were in agreements with other studies which reported that the supplementation of some amino acids to diets had an impact on TOR gene expression in different aquatic animals (Sun et al., 2010; Chen et al., 2012; Wacyk et al., 2012; Zhao et al., 2012). Amino acids are important precursors that stimulate protein synthesis mainly by activating the target of rapamycin (TOR) nutrient-sensitive signaling pathway (Meijer, 2003; Wang and Proud, 2006; Kim, 2009) and hence improve fish growth. The TOR pathway responded not only to dietary amino acids but also to growth factors such as insulin and IGFs via the PI3K pathway and then regulated cell growth (Wullschleger et al., 2006), and similar results were also observed in this study which showed that there had a positive relation between the mRNA expression levels of hepatic TOR and IGF-I genes. The regulating mechanism of TOR signaling pathway by dietary amino acid patterns is complex and the relative information is limited and needs to be further investigated. The significantly higher DFI observed in fish fed the WBPAA diet compared to those of fish fed other experimental diets maybe attributed to their higher FCR and lower PER, PPV which were resulted from the relative AA imbalance of the WBPAA diet. It was reported that when fish fed an imbalanced AA diet, the absorbed dietary AA not matching the profile needed for protein synthesis would be deaminated and used in energy production, gluconeogenesis or lipogenesis (Ballantyne, 2001), accordingly leading to an increase in AA oxidation and catabolism (Kim et al., 1983; Fauconneau et al., 1992), decreasing food conversion efficiencies and lowering growth rate (Millamena et al., 1997). A balanced dietary AA profile increases AA retention, which probably reflected in an increase in protein retention (Aragão et al., 2004). In this study, fish fed the FMPAA diet had higher whole-body protein and dorsal muscle protein contents than fish fed diets with other amino acid patterns, being in accordance with the study of Li et al. (2013). Dietary amino acid pattern plays a role in synthesis and deposition rate of protein, which could influence the composition of fish (Smith, 1981; Abdel-Tawwab et al., 2006; Abdel-Tawwab and Ahmad, 2009). In the present study, amino acids profiles in muscle tissue of fish reflected dietary amino acids contents, and the higher pool of some muscle amino acids including lysine, threonine, isoleucine, leucine, and histidine contents in fish fed the FMPAA diet compared to those of fish fed the WBPAA diet were responsible for the higher contents of these amino acids in the FMPAA diet, being in line with previous studies (Nose et al., 1978; Kaushik and Luquet, 1980; Dabrowska, 1984). Fish fed the FMPAA diet had significantly higher plasma total protein than that of fish fed the WEPAA diet or the WBPAA diet, which may reflect the protein metabolism in vivo (Zhang et al., 2010). Growth performance has been found to be positively related to plasma protein content in some fish species (Yang et al., 2016; Wang et al., 2016). Similar results were also observed in this study which showed that fish with relatively high WG in the FMPAA and MCPAA groups had higher plasma protein contents than fish with low WG in the WEPAA and WBPAA groups.

513

In conclusion, results of the present study indicated that dietary amino acids pattern as that of anchovy fishmeal protein was better to reflect the EAA requirement profile of hybrid grouper compared to dietary amino acids pattern as that of whole-egg protein, whole-body protein, or muscle protein of hybrid grouper due to the better growth performance and feed utilization observed in fish fed the diet with an amino acids pattern of anchovy fishmeal protein. Acknowledgements This study was supported by a grant (no.: 31260641) from The National Natural Science Fund and a grant (no.: ZDYF2016222) from Hainan International Science and Technology Cooperation Projects. Authors wish to appreciate the editor and anonymous reviewers for their valuable suggestions on our manuscript. References Abdel-Tawwab, M., Ahmad, M.H., 2009. Effect of dietary protein regime during the growing period on growth performance, feed utilization and shole-body chemical composition of Nile tilapia, Oreochromis niloticus (L.). Aquac. Res. 40, 1532–1537. Abdel-Tawwab, M., Khattab, Y.A.E., Ahmad, M.H., Shalaby, A.M.E., 2006. Compensatory growth, feed utilization, whole body composition and hematological changes in starved juvenile Nile tilapia, Oreochromis niloticus (L.). J. Appl. Aquac. 18, 17–36. Alam, S., Teshima, S., Yaniharto, D., Koshio, S., Ishikawa, M., 2002. Influence of different dietary amino acid patterns on growth and body composition of juvenile Japanese flounder, Paralichthys olivaceus. Aquaculture 210, 359–369. AOAC, 1990. Official Methods of Analysis. AOAC (Association of Official Analytical Chemists), p. 1298. Aragão, C., Conceição, L.E.C., Martins, D., Rønnestad, I., Gomes, E., Dinis, M.T., 2004. A balanced dietary amino acid profile improves amino acid retention in post-larval Senegalese sole (Solea senegalensis). Aquaculture 233, 293–304. Avruch, J., Long, X., Ortiz-Vega, S., Rapley, J., Papageorgiou, A., Dai, N., 2009. Amino acid regulation of TOR complex 1. Am. J. Physiol. Endocrinol. Metab. 296, E592–E602. Bai, Y., Zhang, L., Xia, S., Liu, S., Ru, X., Xu, Q., 2015. Effects of dietary protein levels on the growth, energy budget, and physiological and immunological performance of green, white and purple color morphs of sea cucumber, Apostichopus japonicus. Aquaculture 450, 289–294. Ballantyne, J.S., 2001. Amino acid metabolism. In: Wright, P.A., Anderson, A.J. (Eds.), Nitrogen Excretion. Academic Press, San Diego, pp. 77–107. Berg, G.E., Lied, E., Sveier, H., 1997. Nutrition of Atlantic salmon (Salmo salar): the requirement and metabolism of arginine. Comp. Biochem. Physiol. 117A, 501–509. Bodin, N., Delfosse, G., Thu, T.T.N., Boulengé, E.L., Abboudi, T., Larondelle, Y., Rollin, X., 2012. Effects of fish size and diet adaptation on growth performances and nitrogen utilization of rainbow trout (Oncorhynchus mykiss W.) juveniles given diets based on free and/or protein-bound amino acids. Aquaculture 356–357, 105–115. Castillo, J., Codina, M., Martínez, M.L., Navarro, I., Gutiérrez, J., 2004. Metabolic and mitogenic effects of IGF-I and insulin on muscle cells of rainbow trout. Am. J. Phys. Regul. Integr. Comp. Phys. 286, R935–R941. Chauvigné, F., Gabillard, J.C., Weil, C., Rescan, P.Y., 2003. Effect of refeeding on IGFI, IGFII, IGF receptors, FGF2, FGF6, and myostatin mRNA expression in rainbow trout myotomal muscle. Gen. Comp. Endocrinol. 132 (2), 209–215. Chen, G.F., Feng, L., Kuang, S.Y., Liu, Y., Jiang, J., Hu, K., Jiang, W.D., Li, S.H., Tang, L., Zhou, X.Q., 2012. Effect of dietary arginine on growth, intestinal enzyme activities and gene expression in muscle, hepatopancreas and intestine of juvenile Jian carp (Cyprinus carpio var. Jian). Br. J. Nutr. 108, 195–207. Codina, M., de la serrana García, D., Sánchez-Gurmaches, J., Montserrat, N., Chistyakova, O., Navarro, I., Gutiérrez, J., 2008. Metabolic and mitogenic effects of IGF-II in rainbow trout (Oncorhynchus mykiss) myocytes in culture and the role of IGF-II in the PI3K/Akt and MAPK signalling pathways. Gen. Comp. Endocrinol. 157, 116–124. Dabrowska, H., 1984. Effect of dietary proteins on the free amino acid content in rainbow trout (Salmo gairdneri rich) muscles. Comp. Biochem. Physiol. A 77, 553–556. Dawson-Hughes, B., Harris, S.S., Rasmussen, H.M., Dallal, G.E., 2007. Comparative effects of oral aromatic and branched-chain amino acids on urine calcium excretion in humans. Osteoporos. Int. 18, 955–961. Deng, D.F., Ju, Z.Y., Dominy, W., Murashige, R., Wilson, R.P., 2011. Optimal dietary protein levels for juvenile pacific threadfin (Polydactylus sexfilis) fed diets with two levels of lipid. Aquaculture 316, 25–30. Duan, C.M., 1998. Nutritional and developmental regulation of insulin-like growth factors in fish. J. Nutr. 128, 306S–314S. Dumas, A., de Lange, C.F.M., France, J., Bureau, D.P., 2007. Quantitative description of body composition and rates of nutrient deposition in rainbow trout (Oncorhynchus mykiss). Aquaculture 263, 165–181. Emmert, J.L., Baker, D.H., 1997. Use of the ideal protein concept for precision formulation of amino acid levels in broiler diets. J. Appl. Poult. Res. 6, 462–470. Fafournoux, P., Bruhat, A., Jousse, C., 2000. Amino acid regulation of gene expression. Biochem. J. 351, 1–12. Fan, Z., Ding, X.Y., He, F., Xu, Y.B., Xue, H.L., Zhang, J.R., 2013. The dietary protein requirement of a new Japanese strain of juvenile Chinese softshell turtle, Pelodiscus sinensis. Aquaculture 412–413, 74–80.

514

M. Wu et al. / Aquaculture 468 (2017) 508–514

Fauconneau, B., Basseres, A., Kaushik, S.J., 1992. Oxidation of phenylalanine and threonine in response to dietary arginine supply in rainbow trout (Salmo gairdneri R.). Comp. Biochem. Physiol. 101A, 395–401. Fuentes, E.N., Valdés, J.A., Molina, A., Björnsson, B.T., 2013. Regulation of skeletal muscle growth in fish by the growth hormone-insulin-like growth factor system. Gen. Comp. Endocrinol. 192, 136–148. Garling Jr., D.L., Wilson, R.P., 1977. Effect of dietary carbohydrate to lipid ratio on growth and body composition of fingerling channel catfish. Prog. Fish Cult. 39, 43–47. Ghigo, E., Aimaretti, G., Arvat, E., Camanni, F., 2001. Growth hormone-releasing hormone combined with arginine or growth hormone secretagogues for the diagnosis of growth hormone deficiency in adults. Endocrine 15, 29–38. Goff, J.B., Gatlin, D.M., 2004. Evaluation of different sulfur amino acid compounds in the diet of red drum, Sciaenops ocellatus, and sparing value of cystine for methionine. Aquaculture 241, 465–477. Halver, J.E., Delong, D.C., Mertz, E.T., 1959. Methionine and cystine requirements of Chinook salmon. Fed. Proc. 18, 2076. Hevrøy, E.M., Azpeleta, C., Shimizu, M., Lanzén, A., Espe, M., Olsvik, P.A., 2011. Effects of short-term starvation on ghrelin, GH–IGF system, and IGF binding proteins in Atlantic salmon. Fish Physiol. Biochem. 37, 217–232. Jiang, S.T., Wu, X.Y., Li, W.F., Wu, M.J., Luo, Y., Lu, S.D., Lin, H.R., 2015. Effects of dietary protein and lipid levels on growth, feed utilization, body and plasma biochemical compositions of hybrid grouper (Epinephelus lanceolatus ♂ × Epinephelus fuscoguttatus ♀) juveniles. Aquaculture 446, 148–155. Jiang, S.T., Wu, X.Y., Luo, Y., Wu, M.J., Lu, S.D., Jin, Z.B., Yao, W., 2016. Optimal dietary protein level and protein to energy ratio for hybrid grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus♂) juveniles. Aquaculture 465, 28–36. Jobgen, W.S., Fried, S.K., Fu, W.J., Meininger, C.J., Wu, G., 2006. Regulatory role for the arginine-nitric oxide pathway in metabolism of energy substrates. J. Nutr. Biochem. 17, 571–588. Kaushik, S.J., Luquet, P., 1980. Influence of dietary amino acid patterns on the free amino acid contents of blood and muscle of rainbow trout (Salmo gairdnerii R.). Comp. Biochem. Physiol. 64B, 175–180. Ketola, H.G., 1982. Amino acid nutrition of fishes: requirements and supplementation of diets. Comp. Biochem. Physiol. 73B, 17–24. Kim, E., 2009. Mechanisms of amino acid sensing in TOR signaling pathway. Nutr. Res. Pract. 3, 64–71. Kim, J.D., Lall, S.P., 2000. Amino acid composition of whole body tissue of Atlantic halibut (Hippoglossus huppoglossus), yellowtail flounder (Pleuronectes ferruginea) and Japanese flounder (Paralichthys olivaceus). Aquaculture 187, 367–373. Kim, K., McMillan, I., Bayley, H.S., 1983. Determination of amino acid requirements of young pigs using an indicator amino acid. Br. J. Nutr. 50, 369–382. Kimball, S.R., Jefferson, L.S., 2006. Signaling pathways and molecular mechanisms through which branched-chain amino acids mediate translational control of protein synthesis. J. Nutr. 136, 227S–231S. Lee, D.J., Putnam, G.B., 1973. The response of rainbow trout to varying protein/energy ratios in a test diet. J. Nutr. 103, 916–922. Li, W.J., Ai, Q.H., Mai, K.S., Xu, W., Luo, Y.W., Zhang, Y.J., 2013. Effects of dietary amino acid patterns on growth and protein metabolism of large yellow croaker (Larimichthys crocea) larvae. Aquaculture 406–407, 1–8. Lin, X.Y., Shiau, S.Y., 2003. Dietary lipid requirement of grouper, Epinephelus malabaricus, and effects on immune responses. Aquaculture 225, 243–250. Luo, Y.W., Ai, Q.H., Mai, K.S., Zhang, W.B., Xu, W., Zhang, Y.J., 2012. Effects of dietary rapeseedmeal on growth performance, digestion and protein metabolism in relation to gene expression of juvenile cobia (Rachycentron canadum). Aquaculture 368–369, 109–116. Luo, Y., Wu, X.Y., Li, W.F., Jiang, S.T., Lu, S.D., Wu, M.J., 2016. Effects of different corn starch levels on growth, protein input, and feed utilization of juvenile hybrid grouper (male Epinephelus lanceolatus × female E. fuscoguttatus). N. Am. J. Aquac. 78, 168–173. Mambrini, B.M., Kaushik, S.J., 1995. Indispensable amino acid requirements of fish: correspondence between quantitative data and amino acid profiles of tissue proteins. J. Appl. Ichthyol. 11, 240–247. Martínez-Palacios, C.A., Ríos-Durán, M.G., Ambriz-Cervantes, L., Jauncey, K.J., Ross, L.G., 2007. Dietary protein requirement of juvenile Mexican silverside (Menidia estor Jordan 1879), a stomachless zooplanktophagous fish. Aquac. Nutr. 13, 304–310. Meijer, A.J., 2003. Amino acids as regulators and components of nonproteinogenic pathways. J. Nutr. 133, 2057S–2062S. Men, K.K., Ai, Q.H., Mai, K.S., Xu, W., Zhang, Y.J., Zhou, H.H., 2014. Effects of dietary corn gluten meal on growth, digestion and protein metabolism in relation to IGF-I gene expression of Japanese seabass, Lateolabrax japonicus. Aquaculture 428–429, 303–309. Millamena, O.M., Bautista-Teruel, M.N., Reyes, O.S., Kanazawa, A., 1997. Threonine requirement of juvenile marine shrimp Penaeus monodon. Aquaculture 151, 9–14.

Millward, D.J., 1998. The nutritional regulation of muscle growth and protein turnover. Aquaculture 79, 1–28. Montserrat, N., Capilla, E., Navarro, I., Gutiérrez, J., 2012. Metabolic effects of insulin and IGFs on gilthead sea bream (Sparus aurata) muscle cells. Front. Endocrinol. 3, 55. Nose, T., Lee, D.L., Arai, S., 1978. The effects of withdrawal of single amino acid from an amino acid diet on the free amino acid composition of skeletal muscle in young carp. Bull. Freshwater Fish. Res. Lab. 28, pp. 255–262. NRC (National Research Council), 2011. Nutrient Requirement of Fish. National Academy Press, Washington, DC, USA . Rahimnejad, S., Bang, I.C., Park, J.Y., Sade, A., Choi, J., Lee, S.M., 2015. Effects of dietary protein and lipid levels on growth performance, feed utilization and body composition of juvenile hybrid grouper, Epinephelus fuscoguttatus × E. lanceolatus. Aquaculture 446, 283–289. Reindl, K.M., Sheridan, M.A., 2012. Peripheral regulation of the growth hormoneinsulinlike growth factor system in fish and other vertebrates. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 163, 231–245. Smith, M.A.K., 1981. Estimation of growth potential by measurement of tissue protein synthetic rates in feeding and fasting rainbow trout, Salmo gairdneri Richardson. J. Fish Biol. 19, 213–220. Stanley, T., 2012. Diagnosis of growth hormone deficiency in childhood. Curr. Opin. Endocrinol. Diabetes Obes. 19, 47–52. Sun, S.J., Liu, M., Peng, J.S., Wang, B.J., Jiang, K.Y., Wang, L., 2010. Molecular cloning of the TOR gene from Fenneropenaeus chinensis and its expression in response to arginine or leucine. J. Mar. Sci. 34, 71–80 (in Chinese with English abstract). Tu, Y.Q., Xie, S.Q., Han, D., Yang, Y.X., Jin, J.Y., Zhu, X.M., 2015. Dietary arginine requirement for gibel carp (Carassis auratus gibelio var. CAS III) reduces with fish size from 50 g to 150 g associated with modulation of genes involved in TOR signaling pathway. Aquaculture 449, 37–47. Unnikrishnan, U., Paulraj, R., 2010. Dietary protein requirement of giant mud crab Scylla serrata juveniles fed isoenergetic formulated diets having graded protein levels. Aquac. Res. 41, 278–294. Van Sluijters, D.A., Dubbelhuis, P.F., Blommaart, E.F.C., Meijer, A.J., 2000. Amino-acid-dependent signal transduction. Biochem. J. 351, 545–550. Wacyk, J., Powell, M., Rodnick, K., Overturf, K., Hill, R.A., Hardy, R., 2012. Dietary protein source significantly alters growth performance, plasma variables and hepatic gene expression in rainbow trout (Oncorhynchus mykiss) fed amino acid balanced diets. Aquaculture 356–357, 223–234. Wang, T.C., Fuller, M.F., 1989. The optimum dietary amino acid pattern for growing pigs. I. Experiments by amino acid deletion. Br. J. Nutr. 62, 77–89. Wang, X., Proud, C., 2006. The mTOR pathway in the control of protein synthesis. Physiology 21, 362–369. Wang, J.T., Jiang, Y.D., Li, X.Y., Han, T., Yang, Y.X., Hu, S.X., Yang, M., 2016. Dietary protein requirement of juvenile red spotted grouper (Epinephelus akaara). Aquaculture 450, 289–294. Whiteman, K.W., Gatlin, D.M., 2005. Evaluation of crystalline amino acid test diets including pH adjustment with red drum (Sciaenops ocellatus) and hybrid striped bass (Morone chrysops × Morone saxatilis). Aquaculture 248, 21–25. Wilson, R.P., Cowey, C.B., 1985. Amino acid composition of whole body tissue of rainbow trout and Atlantic salmon. Aquaculture 48, 373–376. Wilson, R.P., Poe, W.E., 1985. Relationship of whole body and egg essential amino acid patterns to amino acid requirement patterns in channel catfish, Ictalurus punctatus. Comp. Biochem. Physiol. 80B, 385–388. Wullschleger, S., Loewith, R., Hall, M.N., 2006. TOR signaling in growth and metabolism. Cell 124, 471–484. Yang, M., Wang, J.T., Han, T., Yang, Y.X., Li, X.Y., Jiang, Y.D., 2016. Dietary protein requirement of juvenile bluegill sunfish (Lepomis macrochirus). Aquaculture 459, 191–197. Yao, C.L., Kong, P., Wang, Z.Y., Ji, P.F., Cai, M.Y., Liu, X.D., Han, X.Z., 2009. Molecular cloning and expression of MyD88 in large yellow croaker, Pseudosciaena crocea. Fish Shellfish Immunol. 26, 249–255. Zhang, J., Zhou, F., Wang, L., Shao, Q., Xu, Z., Xu, J., 2010. Dietary protein requirement of juvenile black sea bream, Sparus macrocephalus. J. World Aquacult. Soc. 41, 151–164. Zhao, J., Liu, Y., Jiang, J., Wu, P., Chen, G.F., Jiang, W.D., Li, S.H., Tang, L., Kuang, S.Y., Feng, L., Zhou, X.Q., 2012. Effects of dietary isoleucine on growth, the digestion and absorption capacity and gene expression in hepatopancreas and intestine of juvenile Jian carp (Cyprinus carpio var. Jian). Aquaculture 368-369, 117–128. Zhou, Q.C., Zeng, W.P., Wang, H.L., Xie, F.J., Wang, T., Zheng, C.Q., 2012. Dietary arginine requirement of juvenile yellow grouper Epinephelus awoara. Aquaculture 350–353, 175–182.