- Email: [email protected]
Effects of dietary astaxanthin on lipopolysaccharide-induced oxidative stress, immune responses and glucocorticoid receptor (GR)-related gene expression in Channa argus
Aquaculture 517 (2020) 734816
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aquaculture
Effects of dietary astaxanthin on lipopolysaccharide-induced oxidative stress, immune responses and glucocorticoid receptor (GR)-related gene expression in Channa argus
T
Mu-Yang Lia,c,d, Wan-Qing Guob, Gui-Liang Guob, Xin-Ming Zhua,c,d, Xiao-Tian Niua,c,d, ⁎ ⁎ Xiao-Feng Shana,c,d, Jia-Xin Tiana,c,d, Gui-Qin Wanga,c,d, , Dong-Ming Zhanga,c,d, a
College of Animal Science and Technology, Jilin Agricultural University, Changchun, Jilin 130118, China Testing Center of Quality and Safety in Aquatic Product, Changchun, Jilin 130000, China Jilin Provincial Key Laboratory of Animal Nutrition and Feed Science, Jilin Agricultural University, Changchun, Jilin 130118, China d Ministry of Education Laboratory of Animal Production and Quality Security, Jilin Agricultural University, Changchun, Jilin 130118, China b c
A R T I C LE I N FO
A B S T R A C T
Keywords: Astaxanthin Oxidative stress Immune response Channa argus
The present study was conducted to evaluate the effects of dietary astaxanthin (AX) supplementation on lipopolysaccharide (LPS)-induced oxidative stress, immune responses and glucocorticoid receptor (GR)-related gene expression in Channa argus. A basal diet was supplemented with AX at 0, 50, 100 and 200 mg/kg feed for 56 days. The results showed that after LPS challenge, superoxide dismutase (SOD), catalase (CAT), glutathione-Stransferase (GST), glutathione peroxidase (GPx), glutathione reductase (GSH-Rt), lysozyme (LZM), complement 3 (C3), complement 4 (C4) were significantly reduced (P < .05), while malondialdehyde (MDA), interleukin-1β (IL-1β) and tumour necrosis factor-α (TNF-α) levels were significantly increased (P < .05) in liver, spleen, kidney and intestine. Dietary AX supplementation could alleviate LPS induced above changes in C. argus. Dietary AX supplementation significantly increased (P < .05) gene expression levels including heat shock protein 70 (HSP70), heat shock protein 90 (HSP90) and glucocorticoid receptor (GR) after LPS challenge. The protective effects of AX on LPS-induced oxidative damage is associated with promoting the levels of antioxidant enzymes and immune parameters. In addition, AX can attenuate LPS-induced inflammation response by up-regulating GRrelated gene expression in C. argus.
1. Introduction Fish are usually exposed to a variety of stressors (e.g., crowding, capture, invasion of bacteria and viruses) (Zhou et al., 2015a). When fish are subjected to adverse stressors, often resulting in changes of some endocrine and physiological parameters in the tissue of fish (Chen et al., 2016). Bacteria and viruses are generally considered to be one of the most common stressors in fish farming. Lipopolysaccharide (LPS), a bacterial endotoxin, is often associated with oxidative stress, immune responses and disease processes (Jiang et al., 2017). Previous study has revealed that LPS could induce oxidative stress and inflammation, decrease antioxidant enzymes levels and increase inflammatory cytokines levels (Li et al., 2019a). Oxidative stress can cause metabolic and immunological changes, eventually increasing the susceptibility of this fish to various pathogens (Li et al., 2019b). In addition, previous study also reported that oxidative stress and inflammation are closely linked
⁎
(Jiang et al., 2017). Previous study also showed that LPS-induced inflammatory responses are associated with activation of the NF-κB signaling pathways (Li et al., 2019c). The molecular mechanism of NF-κB signaling pathway inhibition is closely related to the interaction of glucocorticoid receptors (GR) and NF-κB (Ioanna et al., 2016). Astaxanthin (AX), an orange-reddish carotenoid pigment, plays an important role in antioxidant, anti-inflammatory, immunity enhancing and growth promoting (Jagruthi et al., 2014). It can naturally synthesize in some bacteria, microalgae, Haematococcus pluvialis and phaffia rhodozyma, which have wide variety of sources, biodegradable, no drug resistance and environment friendly (Liu et al., 2016; Wang et al., 2018). Previous research has showed that dietary AX could improve immune response, disease resistance, and growth performance of Cyprinus carpio (Jagruthi et al., 2014). Han et al. (2018) found that dietary AX can reduce oxidative stress and increase whole body n-3HUFA concentrations for juvenile Portunus trituberculatus (Han et al., 2018).
Corresponding authors at: College of Animal Science and Technology, Jilin Agricultural University, Changchun, Jilin 130118, China. E-mail address: [email protected] (G.-Q. Wang).
https://doi.org/10.1016/j.aquaculture.2019.734816 Received 21 April 2019; Received in revised form 29 November 2019; Accepted 2 December 2019 Available online 03 December 2019 0044-8486/ © 2019 Elsevier B.V. All rights reserved.
Aquaculture 517 (2020) 734816
M.-Y. Li, et al.
Channa argus is an economically important fish species in China (Sagada et al., 2017). In recent decades, there have been increasing reports of aquatic animal diseases caused by stress, which results in substantial economic loss (Zhou et al., 2015a; Chen et al., 2016). Various immunostimulants (i.g., probiotic, vitamin E, emodin, medicinal plant polysaccharide and plant flavonoids) have been used as feed additives, and their immune-promoting effects on stress resistance have been documented (Chen et al., 2004; Liu et al., 2016; Gou et al., 2018; Li et al., 2019d; Li et al., 2019f). In previous study, we evaluated the effect of different dietary AX levels on hematology parameters, serum antioxidant activity, serum immune responses and disease resistance against Aeromonas hydrophila of C. argus (Li et al., 2019e). Our results demonstrated that AX administration promoted antioxidant and immune response and disease resistance (Li et al., 2019e). Meanwhile, our results indicated that pretreatment with AX develops a potent protective effect on LPS-induced inflammatory response which may be associated with its inhibition of NF-κB and MAPKs signaling pathways activation (Li et al., 2019c). Taken together, this study expands on our previous report. Thus, the aim of the present study was to investigate the effects of dietary AX on LPS-induced oxidative stress, immune responses and GR-related gene expression in C. argus.
by the Ethics Committee of Jilin Agricultural University with ID no. 20121008. 2.3. LPS challenge experiment and sample collection After the 56 days, thirty fish from each group were weighed and subjected to the LPS challenge. Fish were injected intraperitoneally with LPS (4 mg/kg of fish) or sterile PBS, according to the methods described in our previous study. Hence, there were three different pretreatment/challenge groups, Ctrl/PBS, Ctrl/LPS, and AX/LPS. After the challenge trial, ten fish were randomly netted from each group and anaesthetized with buffered MS-222 (300 mg/L, Sigma–Aldrich, USA). All of the fish were dissected for the sampling of liver, spleen, kidney and intestine. All tissues were flash-frozen in liquid nitrogen and stored at −80 °C until analyzed. 2.4. Analysis and measurement 2.4.1. Antioxidant parameters The liver, spleen, kidney and intestine were used to analyze the antioxidant parameters. Superoxide dismutase (SOD), catalase (CAT), glutathione-S-transferase (GST), glutathione peroxidase (GPx) activity, glutathione reductase (GSH-Rt) activity and malondialdehyde (MDA) content were measured according to the method described by Xu et al. (Xu et al., 2016) and Li et al. (Li et al., 2019a).
2. Materials and methods 2.1. Experimental diet
2.4.2. Immunological parameters Immunological parameters in liver, spleen, kidney and intestine were measured. Lysozyme (LZM), complement 3 (C3) and complement 4 (C4) were measured according to the method described by Xu et al. (Xu et al., 2016). Interleukin-1β (IL-1β) and tumour necrosis factor-α (TNF-α) levels were determined according to the method described by our previous study (Li et al., 2019a) using a commercially available ELISA kit (Nanjing Jiancheng Bioengineering Institute, China). The minimum detectability of IL-1β and TNF-α was 1.0 ng/g protein. The results for IL-1β and TNF-α are expressed as ng/g protein.
The formulation and nutrient content of the basal diet is shown in Table 1. The AX, ≥ 98% (HPLC, Yuanye Biotechnology, Shanghai, China) were sprayed into the basal diet slowly at four levels: 0, 50, 100 and 200 mg/kg. The diet was uniformly mixed in a micromixer at room temperature, and dried under aseptic conditions, pelleted and stored at −4 °C until used. 2.2. Experimental fish and design We obtained healthy C. argus that were of similar size (23.40 ± 0.53 g) from a commercial hatchery (Huzhou, China). The fish were placed in 300 L glass aquarium with aerated filtered dechlorinated water and were acclimated for 14 days. Following acclimation, 400C. argus were randomly divided into four groups (5 tanks per group, 20 fish per tank). The water temperature and pH were 26 ± 1 °C and 7.1 ± 0.1, respectively. The experimental units were under a natural light and dark cycle (approximately 13:11 h light: dark). All fish were fed two times (08:00 and 16:00) a day at a rate of 3–4% of the wet body weight. Half of the water in each tank was changed every two days. All of the experimental fish used in the study were used in accordance with the NIH Guide for the Care and approved
2.4.3. Real-time PCR analysis The genes (HSP70, HSP90 and GR) expression in liver, spleen, kidney and intestine determined by real-time quantitative PCR. Total RNA samples were extracted using RNAiso Plus (Takara, Dalian, China). The quality and concentration of RNA were analyzed by using NanoDrop 2000 spectrophotometry (Thermo scientific, USA). Reverse transcription of RNA into cDNA and use reverse transcriptase synthesis kit (Takara, Dalian, China). We used real-time PCR to determine gene expression levels SYBR with Premix Ex TaqTM П kit (Takara, Dalian, China). The primer sequences indicated in Table 2. PCR reaction mixtures included SYBR qPCR Mix (10 μL), forward and reverse primer Table 2 Primer sequences and annealing temperatures for polymerase chain reactions.
Table 1 Formulation and nutrient content of the basal diet. Ingredients (%)
Nutrient content (% or kJ/g)
Fish meal
38.7
Crude protein
48.1
Soybean meal Poultry meal Gluten Spraying blood meal Peanut meal Flour Fish oil Squid offal Monocalcium phosphate Vitamin premix Mineral mixture Zeolite
4 12.9 5 5 3 17.5 5.9 1 1.5 1.5 1 3
crude lipid ash carbohydrate gross energy
11.3 12.3 20.1 19.3
Name
Sequence (5′-3′)
Annealing temp. (°C)
GenBank ID/ Reference
GR-F
GGGAAAGACCAGGACTCATA
60
Li et al. (2019)a
GR-R HSP90-F HSP90-R HSP70-F HSP70-R β-actin-F β-actin-R
TTCTTGGTTTTCCGTGCTTC TGTATGTCAGGAGGGTGTTT TAGATTGATTTCTGGTTTTC ATTTTGAATGTGTCTGCGGT ACTTGCTGATGATGGGGTTA CACTGTGCCCATCTACGAG CCATCTCCTGCTCGAAGTC
55
Li et al. (2019)a
56
Li et al. (2019)a
57
Li et al. (2019)a
a Li, M., Zhu, X., Tian, J., Liu, M., 2019d. Dietary flavonoids from Allium mongolicum Regel promotes growth, improves immune, antioxidant status, immune-related signaling molecules and disease resistance in juvenile northern snakehead fish (Channa argus). Aquaculture. 501, 473–481.
2
Aquaculture 517 (2020) 734816
M.-Y. Li, et al.
Fig. 1. Superoxide dismutase (SOD) (A), catalase (CAT) (B) and malondialdehyde (MDA) (C), in liver, spleen, kidney and intestine of Channa argus fed diets containing different astaxanthin levels followed by LPS challenge. Data are expressed as the mean ± S.D. (n = 5). Values with different superscripts are significantly difference (P < .05) as determined by the Tukey's test.
(10 mM, 1 μL), cDNA (1 μL), DEPC-treated water (7 μL). The reaction conditions were as follows 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, anneal for 30 s and 72 °C for 30 s. The levels of gene expression were calculated using the 2 −ΔΔCt method and normalized using β-actin expression (Li et al., 2019a).
were conducted using SPSS statistics 20.0 software (IBM, USA).
2.5. Statistical analysis
Antioxidant parameters of liver, spleen, kidney and intestine were shown in Fig. 1 and Fig. 2. LPS challenge significantly increased the concentrations of MDA (P < .05) in the liver, spleen, kidney and intestine. However, AX/LPS groups significantly decreased MDA level compared with Ctrl/LPS group (P < .05) in the liver, spleen, kidney and intestine.
3. Result 3.1. Antioxidant status
The results are presented as mean ± S.D. The data were analyzed with one-way analysis of variance (ANOVA) to determine the significant differences. Tukey's multiple range test was used to compare the mean values (P < .05) to indicate significant differences. Analysis 3
Aquaculture 517 (2020) 734816
M.-Y. Li, et al.
Fig. 2. Glutathione-S-transferase (GST) (A), glutathione peroxidase (GPx) (B) and glutathione reductase (GSH-Rt) (C), in liver, spleen, kidney and intestine of Channa argus fed diets containing different astaxanthin levels followed by LPS challenge. Data are expressed as the mean ± S.D. (n = 5). Values with different superscripts are significantly difference (P < .05) as determined by the Tukey's test.
Compared with the Ctrl/PBS group, Ctrl/LPS group significantly decreased CAT, SOD, GST, GPx and GSH-Rt levels in the liver, spleen, kidney and intestine (P < .05). However, AX/LPS groups significantly increased CAT, SOD, GST, GPx and GSH-Rt levels compared with Ctrl/ LPS group (P < .05) in the liver, spleen, kidney and intestine.
and C4 compared with those in the Ctrl/LPS group (P < .05). Compared with the Ctrl/PBS group, Ctrl/LPS group significantly increased TNF-α and IL-1β levels in the liver, spleen, kidney and intestine (P < .05). However, AX/LPS groups significantly decreased TNF-α and IL-1β levels compared with Ctrl/LPS group (P < .05).
3.2. Immune response
3.3. Real-time PCR analysis
Immune parameters of liver, spleen, kidney and intestine were shown in Figs. 3 and 4. LPS challenge significantly decreased LZM, C3 and C4 levels in the liver, spleen, kidney and intestine (P < .05). However, AX/LPS group significantly increased the levels of LZM, C3
The HSP70, HSP90 and GR gene expression in liver, spleen, kidney and intestine are displayed in Fig. 5. LPS challenge did not significantly decreased or increased HSP70, HSP90 and GR gene expression levels in liver, spleen, kidney and intestine. However, AX/LPS groups 4
Aquaculture 517 (2020) 734816
M.-Y. Li, et al.
Fig. 3. Lysozyme (LZM) (A), complement 3 (C3) (B) and complement 4 (C4) (C) in liver, spleen, kidney and intestine of Channa argus fed diets containing different astaxanthin levels followed by LPS challenge. Data are expressed as the mean ± S.D. (n = 5). Values with different superscripts are significantly difference (P < .05) as determined by the Tukey's test.
stress and inflammatory response in C. argus (Li et al., 2019a; Li et al., 2019c). In this study, we assessed the effects of AX on LPS-induced oxidative stress, immune responses and GR-related gene expression in C. argus. Jiang et al. (2017) reported that LPS-induced excessive formation of ROS could trigger and accelerate oxidative stress in fish (Jiang et al., 2017). As a reliable indicator of oxidative stress, MDA was applied to reflect the level of cellular injures resulting from ROS (Liang et al., 2018). Therefore, the inhibition of MDA can be a potential intervention approach for oxidative stress. In this study, AX treatment groups significantly decreased the MDA concentration in liver, spleen, kidney and
significantly increased HSP70, HSP90 and GR gene expression levels (P < .05) in liver, spleen, kidney and intestine. 4. Discussion In recent decades, intensive aquaculture activity has generated a range of environmental stressors (Giri et al., 2015). In response to various stressors, organisms (such as fish, shrimp, shellfish, etc.) can trigger a variety of physiological and biochemical response, which involves antioxidant, immune and inflammatory responses (Liu et al., 2010). Our previous study has also shown that LPS can trigger oxidative 5
Aquaculture 517 (2020) 734816
M.-Y. Li, et al.
Fig. 4. Interleukin-1β (IL-1β) (A) and tumour necrosis factor-α (TNF-α) (B) in liver, spleen, kidney and intestine of Channa argus fed diets containing different astaxanthin levels followed by LPS challenge. Data are expressed as the mean ± S.D. (n = 5). Values with different superscripts are significantly difference (P < .05) as determined by the Tukey's test.
and intestine after LPS challenge. Similarly, dietary supplement with Allium mongolicum Regel polysaccharide increased C3, C4 and LZM levels after LPS challenge in C. argus (Li et al., 2019a). Dietary soybean isoflavones also increased C3, C4 and LZM levels in Trachinotus ovatus after pH stress (Zhou et al., 2015b). Short-lived increases in complements and LZM levels are usually beneficial to fish (Yang et al., 2015; Li et al., 2019d). This indicated that AX might enhance the immune ability of C. argus to some degree. IL-1β and TNF-α are two powerful pro-inflammatory cytokines, originating from leucocytes, macrophages, monocytes and granulocytes (Zhang et al., 2017; Li et al., 2019a). LPS is considered a general immunostimulatory component that triggers host defence responses by promoting inflammatory cytokines and the functions of head kidney macrophages (Li et al., 2019a). Jiang et al. (2017) reported that LPS challenge could up-regulate gene expression of IL-1β and TNF-α in Jian carp (Jiang et al., 2017). Our previous study demonstrated AX treatment groups significantly prevented the LPS-induced upregulation of pro-inflammatory cytokines TNF-α, IL-6 and IL-1β (Li et al., 2019c). In this study, LPS challenge significantly increased IL-1β and TNF-α contents, indicating that LPS induced the cellular inflammatory response. However, AX treatment groups significantly decreased IL-1β and TNF-α levels to attenuate the LPS-induced inflammatory response. Previous study demonstrated AX protects LPS-induced inflammatory response in C. argus through inhibiting NF-κB and MAPKs
intestine after LPS challenge. In line with our results, Han et al. (2018) demonstrated that dietary supplement AX enhanced CAT and SOD levels while reduced MDA levels in swimming crab Portunus trituberculatus (Han et al., 2018). CAT, SOD, GST, GPx and GSH-Rt, endogenous antioxidative molecules, play a major role in scavenging harmful reactive oxygen derivatives and counteracting oxygen toxicity (Valbona et al., 2018; Ming et al., 2019). Jiang et al. (2017) demonstrated LPS significantly decreased anti-oxidative enzymes activities, including CAT, SOD, GST, GPx and GSH-Rt in Jian carp (Jiang et al., 2017). The findings of the present study demonstrated that AX treatment groups significantly increased the levels of CAT, SOD, GST, GPx and GSH-Rt in liver, spleen, kidney and intestine after LPS challenge. As important antioxidative enzymes, CAT, SOD, GST, GPx and GSH-Rt are widely distributed in fish tissue and cells. Consequently, the promotion of antioxidative enzymes may contribute to reduce oxidative stress of C. argus. Complements are crucial components of innate immune system and play an essential role in protecting the health of fish (Ichiki et al., 2012; Ming et al., 2019). As an important component of nonspecific immune system, LZM play an important role in scavenging invasive pathogens and bacteria (Magnadóttir, 2006). Our previous study demonstrated LPS significantly decreased immune parameter, including C3, C4 and LZM in C. argus (Li et al., 2019a). In this study, AX treatment groups significantly increased C3, C4 and LZM levels in liver, spleen, kidney 6
Aquaculture 517 (2020) 734816
M.-Y. Li, et al.
Fig. 5. Relative expression (GR (A), HSP70 (B) and HSP90 (C)) in liver, spleen, kidney and intestine of Channa argus fed diets containing different astaxanthin levels followed by LPS challenge. Data are expressed as the mean ± S.D. (n = 5). Values with different superscripts are significantly difference (P < .05) as determined by the Tukey's test.
HSP70 and HSP90 are important chaperone proteins, which play a key role in the folding of newly synthesized and formation of GR protein complexes (Liu et al., 2012; Roberts et al., 2010; Tsurufuji et al., 1979). Our previous study also shown that AX could up-regulate the expression of GR, HSP70 and HSP90 (Li et al., 2019e). Taken together, these results indicate that AX may protect against LPS-induced inflammatory responses by up-regulating GR-related gene expression. In conclusion, the present study indicated that LPS challenge can induce oxidative stress, inflammation response and impaired immune response. Dietary AX supplementation could alleviate LPS induced
signaling pathways (Li et al., 2019c). NF-κB and MAPKs are important transcription factors, which play an important role in regulating the gene expression of inflammatory cytokines (Li et al., 2019c; Goya et al., 2016). In addition, study has shown that the molecular mechanism of NF-κB and MAPKs signaling pathway inhibition are closely related to the interaction of NF-κB, MAPKs and GR (Ioanna et al., 2016). To further characterize the mechanism of the inhibitory effect of AX on proinflammatory cytokines, we investigated the effect of AX on the GRrelated gene expression. In this study, AX treatment groups significantly up-regulated expression of GR, HSP70 and HSP90 after LPS challenge.
7
Aquaculture 517 (2020) 734816
M.-Y. Li, et al.
above changes in C. argus. The protective effects of AX on LPS-induced oxidative damage is associated with promoting the levels of antioxidant enzymes and immune parameters. In addition, AX can attenuate LPSinduced inflammation response by up-regulating GR-related gene expression in C. argus.
lipopolysaccharide-induced inflammatory response in Channa argus through inhibiting NF-κB and MAPKs signaling pathways. Fish Shellfish Immunol. 86, 280–286. Li, M., Zhu, X., Tian, J., Liu, M., 2019d. Dietary flavonoids from Allium mongolicum Regel promotes growth, improves immune, antioxidant status, immune-related signaling molecules and disease resistance in juvenile northern snakehead fish (Channa argus). Aquaculture. 501, 473–481. Li, M.Y., Liu, X.Y., Xia, C.G., Wang, G.Q., 2019e. Astaxanthin enhances hematology, antioxidant and immunological parameters, immune-related gene expression, and disease resistance against in Channa argus. Aquac. Int. 7, 42–49. Li, M.Y., Guo, W.Q., Guo, G.L., 2019f. Effect of sub-chronic exposure to selenium and Allium mongolicum regel flavonoids on Channa argus: bioaccumulation, oxidative stress, immune responses and immune-related signaling molecules. Fish Shellfish Immunol. 91, 122–129. Liang, X., Zhang, Jun, Guo, F., Wei, L., 2018. Oxidative stress and inflammatory responses in the liver of swamp eel (Monopterus albus) exposed to carbon tetrachloride. Aquaculture. 496, 232–238. Liu, B., Xie, J., Ge, X., Xu, P., Wang, A., He, Y., 2010. Effects of anthraquinone extract from rheum officinale bail on the growth performance and physiological responses of macrobrachium rosenbergii under high temperature stress. Fish Shellfish Immunol. 29, 49–57. Liu, B., Ge, X., Xie, J., Xu, P., He, Y., Cui, Y., Ming, J., Zhou, Q., Pan, L., 2012. Effects of anthraquinone extract from Rheum officinale bail on the physiological responses and HSP70 gene expression of Megalobrama amblycephala under Aeromonas hydrophila infection. Fish Shellfish Immunol. 32, 1–7. Liu, F., Shi, H.Z., Guo, Q.S., Yu, Y.B., Wang, A.M., Lv, F., Shen, W.B., 2016. Effects of astaxanthin and emodin on the growth, stress resistance and disease resistance of yellow catfish (Pelteobagrus fulvidraco). Fish Shellfish Immunol. 51, 125–135. Magnadóttir, B., 2006. Innate immunity of fish (overview). Fish Shellfish Immunol. 20, 137–144. Ming, J., Ye, J., Zhang, Y., Yang, X., 2019. Dietary optimal reduced glutathione improves innate immunity, oxidative stress resistance and detoxification function of grass carp (Ctenopharyngodon idella) against microcystin-LR. Aquaculture. 498, 594–605. Roberts, R.J., Agius, C., Saliba, C., Bossier, P., Sung, Y.Y., 2010. Heat shock proteins (chaperones) in fish and shellfish and their potential role in relation to fish health: a review. J. Fish Dis. 33, 789–801. Sagada, G., Chen, J., Shen, B., Huang, A., Sun, L., Jiang, J., Jin, C., 2017. Optimizing protein and lipid levels in practical diet for juvenile northern snakehead fish (Channa argus). Animal Nutrition 3, 156–163. Tsurufuji, S., Sugio, K., Takemasa, F., 1979. The role of glucocorticoid receptor and gene expression in the anti-inflammatory action of dexamethasone. Nature 280, 408–419. Valbona, A., Mihallaq, Q., Eldores, S., Valon, M., Caterina, F., 2018. Antioxidant defense system, immune response and erythron profile modulation in gold fish, Carassius auratus, after acute manganese treatment. Fish Shellfish Immunol. 76, 75–83. Wang, Z., Cai, C.F., Cao, X.M., 2018. Supplementation of dietary astaxanthin alleviated oxidative damage induced by chronic high pH stress, and enhanced carapace astaxanthin concentration of Chinese mitten crab Eriocheir sinensis. Aquaculture. 35, 483–492. Xu, H.J., Jiang, W.D., Feng, L., Liu, Y., 2016. Dietary vitamin C deficiency depresses the growth, head kidney and spleen immunity and structural integrity by regulating NFk B, TOR, Nrf2, apoptosis and MLCK signaling in young grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 52, 111–138. Yang, X., Guo, J.L., Ye, J.Y., Zhang, Y.X., Wang, W., 2015. The effects of ficus carica polysaccharide on immune response and expression of some immune-related genes in grass carp, ctenopharyngodon idella. Fish Shellfish Immunol. 42 (1), 132–137. Zhang, C.N., Zhang, J.L., Ren, H.T., Zhou, B.H., Wu, Q.J., Sun, P., 2017. Effect of tributyltin on antioxidant ability and immune responses of zebrafish ( Danio rerio ). Ecotoxicol. Environ. Saf. 138 (1–8). Zhou, C., Lin, H., Ge, X., Niu, J., Wang, J., Wang, Y., Chen, L., Huang, Z., Yu, W., Tan, X., 2015a. The effects of dietary soybean isoflavones on growth, innate immune responses, hepatic antioxidant abilities and disease resistance of juvenile golden pompano Trachinotus ovatus. Fish Shellfish Immunol. 43, 158–166. Zhou, C., Lin, H., Huang, Z., Wang, J., Wang, Y., Yu, W., 2015b. Effects of dietary soybean isoflavones on non-specific immune responses and hepatic antioxidant abilities and mRNA expression of two heat shock proteins (HSPs) in juvenile golden pompano Trachinotus ovatus under pH stress. Fish Shellfish Immunol. 47, 1043–1053.
Declaration of Competing Interest The authors declare that they have no conflict of interest. Acknowledgments The research was supported by the earmarked fund for Modern Agro-industry Technology Research System (CARS-46) and National Natural Science Foundation of China (NO.31372540). References Chen, R., Lochmann, R., Goodwin, A., 2004. Effects of dietary vitamins C and E on alternative complement activity, hematology, tissue composition, vitamin concentrations and response to heat stress in juvenile golden shiner (Notemigonus crysoleucas). Aquaculture 242, 553–569. Chen, X.M., Guo, G.L., Sun, L., Yang, Q.S., Wang, G.Q., Qin, G.X., 2016. Effects of ala-gln feeding strategies on growth, metabolism, and crowding stress resistance of juvenile cyprinus carpio var. jian. Fish Shellfish Immunol. 51, 365–372. Giri, S.S., Sen, S.S., Chi, C., Kim, H.J., Yun, S., Park, S.C., Sukumaran, V., 2015. Chlorophytum borivilianum polysaccharide fraction provokes the immune function and disease resistance of labeo rohita against aeromonas hydrophila. J Immunol Res 20, 11–15. Gou, C., Wang, J., Wang, Y., Dong, W., Shan, X., Lou, Y., Gao, Y., 2018. Hericium caputmedusae (bull.:fr.) pers. polysaccharide enhance innate immune response, immunerelated genes expression and disease resistance against aeromonas hydrophila in grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 72, 604–613. Goya, L., Sarriá, B., Ramos, S., Mateos, R., Bravo, L., 2016. Effect of cocoa and its flavonoids on biomarkers of inflammation: studies of cell culture, animals and humans. Nutrients. 8, 2–12. Han, T., Li, X.Y., Wang, J., 2018. Effects of dietary astaxanthin (AX) supplementation on pigmentation, antioxidant capacity and nutritional value of swimming crab, Portunus trituberculatus. Aquaculture. 490, 169–177. Ichiki, S., Kato-Unoki, Y., Somamoto, T., Nakao, M., 2012. The binding spectra of carp C3 isotypes against natural targets independent of the binding specificity of their thioester. Dev. Comp. Immunol. 38, 10–16. Ioanna, P., Lien, D., Marlies, B., 2016. The interactome of the glucocorticoid receptor and its influence on the actions of glucocorticoids in combatting inflammatory and infectious diseases. Microbiol. Mol. Biol. Rev. 80, 495–522. Jagruthi, C., Yogeshwari, G., Anbazahan, S.M., Mari, L.S., Arockiaraj, J., Mariappan, P., Sudhakar, G.R., Balasundaram, C., Harikrishnan, R., 2014. Effect of dietary astaxanthin against Aeromonas hydrophila infection in common carp, Cyprinus carpio. Fish Shellfish Immunol. 41, 674–680. Jiang, J., Yin, L., Li, J.Y., Li, Q., Shi, D., Feng, L., 2017. Glutamate attenuates lipopolysaccharide-induced oxidative damage and mrna expression changes of tight junction and defensin proteins, inflammatory and apoptosis response signaling molecules in the intestine of fish. Fish Shellfish Immunol. 70, 473–484. Li, M.Y., Zhu, X.M., Niu, X.T., Chen, X.M., 2019a. Effects of dietary Allium mongolicum Regel polysaccharide on growth, lipopolysaccharide-induced antioxidant responses and immune responses in Channa argus. Mol. Biol. Rep. 46, 2221–2230. Li, M., Zhu, X., Tian, J., Liu, M., 2019b. Bioaccumulation, oxidative stress, immune responses and immune-related genes expression in northern snakehead fish, Channa argus, exposure to waterborne selenium. Mol. Biol. Rep. 46, 947–955. Li, M.Y., Sun, L., Niu, X.T., Tian, J.X., Chen, X.M., 2019c. Astaxanthin protects
8
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aquaculture
Effects of dietary astaxanthin on lipopolysaccharide-induced oxidative stress, immune responses and glucocorticoid receptor (GR)-related gene expression in Channa argus
T
Mu-Yang Lia,c,d, Wan-Qing Guob, Gui-Liang Guob, Xin-Ming Zhua,c,d, Xiao-Tian Niua,c,d, ⁎ ⁎ Xiao-Feng Shana,c,d, Jia-Xin Tiana,c,d, Gui-Qin Wanga,c,d, , Dong-Ming Zhanga,c,d, a
College of Animal Science and Technology, Jilin Agricultural University, Changchun, Jilin 130118, China Testing Center of Quality and Safety in Aquatic Product, Changchun, Jilin 130000, China Jilin Provincial Key Laboratory of Animal Nutrition and Feed Science, Jilin Agricultural University, Changchun, Jilin 130118, China d Ministry of Education Laboratory of Animal Production and Quality Security, Jilin Agricultural University, Changchun, Jilin 130118, China b c
A R T I C LE I N FO
A B S T R A C T
Keywords: Astaxanthin Oxidative stress Immune response Channa argus
The present study was conducted to evaluate the effects of dietary astaxanthin (AX) supplementation on lipopolysaccharide (LPS)-induced oxidative stress, immune responses and glucocorticoid receptor (GR)-related gene expression in Channa argus. A basal diet was supplemented with AX at 0, 50, 100 and 200 mg/kg feed for 56 days. The results showed that after LPS challenge, superoxide dismutase (SOD), catalase (CAT), glutathione-Stransferase (GST), glutathione peroxidase (GPx), glutathione reductase (GSH-Rt), lysozyme (LZM), complement 3 (C3), complement 4 (C4) were significantly reduced (P < .05), while malondialdehyde (MDA), interleukin-1β (IL-1β) and tumour necrosis factor-α (TNF-α) levels were significantly increased (P < .05) in liver, spleen, kidney and intestine. Dietary AX supplementation could alleviate LPS induced above changes in C. argus. Dietary AX supplementation significantly increased (P < .05) gene expression levels including heat shock protein 70 (HSP70), heat shock protein 90 (HSP90) and glucocorticoid receptor (GR) after LPS challenge. The protective effects of AX on LPS-induced oxidative damage is associated with promoting the levels of antioxidant enzymes and immune parameters. In addition, AX can attenuate LPS-induced inflammation response by up-regulating GRrelated gene expression in C. argus.
1. Introduction Fish are usually exposed to a variety of stressors (e.g., crowding, capture, invasion of bacteria and viruses) (Zhou et al., 2015a). When fish are subjected to adverse stressors, often resulting in changes of some endocrine and physiological parameters in the tissue of fish (Chen et al., 2016). Bacteria and viruses are generally considered to be one of the most common stressors in fish farming. Lipopolysaccharide (LPS), a bacterial endotoxin, is often associated with oxidative stress, immune responses and disease processes (Jiang et al., 2017). Previous study has revealed that LPS could induce oxidative stress and inflammation, decrease antioxidant enzymes levels and increase inflammatory cytokines levels (Li et al., 2019a). Oxidative stress can cause metabolic and immunological changes, eventually increasing the susceptibility of this fish to various pathogens (Li et al., 2019b). In addition, previous study also reported that oxidative stress and inflammation are closely linked
⁎
(Jiang et al., 2017). Previous study also showed that LPS-induced inflammatory responses are associated with activation of the NF-κB signaling pathways (Li et al., 2019c). The molecular mechanism of NF-κB signaling pathway inhibition is closely related to the interaction of glucocorticoid receptors (GR) and NF-κB (Ioanna et al., 2016). Astaxanthin (AX), an orange-reddish carotenoid pigment, plays an important role in antioxidant, anti-inflammatory, immunity enhancing and growth promoting (Jagruthi et al., 2014). It can naturally synthesize in some bacteria, microalgae, Haematococcus pluvialis and phaffia rhodozyma, which have wide variety of sources, biodegradable, no drug resistance and environment friendly (Liu et al., 2016; Wang et al., 2018). Previous research has showed that dietary AX could improve immune response, disease resistance, and growth performance of Cyprinus carpio (Jagruthi et al., 2014). Han et al. (2018) found that dietary AX can reduce oxidative stress and increase whole body n-3HUFA concentrations for juvenile Portunus trituberculatus (Han et al., 2018).
Corresponding authors at: College of Animal Science and Technology, Jilin Agricultural University, Changchun, Jilin 130118, China. E-mail address: [email protected] (G.-Q. Wang).
https://doi.org/10.1016/j.aquaculture.2019.734816 Received 21 April 2019; Received in revised form 29 November 2019; Accepted 2 December 2019 Available online 03 December 2019 0044-8486/ © 2019 Elsevier B.V. All rights reserved.
Aquaculture 517 (2020) 734816
M.-Y. Li, et al.
Channa argus is an economically important fish species in China (Sagada et al., 2017). In recent decades, there have been increasing reports of aquatic animal diseases caused by stress, which results in substantial economic loss (Zhou et al., 2015a; Chen et al., 2016). Various immunostimulants (i.g., probiotic, vitamin E, emodin, medicinal plant polysaccharide and plant flavonoids) have been used as feed additives, and their immune-promoting effects on stress resistance have been documented (Chen et al., 2004; Liu et al., 2016; Gou et al., 2018; Li et al., 2019d; Li et al., 2019f). In previous study, we evaluated the effect of different dietary AX levels on hematology parameters, serum antioxidant activity, serum immune responses and disease resistance against Aeromonas hydrophila of C. argus (Li et al., 2019e). Our results demonstrated that AX administration promoted antioxidant and immune response and disease resistance (Li et al., 2019e). Meanwhile, our results indicated that pretreatment with AX develops a potent protective effect on LPS-induced inflammatory response which may be associated with its inhibition of NF-κB and MAPKs signaling pathways activation (Li et al., 2019c). Taken together, this study expands on our previous report. Thus, the aim of the present study was to investigate the effects of dietary AX on LPS-induced oxidative stress, immune responses and GR-related gene expression in C. argus.
by the Ethics Committee of Jilin Agricultural University with ID no. 20121008. 2.3. LPS challenge experiment and sample collection After the 56 days, thirty fish from each group were weighed and subjected to the LPS challenge. Fish were injected intraperitoneally with LPS (4 mg/kg of fish) or sterile PBS, according to the methods described in our previous study. Hence, there were three different pretreatment/challenge groups, Ctrl/PBS, Ctrl/LPS, and AX/LPS. After the challenge trial, ten fish were randomly netted from each group and anaesthetized with buffered MS-222 (300 mg/L, Sigma–Aldrich, USA). All of the fish were dissected for the sampling of liver, spleen, kidney and intestine. All tissues were flash-frozen in liquid nitrogen and stored at −80 °C until analyzed. 2.4. Analysis and measurement 2.4.1. Antioxidant parameters The liver, spleen, kidney and intestine were used to analyze the antioxidant parameters. Superoxide dismutase (SOD), catalase (CAT), glutathione-S-transferase (GST), glutathione peroxidase (GPx) activity, glutathione reductase (GSH-Rt) activity and malondialdehyde (MDA) content were measured according to the method described by Xu et al. (Xu et al., 2016) and Li et al. (Li et al., 2019a).
2. Materials and methods 2.1. Experimental diet
2.4.2. Immunological parameters Immunological parameters in liver, spleen, kidney and intestine were measured. Lysozyme (LZM), complement 3 (C3) and complement 4 (C4) were measured according to the method described by Xu et al. (Xu et al., 2016). Interleukin-1β (IL-1β) and tumour necrosis factor-α (TNF-α) levels were determined according to the method described by our previous study (Li et al., 2019a) using a commercially available ELISA kit (Nanjing Jiancheng Bioengineering Institute, China). The minimum detectability of IL-1β and TNF-α was 1.0 ng/g protein. The results for IL-1β and TNF-α are expressed as ng/g protein.
The formulation and nutrient content of the basal diet is shown in Table 1. The AX, ≥ 98% (HPLC, Yuanye Biotechnology, Shanghai, China) were sprayed into the basal diet slowly at four levels: 0, 50, 100 and 200 mg/kg. The diet was uniformly mixed in a micromixer at room temperature, and dried under aseptic conditions, pelleted and stored at −4 °C until used. 2.2. Experimental fish and design We obtained healthy C. argus that were of similar size (23.40 ± 0.53 g) from a commercial hatchery (Huzhou, China). The fish were placed in 300 L glass aquarium with aerated filtered dechlorinated water and were acclimated for 14 days. Following acclimation, 400C. argus were randomly divided into four groups (5 tanks per group, 20 fish per tank). The water temperature and pH were 26 ± 1 °C and 7.1 ± 0.1, respectively. The experimental units were under a natural light and dark cycle (approximately 13:11 h light: dark). All fish were fed two times (08:00 and 16:00) a day at a rate of 3–4% of the wet body weight. Half of the water in each tank was changed every two days. All of the experimental fish used in the study were used in accordance with the NIH Guide for the Care and approved
2.4.3. Real-time PCR analysis The genes (HSP70, HSP90 and GR) expression in liver, spleen, kidney and intestine determined by real-time quantitative PCR. Total RNA samples were extracted using RNAiso Plus (Takara, Dalian, China). The quality and concentration of RNA were analyzed by using NanoDrop 2000 spectrophotometry (Thermo scientific, USA). Reverse transcription of RNA into cDNA and use reverse transcriptase synthesis kit (Takara, Dalian, China). We used real-time PCR to determine gene expression levels SYBR with Premix Ex TaqTM П kit (Takara, Dalian, China). The primer sequences indicated in Table 2. PCR reaction mixtures included SYBR qPCR Mix (10 μL), forward and reverse primer Table 2 Primer sequences and annealing temperatures for polymerase chain reactions.
Table 1 Formulation and nutrient content of the basal diet. Ingredients (%)
Nutrient content (% or kJ/g)
Fish meal
38.7
Crude protein
48.1
Soybean meal Poultry meal Gluten Spraying blood meal Peanut meal Flour Fish oil Squid offal Monocalcium phosphate Vitamin premix Mineral mixture Zeolite
4 12.9 5 5 3 17.5 5.9 1 1.5 1.5 1 3
crude lipid ash carbohydrate gross energy
11.3 12.3 20.1 19.3
Name
Sequence (5′-3′)
Annealing temp. (°C)
GenBank ID/ Reference
GR-F
GGGAAAGACCAGGACTCATA
60
Li et al. (2019)a
GR-R HSP90-F HSP90-R HSP70-F HSP70-R β-actin-F β-actin-R
TTCTTGGTTTTCCGTGCTTC TGTATGTCAGGAGGGTGTTT TAGATTGATTTCTGGTTTTC ATTTTGAATGTGTCTGCGGT ACTTGCTGATGATGGGGTTA CACTGTGCCCATCTACGAG CCATCTCCTGCTCGAAGTC
55
Li et al. (2019)a
56
Li et al. (2019)a
57
Li et al. (2019)a
a Li, M., Zhu, X., Tian, J., Liu, M., 2019d. Dietary flavonoids from Allium mongolicum Regel promotes growth, improves immune, antioxidant status, immune-related signaling molecules and disease resistance in juvenile northern snakehead fish (Channa argus). Aquaculture. 501, 473–481.
2
Aquaculture 517 (2020) 734816
M.-Y. Li, et al.
Fig. 1. Superoxide dismutase (SOD) (A), catalase (CAT) (B) and malondialdehyde (MDA) (C), in liver, spleen, kidney and intestine of Channa argus fed diets containing different astaxanthin levels followed by LPS challenge. Data are expressed as the mean ± S.D. (n = 5). Values with different superscripts are significantly difference (P < .05) as determined by the Tukey's test.
(10 mM, 1 μL), cDNA (1 μL), DEPC-treated water (7 μL). The reaction conditions were as follows 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, anneal for 30 s and 72 °C for 30 s. The levels of gene expression were calculated using the 2 −ΔΔCt method and normalized using β-actin expression (Li et al., 2019a).
were conducted using SPSS statistics 20.0 software (IBM, USA).
2.5. Statistical analysis
Antioxidant parameters of liver, spleen, kidney and intestine were shown in Fig. 1 and Fig. 2. LPS challenge significantly increased the concentrations of MDA (P < .05) in the liver, spleen, kidney and intestine. However, AX/LPS groups significantly decreased MDA level compared with Ctrl/LPS group (P < .05) in the liver, spleen, kidney and intestine.
3. Result 3.1. Antioxidant status
The results are presented as mean ± S.D. The data were analyzed with one-way analysis of variance (ANOVA) to determine the significant differences. Tukey's multiple range test was used to compare the mean values (P < .05) to indicate significant differences. Analysis 3
Aquaculture 517 (2020) 734816
M.-Y. Li, et al.
Fig. 2. Glutathione-S-transferase (GST) (A), glutathione peroxidase (GPx) (B) and glutathione reductase (GSH-Rt) (C), in liver, spleen, kidney and intestine of Channa argus fed diets containing different astaxanthin levels followed by LPS challenge. Data are expressed as the mean ± S.D. (n = 5). Values with different superscripts are significantly difference (P < .05) as determined by the Tukey's test.
Compared with the Ctrl/PBS group, Ctrl/LPS group significantly decreased CAT, SOD, GST, GPx and GSH-Rt levels in the liver, spleen, kidney and intestine (P < .05). However, AX/LPS groups significantly increased CAT, SOD, GST, GPx and GSH-Rt levels compared with Ctrl/ LPS group (P < .05) in the liver, spleen, kidney and intestine.
and C4 compared with those in the Ctrl/LPS group (P < .05). Compared with the Ctrl/PBS group, Ctrl/LPS group significantly increased TNF-α and IL-1β levels in the liver, spleen, kidney and intestine (P < .05). However, AX/LPS groups significantly decreased TNF-α and IL-1β levels compared with Ctrl/LPS group (P < .05).
3.2. Immune response
3.3. Real-time PCR analysis
Immune parameters of liver, spleen, kidney and intestine were shown in Figs. 3 and 4. LPS challenge significantly decreased LZM, C3 and C4 levels in the liver, spleen, kidney and intestine (P < .05). However, AX/LPS group significantly increased the levels of LZM, C3
The HSP70, HSP90 and GR gene expression in liver, spleen, kidney and intestine are displayed in Fig. 5. LPS challenge did not significantly decreased or increased HSP70, HSP90 and GR gene expression levels in liver, spleen, kidney and intestine. However, AX/LPS groups 4
Aquaculture 517 (2020) 734816
M.-Y. Li, et al.
Fig. 3. Lysozyme (LZM) (A), complement 3 (C3) (B) and complement 4 (C4) (C) in liver, spleen, kidney and intestine of Channa argus fed diets containing different astaxanthin levels followed by LPS challenge. Data are expressed as the mean ± S.D. (n = 5). Values with different superscripts are significantly difference (P < .05) as determined by the Tukey's test.
stress and inflammatory response in C. argus (Li et al., 2019a; Li et al., 2019c). In this study, we assessed the effects of AX on LPS-induced oxidative stress, immune responses and GR-related gene expression in C. argus. Jiang et al. (2017) reported that LPS-induced excessive formation of ROS could trigger and accelerate oxidative stress in fish (Jiang et al., 2017). As a reliable indicator of oxidative stress, MDA was applied to reflect the level of cellular injures resulting from ROS (Liang et al., 2018). Therefore, the inhibition of MDA can be a potential intervention approach for oxidative stress. In this study, AX treatment groups significantly decreased the MDA concentration in liver, spleen, kidney and
significantly increased HSP70, HSP90 and GR gene expression levels (P < .05) in liver, spleen, kidney and intestine. 4. Discussion In recent decades, intensive aquaculture activity has generated a range of environmental stressors (Giri et al., 2015). In response to various stressors, organisms (such as fish, shrimp, shellfish, etc.) can trigger a variety of physiological and biochemical response, which involves antioxidant, immune and inflammatory responses (Liu et al., 2010). Our previous study has also shown that LPS can trigger oxidative 5
Aquaculture 517 (2020) 734816
M.-Y. Li, et al.
Fig. 4. Interleukin-1β (IL-1β) (A) and tumour necrosis factor-α (TNF-α) (B) in liver, spleen, kidney and intestine of Channa argus fed diets containing different astaxanthin levels followed by LPS challenge. Data are expressed as the mean ± S.D. (n = 5). Values with different superscripts are significantly difference (P < .05) as determined by the Tukey's test.
and intestine after LPS challenge. Similarly, dietary supplement with Allium mongolicum Regel polysaccharide increased C3, C4 and LZM levels after LPS challenge in C. argus (Li et al., 2019a). Dietary soybean isoflavones also increased C3, C4 and LZM levels in Trachinotus ovatus after pH stress (Zhou et al., 2015b). Short-lived increases in complements and LZM levels are usually beneficial to fish (Yang et al., 2015; Li et al., 2019d). This indicated that AX might enhance the immune ability of C. argus to some degree. IL-1β and TNF-α are two powerful pro-inflammatory cytokines, originating from leucocytes, macrophages, monocytes and granulocytes (Zhang et al., 2017; Li et al., 2019a). LPS is considered a general immunostimulatory component that triggers host defence responses by promoting inflammatory cytokines and the functions of head kidney macrophages (Li et al., 2019a). Jiang et al. (2017) reported that LPS challenge could up-regulate gene expression of IL-1β and TNF-α in Jian carp (Jiang et al., 2017). Our previous study demonstrated AX treatment groups significantly prevented the LPS-induced upregulation of pro-inflammatory cytokines TNF-α, IL-6 and IL-1β (Li et al., 2019c). In this study, LPS challenge significantly increased IL-1β and TNF-α contents, indicating that LPS induced the cellular inflammatory response. However, AX treatment groups significantly decreased IL-1β and TNF-α levels to attenuate the LPS-induced inflammatory response. Previous study demonstrated AX protects LPS-induced inflammatory response in C. argus through inhibiting NF-κB and MAPKs
intestine after LPS challenge. In line with our results, Han et al. (2018) demonstrated that dietary supplement AX enhanced CAT and SOD levels while reduced MDA levels in swimming crab Portunus trituberculatus (Han et al., 2018). CAT, SOD, GST, GPx and GSH-Rt, endogenous antioxidative molecules, play a major role in scavenging harmful reactive oxygen derivatives and counteracting oxygen toxicity (Valbona et al., 2018; Ming et al., 2019). Jiang et al. (2017) demonstrated LPS significantly decreased anti-oxidative enzymes activities, including CAT, SOD, GST, GPx and GSH-Rt in Jian carp (Jiang et al., 2017). The findings of the present study demonstrated that AX treatment groups significantly increased the levels of CAT, SOD, GST, GPx and GSH-Rt in liver, spleen, kidney and intestine after LPS challenge. As important antioxidative enzymes, CAT, SOD, GST, GPx and GSH-Rt are widely distributed in fish tissue and cells. Consequently, the promotion of antioxidative enzymes may contribute to reduce oxidative stress of C. argus. Complements are crucial components of innate immune system and play an essential role in protecting the health of fish (Ichiki et al., 2012; Ming et al., 2019). As an important component of nonspecific immune system, LZM play an important role in scavenging invasive pathogens and bacteria (Magnadóttir, 2006). Our previous study demonstrated LPS significantly decreased immune parameter, including C3, C4 and LZM in C. argus (Li et al., 2019a). In this study, AX treatment groups significantly increased C3, C4 and LZM levels in liver, spleen, kidney 6
Aquaculture 517 (2020) 734816
M.-Y. Li, et al.
Fig. 5. Relative expression (GR (A), HSP70 (B) and HSP90 (C)) in liver, spleen, kidney and intestine of Channa argus fed diets containing different astaxanthin levels followed by LPS challenge. Data are expressed as the mean ± S.D. (n = 5). Values with different superscripts are significantly difference (P < .05) as determined by the Tukey's test.
HSP70 and HSP90 are important chaperone proteins, which play a key role in the folding of newly synthesized and formation of GR protein complexes (Liu et al., 2012; Roberts et al., 2010; Tsurufuji et al., 1979). Our previous study also shown that AX could up-regulate the expression of GR, HSP70 and HSP90 (Li et al., 2019e). Taken together, these results indicate that AX may protect against LPS-induced inflammatory responses by up-regulating GR-related gene expression. In conclusion, the present study indicated that LPS challenge can induce oxidative stress, inflammation response and impaired immune response. Dietary AX supplementation could alleviate LPS induced
signaling pathways (Li et al., 2019c). NF-κB and MAPKs are important transcription factors, which play an important role in regulating the gene expression of inflammatory cytokines (Li et al., 2019c; Goya et al., 2016). In addition, study has shown that the molecular mechanism of NF-κB and MAPKs signaling pathway inhibition are closely related to the interaction of NF-κB, MAPKs and GR (Ioanna et al., 2016). To further characterize the mechanism of the inhibitory effect of AX on proinflammatory cytokines, we investigated the effect of AX on the GRrelated gene expression. In this study, AX treatment groups significantly up-regulated expression of GR, HSP70 and HSP90 after LPS challenge.
7
Aquaculture 517 (2020) 734816
M.-Y. Li, et al.
above changes in C. argus. The protective effects of AX on LPS-induced oxidative damage is associated with promoting the levels of antioxidant enzymes and immune parameters. In addition, AX can attenuate LPSinduced inflammation response by up-regulating GR-related gene expression in C. argus.
lipopolysaccharide-induced inflammatory response in Channa argus through inhibiting NF-κB and MAPKs signaling pathways. Fish Shellfish Immunol. 86, 280–286. Li, M., Zhu, X., Tian, J., Liu, M., 2019d. Dietary flavonoids from Allium mongolicum Regel promotes growth, improves immune, antioxidant status, immune-related signaling molecules and disease resistance in juvenile northern snakehead fish (Channa argus). Aquaculture. 501, 473–481. Li, M.Y., Liu, X.Y., Xia, C.G., Wang, G.Q., 2019e. Astaxanthin enhances hematology, antioxidant and immunological parameters, immune-related gene expression, and disease resistance against in Channa argus. Aquac. Int. 7, 42–49. Li, M.Y., Guo, W.Q., Guo, G.L., 2019f. Effect of sub-chronic exposure to selenium and Allium mongolicum regel flavonoids on Channa argus: bioaccumulation, oxidative stress, immune responses and immune-related signaling molecules. Fish Shellfish Immunol. 91, 122–129. Liang, X., Zhang, Jun, Guo, F., Wei, L., 2018. Oxidative stress and inflammatory responses in the liver of swamp eel (Monopterus albus) exposed to carbon tetrachloride. Aquaculture. 496, 232–238. Liu, B., Xie, J., Ge, X., Xu, P., Wang, A., He, Y., 2010. Effects of anthraquinone extract from rheum officinale bail on the growth performance and physiological responses of macrobrachium rosenbergii under high temperature stress. Fish Shellfish Immunol. 29, 49–57. Liu, B., Ge, X., Xie, J., Xu, P., He, Y., Cui, Y., Ming, J., Zhou, Q., Pan, L., 2012. Effects of anthraquinone extract from Rheum officinale bail on the physiological responses and HSP70 gene expression of Megalobrama amblycephala under Aeromonas hydrophila infection. Fish Shellfish Immunol. 32, 1–7. Liu, F., Shi, H.Z., Guo, Q.S., Yu, Y.B., Wang, A.M., Lv, F., Shen, W.B., 2016. Effects of astaxanthin and emodin on the growth, stress resistance and disease resistance of yellow catfish (Pelteobagrus fulvidraco). Fish Shellfish Immunol. 51, 125–135. Magnadóttir, B., 2006. Innate immunity of fish (overview). Fish Shellfish Immunol. 20, 137–144. Ming, J., Ye, J., Zhang, Y., Yang, X., 2019. Dietary optimal reduced glutathione improves innate immunity, oxidative stress resistance and detoxification function of grass carp (Ctenopharyngodon idella) against microcystin-LR. Aquaculture. 498, 594–605. Roberts, R.J., Agius, C., Saliba, C., Bossier, P., Sung, Y.Y., 2010. Heat shock proteins (chaperones) in fish and shellfish and their potential role in relation to fish health: a review. J. Fish Dis. 33, 789–801. Sagada, G., Chen, J., Shen, B., Huang, A., Sun, L., Jiang, J., Jin, C., 2017. Optimizing protein and lipid levels in practical diet for juvenile northern snakehead fish (Channa argus). Animal Nutrition 3, 156–163. Tsurufuji, S., Sugio, K., Takemasa, F., 1979. The role of glucocorticoid receptor and gene expression in the anti-inflammatory action of dexamethasone. Nature 280, 408–419. Valbona, A., Mihallaq, Q., Eldores, S., Valon, M., Caterina, F., 2018. Antioxidant defense system, immune response and erythron profile modulation in gold fish, Carassius auratus, after acute manganese treatment. Fish Shellfish Immunol. 76, 75–83. Wang, Z., Cai, C.F., Cao, X.M., 2018. Supplementation of dietary astaxanthin alleviated oxidative damage induced by chronic high pH stress, and enhanced carapace astaxanthin concentration of Chinese mitten crab Eriocheir sinensis. Aquaculture. 35, 483–492. Xu, H.J., Jiang, W.D., Feng, L., Liu, Y., 2016. Dietary vitamin C deficiency depresses the growth, head kidney and spleen immunity and structural integrity by regulating NFk B, TOR, Nrf2, apoptosis and MLCK signaling in young grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 52, 111–138. Yang, X., Guo, J.L., Ye, J.Y., Zhang, Y.X., Wang, W., 2015. The effects of ficus carica polysaccharide on immune response and expression of some immune-related genes in grass carp, ctenopharyngodon idella. Fish Shellfish Immunol. 42 (1), 132–137. Zhang, C.N., Zhang, J.L., Ren, H.T., Zhou, B.H., Wu, Q.J., Sun, P., 2017. Effect of tributyltin on antioxidant ability and immune responses of zebrafish ( Danio rerio ). Ecotoxicol. Environ. Saf. 138 (1–8). Zhou, C., Lin, H., Ge, X., Niu, J., Wang, J., Wang, Y., Chen, L., Huang, Z., Yu, W., Tan, X., 2015a. The effects of dietary soybean isoflavones on growth, innate immune responses, hepatic antioxidant abilities and disease resistance of juvenile golden pompano Trachinotus ovatus. Fish Shellfish Immunol. 43, 158–166. Zhou, C., Lin, H., Huang, Z., Wang, J., Wang, Y., Yu, W., 2015b. Effects of dietary soybean isoflavones on non-specific immune responses and hepatic antioxidant abilities and mRNA expression of two heat shock proteins (HSPs) in juvenile golden pompano Trachinotus ovatus under pH stress. Fish Shellfish Immunol. 47, 1043–1053.
Declaration of Competing Interest The authors declare that they have no conflict of interest. Acknowledgments The research was supported by the earmarked fund for Modern Agro-industry Technology Research System (CARS-46) and National Natural Science Foundation of China (NO.31372540). References Chen, R., Lochmann, R., Goodwin, A., 2004. Effects of dietary vitamins C and E on alternative complement activity, hematology, tissue composition, vitamin concentrations and response to heat stress in juvenile golden shiner (Notemigonus crysoleucas). Aquaculture 242, 553–569. Chen, X.M., Guo, G.L., Sun, L., Yang, Q.S., Wang, G.Q., Qin, G.X., 2016. Effects of ala-gln feeding strategies on growth, metabolism, and crowding stress resistance of juvenile cyprinus carpio var. jian. Fish Shellfish Immunol. 51, 365–372. Giri, S.S., Sen, S.S., Chi, C., Kim, H.J., Yun, S., Park, S.C., Sukumaran, V., 2015. Chlorophytum borivilianum polysaccharide fraction provokes the immune function and disease resistance of labeo rohita against aeromonas hydrophila. J Immunol Res 20, 11–15. Gou, C., Wang, J., Wang, Y., Dong, W., Shan, X., Lou, Y., Gao, Y., 2018. Hericium caputmedusae (bull.:fr.) pers. polysaccharide enhance innate immune response, immunerelated genes expression and disease resistance against aeromonas hydrophila in grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 72, 604–613. Goya, L., Sarriá, B., Ramos, S., Mateos, R., Bravo, L., 2016. Effect of cocoa and its flavonoids on biomarkers of inflammation: studies of cell culture, animals and humans. Nutrients. 8, 2–12. Han, T., Li, X.Y., Wang, J., 2018. Effects of dietary astaxanthin (AX) supplementation on pigmentation, antioxidant capacity and nutritional value of swimming crab, Portunus trituberculatus. Aquaculture. 490, 169–177. Ichiki, S., Kato-Unoki, Y., Somamoto, T., Nakao, M., 2012. The binding spectra of carp C3 isotypes against natural targets independent of the binding specificity of their thioester. Dev. Comp. Immunol. 38, 10–16. Ioanna, P., Lien, D., Marlies, B., 2016. The interactome of the glucocorticoid receptor and its influence on the actions of glucocorticoids in combatting inflammatory and infectious diseases. Microbiol. Mol. Biol. Rev. 80, 495–522. Jagruthi, C., Yogeshwari, G., Anbazahan, S.M., Mari, L.S., Arockiaraj, J., Mariappan, P., Sudhakar, G.R., Balasundaram, C., Harikrishnan, R., 2014. Effect of dietary astaxanthin against Aeromonas hydrophila infection in common carp, Cyprinus carpio. Fish Shellfish Immunol. 41, 674–680. Jiang, J., Yin, L., Li, J.Y., Li, Q., Shi, D., Feng, L., 2017. Glutamate attenuates lipopolysaccharide-induced oxidative damage and mrna expression changes of tight junction and defensin proteins, inflammatory and apoptosis response signaling molecules in the intestine of fish. Fish Shellfish Immunol. 70, 473–484. Li, M.Y., Zhu, X.M., Niu, X.T., Chen, X.M., 2019a. Effects of dietary Allium mongolicum Regel polysaccharide on growth, lipopolysaccharide-induced antioxidant responses and immune responses in Channa argus. Mol. Biol. Rep. 46, 2221–2230. Li, M., Zhu, X., Tian, J., Liu, M., 2019b. Bioaccumulation, oxidative stress, immune responses and immune-related genes expression in northern snakehead fish, Channa argus, exposure to waterborne selenium. Mol. Biol. Rep. 46, 947–955. Li, M.Y., Sun, L., Niu, X.T., Tian, J.X., Chen, X.M., 2019c. Astaxanthin protects
8