Effects of replacing fishmeal protein with poultry by-product meal protein and soybean meal protein on growth, feed intake, feed utilization, gut and liver histology of hybrid grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂) juveniles

Aquaculture 516 (2020) 734503

Contents lists available at ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aquaculture

Effects of replacing fishmeal protein with poultry by-product meal protein and soybean meal protein on growth, feed intake, feed utilization, gut and liver histology of hybrid grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂) juveniles

T

Zhiyu Zhoua,b, Wei Yaoa,b,c, Bo Yea,b, Xiaoyi Wua,b, , Xiaojun Lia,b, Yu Donga,b ⁎

a b c

State Key Laboratory of Marine Resource Utilization in South China Sea, Hainan University, Haikou 570228, China Hainan Provincial Key Laboratory for Tropical Hydrobiology and Biotechnology, Department of Aquaculture, Hainan University, Haikou, Hainan 570228, China JiangXi Green Ecology Puerariae Research Institute, Shangrao 334300, China

ARTICLE INFO

ABSTRACT

Keywords: Epinephelus fuscoguttatus × Epinephelus lanceolatus Growth Fishmeal Poultry by-product meal Soybean meal

Two consecutive eight-week growth trials were undertaken to evaluate the effects of replacing fishmeal protein (FMP) with poultry by-product meal protein (PBMP) and soybean meal protein (SBMP) on growth, feed intake, feed utilization, gut and liver histology of hybrid grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂) juveniles. In trial 1, eight isoenergetic (340 kcal per 100 g dry matter) and isoproteic (53.5% of dry matter) experimental diets were formulated to replace 0%, 10%, 20%, 30%, 40%, 50%, 60% and 70% FMP with PBMP, being abbreviated as FMP, PBMP10, PBMP20, PBMP30, PBMP40, PBMP50, PBMP60 and PBMP70, respectively. Based on the results of trial 1, another six isoenergetic (340 kcal per 100 g dry matter) and isoproteic (53.5% of dry matter) experimental diets including a high FM (86.64%) diet (FMP) and five low-FM (25.99%) diets were formulated in trial 2, and in the low-FM diets, 0%, 7%, 14%, 21% and 21% PBMP was replaced with SBMP, being abbreviated as PBMP, SBMP7, SBMP14, SBMP21, SBMP28, respectively. The initial average body weights of experimental fish were 6.0 ± 0.05 g in trial 1 and 6.8 ± 0.08 g in trial 2 (means ± S.D.), and fish were fed their described diets by hand to apparent satiation twice daily (08:00 and 16:30) at a density of 30 fish/cage (trial 1) or 15 fish/cage (trial 2). Experimental cages were labeled and located in connective 6-m3 indoor concrete tanks (L 3 m × W 2 m × H 1 m) with 3 cages occurring in each tank. Each treatment had three replicates both in trial 1 and in trial 2. Results showed that in trial 1, weight gain% (WG%), daily feed intake (DFI), feed conversion ratio (FCR), protein efficiency ratio (PER) as well as protein productive value (PPV) were not significantly affected by different FMP replacements with PBMP. Fish fed FMP, PBMP10 and PBMP20 had higher hepatosomatic index (HSI) and condition factor (CF) than fish fed PBMP30, PBMP40, PBMP50, PBMP60 and PBMP70, and intraperitoneal fat (IPF) ratio was increased as dietary PBM inclusion levels increased. Whole-body and muscle lipid contents of fish were elevated by the increments in PBM. High FMP replacements (50%–70%) by PBMP induced steatosis in hepatocytes. Different replacements of FMP by PBMP had no significant effects on gut morphology of experimental fish. In trial 2, there were also no remarkable variations in WG%, DFI, FCR and PER among various experimental treatments. Fish fed SBMP7, SBMP14, SBMP21 and SBMP28 showed similar fold height (hF), enterocyte height (hE) as well as microvilli height (hMV) in foregut and hF, hE in midgut in comparison to fish fed PBMP or the high FM, but for midgut hMV and hindgut hF, hE, hMV, fish fed the low-FM diets (PBMP, SBMP7, SBMP14, SBMP21 and SBMP28) displayed lower values of these parameters than fish fed the high-FM diet. Swelling in hepatocytes was observed in fish fed SBMP14, SBMP21 and SBMP28. Generally, replacing 70% FM protein or reducing the FM inclusion level to about 26% with PBMP or the combination of PBMP and SBMP at the 53.5% dietary crude protein level did not negatively affect growth, feed intake as well as feed utilization of hybrid grouper, but liver health and gut morphology of fish fed low FM diets need to be further focused on.

⁎

Corresponding author at: State Key Laboratory of Marine Resource Utilization in South China Sea, Hainan University, Haikou 570228, China. E-mail address: [email protected] (X. Wu).

https://doi.org/10.1016/j.aquaculture.2019.734503 Received 14 June 2019; Received in revised form 10 September 2019; Accepted 10 September 2019 Available online 13 September 2019 0044-8486/ © 2019 Elsevier B.V. All rights reserved.

Aquaculture 516 (2020) 734503

Z. Zhou, et al.

1. Introduction

amino acids composition of experimental diets in trial 1 was shown in Table 2. Based on the results of trial 1, another six isoenergetic (340 kcal per 100 g dry matter) and isoproteic (53.5% of dry matter) experimental diets including a high FM (86.64%) diet (FMP) and five low-FM (25.99%) diets were formulated in trial 2 (Table 3), and in the low-FM diets, 0%, 7%, 14%, 21% and 21% PBMP was replaced by SBMP, being abbreviated as PBMP, SBMP7, SBMP14, SBMP21, SBMP28, respectively. The analyzed amino acids composition of experimental diets in trial 2 was shown in Table 4. The crude protein level and estimated digestible energy value were selected for experimental diets of this study as a result of our previous findings (Jiang et al., 2015; Jiang et al., 2016). All dry ingredients were carefully weighed, and mixed in a Hobart mixer (A-200 T Mixer Bench Model unit, Resell Food Equipment Ltd., Ottawa, Canada) for 30 min. Fish oil was then gradually added and mixed constantly. Subsequently, deionized water (30%–50% dry ingredient mixture) was added, resulting in suitably textured dough. The diets were formed into a noodle-like shape of 3-mm diameter using a twin-screw meat grinder (Institute of Chemical Engineering, South China University of Technology, Guangzhou, PR China). All diets were air-dried at 25 °C for 24 h, sieved and then packaged and stored frozen (−20 °C). The analyzed crude protein content in diets of trial 1 was 53.1%, 53.1%, 53.5%, 53.4%, 53.3%, 53.2%, 53.3% and 53.3%, respectively, and the analyzed crude lipid content in diets was increased from 7.8% to 14.4% as the PBM inclusion level increased. In trial 2, the analyzed crude protein content for the FMP diet was 52.9%, and for the PBMP and SBMP diets, the crude protein content was 50.6%, 50.5%, 50.3%, 50.8% and 50.1%, respectively. The crude lipid content in diets of trial 2 was 11.2%, 11.1%, 11.2%, 10.8%, 10.9% and 11.0%, respectively.

Given the predicted feed requirements associated with increasing aquaculture production, global fishmeal (FM) is clearly inadequate to support the demand, and use levels in feeds will have to be reduced (NRC, 2011), so alternative protein sources for FM should be used to the most extent without adversely influencing the growth, feed utilization and health of fish. One of the most promising alternatives is poultry byproduct meal (PBM), because it has similar protein level and amino acid profile as fishmeal (NRC, 2011), lower price in comparison to FM and sustainable sources (Cruz-Suárez et al., 2007). The replacing potential of PBMP to FMP has been demonstrated in diets for several fish species (Shapawi et al., 2007; Zhou et al., 2011a; Rossi Jr and Davis, 2012; Fuertes et al., 2013). However, there are two aspects which perhaps limit the high inclusions of PBM in aquatic feeds. One is its high lipid content (usually > 13%) (NRC, 2011), which limits the possibilities of formulating the lipid fraction of the feeds, especially for fish that have low lipid requirement, and the other is the deficiency of DHA and EPA in lipids of PBM (NRC, 2011). Among all the plant protein sources, soybean meal (SBM) appears to be one of the most appropriate alternative ingredients because of its sustainable supply, acceptable price and favorable amino acids (AA) profile. The possibility of SBM to replacing FM has been intensively studied in many cultured marine carnivorous fish species including cobia (40%) (Zhou et al., 2005), European sea bass (25%) (Tibaldi et al., 2006), turbot (25%) (Day and Plascencia-Gonzalez, 2000), black sea bream (20%) (Zhou et al., 2011b) and Atlantic salmon (33%) (Carter and Hauler, 2000). However, SBM has a shortage of several amino acids (methionine, lysine and taurine), nucleotides in comparison to fishmeal and contains anti-nutritional factors (ANF), which may negatively influence nutrients digestion and absorption in fish (Francis et al., 2001). Furthermore, intestine histological and pathology changes, such as subepithelial mucosa swelling, mucosal folds shortening and enteritis caused by high levels of soybean meal supplementation have been observed in several fish species including common carp (Urán et al., 2008), rainbow trout (Romarheim et al., 2008; Merrifield et al., 2009), Atlantic salmon (Baeverfjord and Krogdahl, 1996; Nordrum et al., 2000), yellowtail kingfish (Bansemer et al., 2015), sharpsnout seabream (Ferrara et al., 2015) and gibel carp (Liu et al., 2017). However, in the studies of Atlantic halibut (GrisdalleHelland et al., 2002) and sea bass (Bonaldo et al., 2008), no intestine histology and pathology variations were found after feeding SBM-based diet. There is limited information on the use of alternative protein sources in diets of hybrid grouper which has been largely cultured in China. Our previous study showed that hybrid grouper needed a high level of protein (53% of dry matter) to maintain its rapid growth (Jiang et al., 2015). As mentioned above, the high levels of FM replacement by single PBM or SBM protein source may induce abnormality for fish growth or physiology, and the mixed use of PBM and SBM protein sources to replacing FM protein perhaps is an effective way to resolve the problems above; therefore, the first aim of this study was to establish the maximal FMP replacement by PBMP without negatively affecting growth performance and health of hybrid grouper, and the second was further to determine the maximal PBMP replacement by SBMP in the PBM-based diets of this fish species.

2.2. Experimental procedures In trial 1, hybrid grouper juveniles were obtained from a commercial hatchery (Changjiang, Hainan, China). Prior to the trial, experimental fish were acclimated with a commercial diet for 2 weeks, and then, groups of 30 fish (average initial body weight: 6.0 ± 0.05 g/fish) were randomly distributed into 24 small floating cages (L 120 cm × W 70 cm × H 50 cm) which were labeled and located in seven connective 6-m3 indoor concrete tanks (L 3 m × W 2 m × H 1 m) with 3 cages occurring in each tank. All tanks received flowing sea water (salinity: 33.1 g/L) from the same reservoir at a rate of 3 L/min. In trial 2, the initial body weight of experimental fish was 6.8 ± 0.08 g/fish, and fish were cultured at a density of 15 fish/cage in the same concrete tanks as trial 1. During the rearing period, each dietary treatment of these two trials was fed three replicate cages, and each replicate cage was in different tanks. Throughout the trial, dissolved oxygen content was measured in the tanks every other day with a portable meter (HATCH HQ30d, Hatch Lange GMBH) and values ranged at 6.0–6.2 mg/L. Total ammonia nitrogen (0–0.20 mg/L) was measured with a portable spectrophotometer (HATCH DR 2800, Hatch Lange GMBH). Water temperature was recorded daily using maximum-minimum thermometers and ranged at 27–28 °C. Fish were exposed to a 12 h: 12 h light: dark cycle and fed with each dietary treatment twice daily (08:00 h and 16:30 h) to apparent satiation which was judged when the first pellet was seen to sink to the bottom of cages. Feed intake was recorded daily. Fish in each cage were weighed weekly at which time experimental tanks and cages were cleaned. Both of these two growth trials lasted for 8 weeks (Table 5).

2. Materials and methods 2.1. Experimental diets In trial 1, eight isoenergetic (340 kcal per 100 g dry matter) and isoproteic (53.5% of dry matter) experimental diets were formulated to replace 0%, 10%, 20%, 30%, 40%, 50%, 60% and 70% FMP with PBMP (Table 1), being abbreviated as FMP, PBMP10, PBMP20, PBMP30, PBMP40, PBMP50, PBMP60 and PBMP70, respectively. The analyzed

2.3. Sampling and analysis At the beginning of trial 1 or trial 2, 10 fish were sampled and stored at −20 °C for analysis of initial whole-body proximate composition. At the end of trial 1, two fish per cage were collected for whole-body 2

Aquaculture 516 (2020) 734503

Z. Zhou, et al.

Table 1 Formulations and analyzed composition of experimental diets (dry-matter basis) in trial 1. Ingredients

Dietary treatments

Peruvian fishmeal (anchovy) Poultry by-product mealb DHA Algae oilc Corn starch Vitamin mixtured Mineral mixturee Lysine-HCl L-Methionine Cellulose Carboxymethyl cellulose Probioticsf Analyzed compositiong Dry matter % Crude protein % Crude lipid % a b c d e f g

a

FMP

PBMP10

PBMP20

PBMP30

PBMP40

PBMP50

PBMP60

PBMP70

80.45 0.00 0.48 15.72 1 0.5 0.00 0.00 0.02 1.68 0.15

72.41 8.92 0.63 13.46 1 0.5 0.11 0.06 1.08 1.68 0.15

64.36 17.83 0.77 11.20 1 0.5 0.22 0.13 2.16 1.68 0.15

56.32 26.75 0.92 8.95 1 0.5 0.32 0.19 3.22 1.68 0.15

48.27 35.67 1.06 6.69 1 0.5 0.43 0.25 4.30 1.68 0.15

40.23 44.58 1.21 4.44 1 0.5 0.54 0.32 5.35 1.68 0.15

32.18 53.50 1.35 2.18 1 0.5 0.65 0.38 6.43 1.68 0.15

24.14 62.42 1.50 0.00 1 0.5 0.76 0.44 7.41 1.68 0.15

91 53.1 7.8

90 53.1 8.7

91 53.5 9.6

91 53.4 10.3

91 53.3 11.3

91 53.2 12.4

92 53.3 13.5

92 53.3 14.4

Yongsheng Feed Corporation, Binzhou, China; proximate composition (% dry matter): moisture, 7.2; crude protein, 66.5; crude lipid, 9.2. Liyang Lifu Meat Products Co., Ltd., Jiangshu, China; proximate composition (% dry matter): moisture, 6.93; crude protein, 60.18; crude lipid, 17.94. Linyi Youkang Biotechnology Co., Ltd., Linyi, Shandong, China. Vitamin mixture. Mineral mixture see Lin and Shiau (2003). Bacillus subtilis, Zhuhai Qingyu Environmental Protection Technology Co., Ltd., Zhuhai, China. Values represent means of duplicate samples.

Table 2 Amino acid compositions (%) of experimental diets (dry-matter basis) in trial 1. Ingredients

Dietary treatments FMP

PBMP10

PBMP20

PBMP30

PBMP40

PBMP50

PBMP60

PBMP70

2.21 2.58 1.47 2.23 3.88 2.15 4.01 1.51 3.06

2.12 2.49 1.39 2.13 3.73 2.06 3.90 1.42 3.06

2.12 2.49 1.40 2.12 3.73 2.07 3.92 1.41 3.09

2.11 2.48 1.39 2.09 3.75 2.13 3.89 1.35 3.21

2.06 2.41 1.39 2.02 3.67 2.06 3.87 1.29 3.18

2.04 2.38 1.40 2.01 3.63 2.10 3.82 1.27 3.19

2.01 2.36 1.37 1.94 3.59 2.04 3.75 1.20 3.31

2.16 2.56 1.53 2.11 3.88 2.19 4.1 1.27 3.69

Non-essential amino acids Aspartic acid 4.78 Serine 1.98 Glutamic acid 6.92 Proline 2.12 Glycine 3.37 Alanine 3.37 Tyrosine 1.46

4.57 1.92 6.75 2.20 3.49 3.31 1.34

4.56 1.93 6.82 2.36 3.72 3.37 1.36

4.55 1.96 6.91 2.52 3.98 3.45 1.37

4.43 1.93 6.81 2.57 4.08 3.42 1.31

4.37 1.93 6.78 2.68 4.17 3.43 1.34

4.33 1.94 6.77 2.82 4.37 3.45 1.28

4.66 2.1 7.42 3.2 4.88 3.76 1.38

Essential amino acids Threonine Valine Methionine Isoleucine Leucine Phenylalanine Lysine Histidine Arginine

composition analysis, and another three fish per cage were individually weighed and dissected to obtain viscera and liver, gut and intraperitoneal fat (IPF) weights for computing body condition indices including hepatosomatic index (HSI) ((liver wt./live wt.) × 100) and IPF ratio ((IPF wt./live wt.) × 100), respectively. Intraperitoneal fat was obtained by removing and weighing the fat from the abdominal cavity as well as that adhering to the gastrointestinal (GI) tract of the fish. Condition factor (CF) was also computed as (body weight × 100)/ (body length)3. For gene expression assays of hypothalamus samples, another three individuals were randomly collected from each cage and hypothalamus were taken out and immediately frozen in liquid nitrogen and then stored at −80 °C. Gut and liver samples for histological analysis were removed and then immersed in Davidson's fixative solution (water/formalin/ethanol/acetic acid, 3/2/3/1, v/v). After 24 h, the samples for histological analysis were dehydrated and transferred to an ethanol solution (70%). The foregut, midgut, hindgut as well as liver were embedded in paraffin, and gut samples were sectioned into 4-μm

transverse cuts following the axis of the gut lumen. The samples were then mounted on glass slides, and stained with hematoxylin and eosin. Slides were examined on a light microscope (Olympus IX71) equipped with the Image-Pro Plus 7.0C software. Digitalized images were analyzed to measure the micrometer length of various enteric structures. Macromorphological (fold height) and micromorphological (enterocyte height and microvillus height) parameters were measured (10 fields per individual sample) according to the procedures described by Escaffre et al. (2007). The sampling protocol of trial 2 was similar as trial 1 except that the sample for genes expression assays was head kidney. Crude protein (N × 6.25) was determined by the Kjeldahl method after acid digestion using an auto Kjeldahl System (FOSS Tecator, Haganas, Sweden). Crude lipid was determined by ether extraction using a Soxtec System HT (Soxtec System HT6, Haineng SOX406, Shandong, China). Dry matter was determined by heating ~2 g samples at 125 °C for 3 h (AOAC, 1990). The amino acid levels of the diets were determined after acid hydrolysis using the L-8900 amino acid analyzer 3

Aquaculture 516 (2020) 734503

Z. Zhou, et al.

Table 3 Formulations and analyzed composition of experimental diets (dry-matter basis) in trial 2. Ingredients

Table 5 Primers used for quantitative RT-PCR (qPCR) in trial 1 and trial 2.

Dietary treatments

Peruvian fishmeal (anchovy)a Poultry by-product mealb Soybean mealc Fish oil Vitamin mixtured Mineral mixtured Corn starch Lysine-HCl L-Arginine L-Methionine Carboxymethyl cellulose Cellulose Analyzed compositione Dry matter % Crude protein % Crude lipid %

Gene names

Gene bank accession no.

Primer sequence(5′-3′)

qPCR

AgRPa

NM_001328012.1

F: CTGCATCCCCCACCAGCb R: GTAGCAGATGGCATTGAAGAAc F: GGAAGCCTGTTGGACGAAAG R: CTTTTCGTGGATGTCACCTGG F: TCCACAAACCCACCAAAGTAA R: TCCACCAACAGCGTAGAAAAG F: TATGGAGATGGGTCCTTTGGTG R: GCTTCTTTTCCTGCGTCTGTTG F: GTCCTGATCAAACGAAACACCA R: CACGCTCACCCTCATAAACCT F: CTCTGGGCAACGGAACCTCT R:GTGCGTGACATCAAGGAGAAGC

FMP

PBMP

SBMP7

SBMP14

SBMP21

SBMP28

86.64

25.99

25.99

25.99

25.99

25.99

POMCd

AY169408.1

0.00

54.93

51.08

47.24

43.39

39.55

Keap1e

XM_018665037.1

0.00 1.31 1.00 0.50 7.02 0.00 0.00 0.00 1.21

0.00 0.00 1.00 0.50 7.02 0.81 0.31 0.34 1.21

5.25 0.53 1.00 0.50 7.02 0.81 0.30 0.38 1.21

10.50 1.07 1.00 0.50 7.02 0.82 0.29 0.41 1.21

15.75 1.60 1.00 0.50 7.02 0.82 0.28 0.45 1.21

21.00 2.14 1.00 0.50 7.02 0.83 0.27 0.48 1.21

2.31

7.88

5.91

3.94

1.97

0.00

86 52.9 11.2

88 50.6 11.1

89 50.5 11.2

88 50.3 10.8

90 50.8 10.9

90 50.1 11.0

f

Nrf2

HSP-70 β-Actin a b c d e f g

Dietary treatments SBMP7

SBMP14

SBMP21

SBMP28

Essential amino acids Threonine 2.57 Valine 3.15 Methionine 1.65 Isoleucine 2.56 Leucine 4.42 Phenylalanine 2.46 Lysine 4.47 Histidine 1.70 Arginine 3.35

2.16 2.81 1.40 2.09 4.02 2.37 4.17 1.44 3.59

2.16 2.81 1.36 2.10 4.00 2.39 4.20 1.42 3.58

2.15 2.80 1.33 2.12 4.00 2.43 4.18 1.41 3.58

2.17 2.83 1.32 2.17 4.06 2.50 4.21 1.39 3.59

2.15 2.77 1.25 2.15 3.99 2.45 4.16 1.38 3.56

Non-essential amino acids Aspartic acid 5.38 Serine 2.25 Glutamic acid 7.79 Proline 2.27 Glycine 3.40 Alanine 3.86 Tyrosine 1.65

4.59 2.07 7.31 2.96 4.44 3.74 1.39

4.67 2.09 7.43 2.95 4.31 3.66 1.34

4.71 2.10 7.50 2.89 4.16 3.58 1.39

4.83 2.14 7.68 2.86 4.04 3.51 1.50

4.87 2.17 7.74 2.77 3.87 3.42 1.44

AY423555.2 AY510710.2

AgRP: Agouti-related protein. F: Forward sequence. R: Reverse sequence. POMC: Proopiomelanocortin. Keap1: Kelch-like ECH-associated protein-1. Nrf2: NF-E2-related factor 2. HSP70: Heat shock protein 70.

Real-time PCR (RT-PCR) was carried out in a quantitative thermal cycler (Mastercyclereprealplex, Eppendorf, Germany). The amplification was performed in a total volume of 10 μL containing 5 μL power SYBR® Green PCR Master Mix (Applied Biosystems, America), 0.5 μL of each primer (10 μmol/L), 3 μL nuclease-free water and 1 μL of cDNA mix. The real-time RT-PCR program was as follows: 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s, 60 °C for 60 s, and 68 °C for 20 s. The RT-PCR primer pairs designed by Primer Premier 5.0 based on the published nucleotide sequences were for agouti-related protein (AGRP) [NM_001328012.1, F (Forward sequence): CTGCATCCCCCACCAGC, R (Reverse sequence): GTAGCAGATGGCATTGAAGAA], proopiomelanocortin (POMC) (AY169408.1, F: GGAAGCCTGTTGGACGAAAG, R: CTT TTCGTGGATGTCACCTGG), kelch-like ECH-associated protein-1 (Keap1) (XM_018665037.1, F: TCCACAAACCCACCAAAGTAA, R: TCC ACCAACAGCGTAGAAAAG), NF-E2-related factor 2 (Nrf2) (KU892416.1, F: TATGGAGATGGGTCCTTTGGTG, R: GCTTCTTTTCCT GCGTCTGTTG), heat shock protein 70 (HSP-70) (AY423555.2, F: GTC CTGATCAAACGAAACACCA, R: CACGCTCACCCTCATAAACCT), and βactin (AY510710.2, F: CTCTGGGCAACGGAACCTCT, R: GTGCGTGAC ATCAAGGAGAAGC). At the end of each PCR reaction, melting curve analysis of amplification products was carried out to confirm that a single PCR product was present in these reactions. Standard curves were made with five different dilutions (in triplicate) of the cDNA samples and amplification efficiency was analyzed according to the following eq. E = 10(−1/slope)-1. The expression levels of the target genes were calculated followed the 2-∆∆Ct method described by Yao et al. (2009).

Table 4 Amino acid compositions (%) of experimental diets (dry-matter basis) in trial 2.

PBMP

KU892416.1 g

2.5. Real-time quantitative PCR analysis of feeding, anti-oxidation and immunity related gene

a Yongsheng Feed Corporation, Binzhou, China; proximate composition (% dry matter): moisture, 8.59; crude protein, 69.63; crude lipid, 11.04. b American Proteins Inc., USA; proximate composition (% dry matter): moisture, 3.58; crude protein, 68.18; crude lipid, 14.58. c Chinatex Corporation, Zhanjiang, China; proximate composition (% dry matter): moisture, 11.33; crude protein, 49.93; crude lipid, 0.5. d As in trial 1. e Values represent means of duplicate samples.

FMP

Used for

(Hitachi, Japan) (Unnikrishnan and Paulraj, 2010).

2.6. Statistical analysis

2.4. Total RNA extraction and reverse transcription

Normality and homoscedasticity assumptions were confirmed prior to any statistical analysis. All evaluated variables were subjected to an analysis of variance (ANOVA) to determine if the inclusion levels of PBMP or SBMP significantly (P < 0.05) affected the observed responses. In addition, to determine if the effect was linear, quadratic and/or cubic, a follow-up trend analysis using orthogonal polynomial contrasts was performed (Davis, 2010) using the SPSS 18.0 (SPSS Inc., Michigan Avenue, Chicago, IL, USA) in trial 1, and for trial 2, this analysis was conducted only among experimental treatments of PBMP, SBMP7, SBMP14, SBMP21, SBMP28. The adjusted R2 (Adj. R2) was

Total RNA was extracted from hypothalamus and head kidney using Trizol Reagent (Invitrogen, America) followed by quality measurement on a 1.0% denaturing agarose gel and yield determination on NanoDrop® ND-1000 (Wilmington, DE). The RNA was treated with RNA-Free DNase (Takara, Japan) to remove DNA contaminant and reversely transcribed to cDNA by RevertAid First Stand cDNA Synthesis kit (Thermo Scientific, America) following the instructions provided by the manufacturer. 4

Aquaculture 516 (2020) 734503

Z. Zhou, et al.

Table 6 Growth performance and feed utilization of hybrid grouper juveniles fed diets with different FMP replacements by PBMP for 8 weeks in trial 1.

Table 7 Growth performance and feed utilization of hybrid grouper juveniles fed diets with different PBMP replacements by SBMP for 8 weeks in trial 2.

Dietary treatments

WG%a

DFIb

FCRc

PERd

PPVe

Survival

Dietary treatments

WG%a

DFI

FCR

PER

PPV

Survival

FMP PBMP10 PBMP20 PBMP30 PBMP40 PBMP50 PBMP60 PBMP70

1165 1180 1131 1164 1133 1078 1086 1061

1.37 1.36 1.33 1.37 1.37 1.39 1.37 1.38

0.74 0.75 0.77 0.77 0.76 0.78 0.77 0.77

2.46 2.48 2.51 2.44 2.45 2.42 2.44 2.43

48.1 48.7 49.4 48.1 48.9 48.6 49.3 51.2

100 100 100 100 100 100 100 100

FMP PBMP SBMP7 SBMP14 SBMP21 SBMP28

1315 1237 1264 1157 1284 1301

1.41 1.52 1.54 1.50 1.50 1.50

0.79 0.85 0.86 0.84 0.84 0.84

2.39 2.33 2.31 2.37 2.34 2.38

39.4 37.8 38.5 39.0 37.3 38.8

100 95.6 95.6 100 97.8 95.6

PSE

59.30

0.04

0.024

0.066

1.478

2.567

PSEf

40.10

0.027

0.013

0.048

1.003

ANOVA P-Value Regression (N = 3)

0.170

0.131

0.129

0.784

0.722

0.276

0.061

0.546

0.266

0.618

0.117

ANOVA P-Value Regression (N = 3) L Adj. R2 P-Value

0.012 0.300

−0.019 0.403

−0.028 0.447

0.003 0.325

−0.070 0.776

−0.064 0.699

SOP Adj. R2 P-Value

0.036 0.317

−0.103 0.712

−0.114 0.757

−0.079 0.626

−0.158 0.958

0.100 0.211

CF Adj. R2 P-Value

−0.041 0.512

−0.196 0.869

−0.198 0.875

−0.175 0.822

−0.167 0.801

0.024 0.385

g

L Adj. R2h P-Value

0.399 0.001

0.040 0.176

0.245 0.008

0.069 0.114

0.177 0.023

SOPi Adj. R2 P-Value

0.387 0.002

0.017 0.320

0.267 0.015

0.031 0.278

0.226 0.026

0.363 0.007

0.041 0.293

0.239 0.037

0.034 0.312

0.333 0.011

j

CF Adj. R2 P-Value a b c d e f g h i j

Table 8 Body condition indices of hybrid grouper juveniles fed diets with different FMP replacements by PBMP for 8 weeks in trial 1.

WG = weight gain (%). DFI = daily feed intake (g/fish). FCR = feed conversion ratio. PER = protein efficiency ratio. PPV = protein productive value. PSE = pooled standard error of treatment means (n = 3). L = linear trend. Adj. R2 = adjusted R square. SOP = second order polynomial trend. CF = cubic function.

calculated as previously described by Kvalseth (1985). 3. Results 3.1. Growth performance and feed utilization In trial 1, WG%, DFI, FCR, PER and PPV of hybrid grouper were not significantly affected by different FMP replacements (0%–70%) with PBMP (Table 6). In trial 2, fish fed the low-FM diets had similar values of WG%, DFI, FCR, PER and PPV as fish fed the high-FM diet (Table 7), and also, these parameters were not significantly influenced by different PBMP replacements (0%–28%) with SBMP. Survival ratios of fish both in trial 1 and in trial 2 were less affected by different dietary treatments.

Dietary treatments

VSIa

HSI

IPF

CF

FMP PBMP10 PBMP20 PBMP30 PBMP40 PBMP50 PBMP60 PBMP70

8.70 9.11 8.28 8.42 8.28 7.96 8.79 8.84

2.24 1.94 1.71 1.57 1.46 1.45 1.53 1.60

1.52 1.80 2.17 2.28 2.23 2.28 2.49 2.56

3.43 3.32 2.92 2.82 2.83 2.74 2.89 2.82

PSE

0.4717

0.1581

0.2262

0.0865

ANOVA P-Value Regression (N = 3)

0.325

0.001

0.005

< 0.001

L Adj. R2 P-Value

−0.039 0.706

0.430 < 0.001

0.559 < 0.001

0.527 < 0.001

SOP Adj. R2 P-Value

0.080 0.160

0.698 < 0.001

0.584 < 0.001

0.792 < 0.001

CF Adj. R2 P-Value

0.076 0.213

0.684 < 0.001

0.255 < 0.001

0.789 < 0.001

a VSI = viscerosomatic index; HSI = hepatosomatic index; IPF = intraperitoneal fat ratio; CF = condition factor; PSE = pooled standard error of treatment means (n = 3); L = linear trend; Adj. R2 = adjusted R square; SOP = second order polynomial trend; CF = cubic function.

3.2. Body condition indices, whole-body and muscle proximate composition In trial 1, HSI, IPF ratio as well as CF of fish were significantly affected by different FMP replacements with PBMP (Table 8). Fish fed FMP, PBMP10 and PBMP20 had higher values of HSI and CF than fish fed PBMP30, PBMP40, PBMP50, PBMP60 and PBMP70. IPF ratio was increased as PBM inclusion levels in diets increased. Viscerosomatic index (VSI) of fish was not affected by different FMP replacements with PBMP. In trial 2, different dietary treatments displayed no significant effects on HSI, IPF ratio, CF and VSI of fish (Table 9). Whole-body and muscle lipid contents of fish in trial 1 were increased by the increments in PBM inclusions (Table 10), and protein contents in whole body and muscle of fish were not affected by different PBM inclusions to diets. In trial 2, whole-body and muscle compositions (moisture, protein and lipid) of fish were not influenced by different

experimental treatments (Table 11). 3.3. Gut morphometric and liver histological analysis In trial 1, there were no significant differences in micromorphology (hF, hE, hMV) of foregut, midgut, hindgut of fish fed FMP, PBMP10, PBMP20, PBMP30, PBMP40, PBMP50, PBMP60 and PBMP70 (Table 12). In trial 2, fish fed SBMP7, SBMP14, SBMP21 and SBMP28 showed similar hF, hE, hMV in foregut and hF, hE in midgut as fish fed PBMP or high FM (Table 13), but fish fed the low-FM diets with PBMP, SBMP7, SBMP14, SBMP21 and SBMP28 had lower midgut hMV and 5

Aquaculture 516 (2020) 734503

Z. Zhou, et al.

Table 9 Body condition indices of hybrid grouper juveniles fed diets with different PBMP replacements by SBMP for 8 weeks in trial 2. Dietary treatments

VSI

HSI

IPF

CF

FMP PBMP SBMP7 SBMP14 SBMP21 SBMP28

9.90 10.85 9.89 10.49 9.98 10.25

2.32 2.04 2.08 2.13 2.07 2.01

2.76 2.76 2.70 2.92 2.82 2.97

3.52 3.47 3.46 3.41 3.57 3.55

PSE

0.4463

0.1627

0.1582

0.1309

ANOVA P-Value Regression (N = 3)

0.263

0.500

0.525

0.812

L Adj. R2 P-Value

−0.002 0.343

−0.075 0.891

0.103 0.130

0.007 0.314

SOP Adj. R2 P-Value

0.004 0.388

−0.078 0.621

0.036 0.318

0.051 0.534

CF Adj. R2 P-Value

−0.039 0.508

−0.157 0.779

−0.047 0.524

−0.126 0.703

Table 11 Whole-body and muscle proximate compositions of hybrid grouper juveniles fed diets with different PBMP replacements by SBMP for 8 weeks in trial 2.

Whole-body compositiona

Dorsal muscle composition

Moisture

Protein

Lipid

Moisture

Protein

Lipid

FMP PBMP10 PBMP20 PBMP30 PBMP40 PBMP50 PBMP60 PBMP70

71.45 71.02 71.20 70.47 70.99 70.58 70.29 70.19

16.54 16.39 16.56 16.90 16.46 16.30 16.42 16.73

5.54 5.73 6.40 6.20 6.23 6.75 7.39 6.54

74.37 76.81 74.56 75.76 76.79 75.01 76.51 74.70

19.31 19.31 19.26 19.37 19.36 19.32 19.37 19.33

0.97 0.88 1.15 1.39 1.11 1.54 1.55 1.53

PSE

0.348

0.192

0.426

1.115

0.061

0.125

0.020

0.114

0.014

0.174

0.655

< 0.001

L Adj. R2 P-Value

0.445 < 0.001

−0.044 0.885

0.392 0.001

−0.042 0.787

0.017 0.249

0.601 < 0.001

SOP Adj. R2 P-Value

0.418 0.001

−0.093 0.975

0.389 0.002

−0.011 0.433

−0.020 0.475

0.586 < 0.001

CF Adj. R2 P-Value

0.400 0.004

−0.007 0.438

0.376 0.006

−0.060 0.645

−0.048 0.591

0.578 < 0.001

ANOVA P-Value Regression (N = 3)

Whole-body compositiona

Dorsal muscle composition

Moisture

Protein

Lipid

Moisture

Protein

Lipid

FMP PBMP SBMP7 SBMP14 SBMP21 SBMP28

67.13 68.41 66.65 68.31 67.60 68.74

16.33 16.09 16.53 16.34 15.83 16.21

8.39 8.37 8.59 8.43 8.62 8.35

74.60 75.58 76.08 75.56 75.25 75.05

22.30 21.28 20.98 21.53 21.43 21.57

1.78 1.83 1.60 1.62 1.71 1.73

PSE

0.8717

0.4816

0.2161

0.4448

0.4719

0.1395

0.198

0.762

0.690

0.080

0.198

0.558

L Adj. R2 P-Value

−0.032 0.466

−0.056 0.624

−0.077 0.948

0.189 0.060

0.184 0.062

−0.073 0.840

SOP Adj. R2 P-Value

0.044 0.304

−0.143 0.882

−0.053 0.539

0.163 0.136

0.121 0.183

−0.003 0.403

CF Adj. R2 P-Value

0.019 0.394

−0.138 0.733

−0.137 0.730

0.130 0.225

0.120 0.238

−0.039 0.507

ANOVA P-Value Regression (N = 3)

Table 10 Whole-body, muscle proximate compositions of hybrid grouper juveniles fed diets with different FMP replacements by PBMP for 8 weeks in trial 1. Dietary treatments

Dietary treatments

a Initial whole-body composition (%): Moisture = 78.0; Protein = 14.9; Lipid =3.0.

significantly different among fish fed different FMP replacements by PBMP for 8 weeks in trial 1 (Fig. 3). In trial 2, expression of Keap1, Nrf2 and HSP70 in head kidney of hybrid grouper juveniles was not significantly affected by different experimental treatments (Fig. 4). 4. Discussion Results from trial 1 indicated that replacing 70% FM protein with PBM protein did not negatively affect growth performance and feed utilization of hybrid grouper, which was in agreement with the results observed in humpback grouper (Shapawi et al., 2007). In some other marine fish species such as cobia (Zhou et al., 2011) and Florida pompano (Rossi Jr and Davis, 2012; Riche, 2015), PBM was also suggested to be a good alternative ingredient for FM in diets. However, limited concerns were given to fish liver health when replacing FM with PBM in aquatic feeds. Our results showed that high FMP replacements (50%–70%) by PBMP induced steatosis in hepatocytes of hybrid grouper. This may be due to the high lipid contents but low DHA, EPA contents from high supplementations of PBM. It was well known that PBM has high lipid contents but almost no EPA and DHA (NRC, 2011), and our previous study (Jiang et al., 2015) showed that 7% of dietary crude lipid could meet the demands for fast growth of hybrid grouper and the increments of dietary crude lipid level from 7% to 13% significantly increased whole-body lipid contents but not growth. Results of the present study firstly showed that the high dietary lipid contents from PBM possibly caused the damage to liver health of fish. This further pointed out the necessity to reducing the lipid content in PBM for facilitating feed formulation, which was also suggested by MataSotres et al. (2018). No significant variations in values of WG%, FCR, PER as well as PPV observed in trial 2 further demonstrated that 70% FM protein could be replaced by PBM protein or by the combination of PBMP and SBMP without negatively affecting growth performance and feed utilization of hybrid grouper. In the study of Rossi Jr and Davis (2012), it was also reported that the combination of SBM and PBM as alternative ingredients for FM resulted in satisfactory Florida pompano performance. In trial 2, no obvious steatosis observed in hepatocytes of fish may be

a Initial whole-body composition (%): Moisture = 76.0; Protein = 14.8; Lipid =3.9.

hindgut hF, hE, hMV than fish fed the high-FM diet. More steatosis in hepatocytes were observed in fish fed PBMP50, PBMP60 and PBMP70 compared to fish fed FMP, PBMP10, PBMP20, PBMP30, PBMP40 in trial 1 (Fig. 1). In trial 2, there were no obvious steatosis in hepatocytes of fish fed different experimental diets (Fig. 2), but swelling in hepatocytes was observed in fish fed SBMP14, SBMP21 and SBMP28. 3.4. Expression of feeding, anti-oxidation and immunity related genes Expression of AgRP and POMC in hypothalamus was not 6

Aquaculture 516 (2020) 734503

Z. Zhou, et al.

Table 12 Gut micromorphology of hybrid grouper juveniles fed diets with different FMP replacements by PBMP for 8 weeks in trial 1. Dietary treatments

Foregut

Midgut

Hindgut

hF (μm)

hE (μm)

hMV (μm)

hF (μm)

hE (μm)

hMV (μm)

hF (μm)

hE (μm)

hMV (μm)

FMP PBMP10 PBMP20 PBMP30 PBMP40 PBMP50 PBMP60 PBMP70

599.3 516.0 616.0 574.7 563.7 579.0 565.0 545.7

32.84 33.52 39.99 30.17 39.08 34.56 26.57 32.03

5.70 4.28 3.58 3.91 4.93 5.06 3.89 4.59

403.7 410.7 374.3 406.7 418.0 501.0 430.3 475.0

37.54 33.92 30.61 29.52 34.74 31.27 25.96 29.97

4.48 3.34 3.24 4.01 4.21 3.03 3.28 4.32

517.3 477.0 544.3 497.3 491.3 482.3 466.7 484.3

39.06 28.84 31.03 31.29 29.34 32.38 27.84 35.50

4.61 3.43 3.09 4.40 4.30 4.07 4.34 4.12

PSE

48.53

4.70

0.77

59.49

6.11

0.72

60.29

4.42

0.65

ANOVA P-Value Regression (N = 3)

0.594

0.166

0.177

0.688

0.679

0.329

0.922

0.260

0.328

L Adj. R2 P-Value

−0.030 0.570

0.000 0.328

−0.032 0.598

0.027 0.213

0.072 0.110

−0.042 0.791

−0.004 0.348

−0.027 0.531

−0.027 0.531

SOP Adj. R2 P-Value

−0.071 0.787

0.017 0.322

−0.001 0.390

0.006 0.361

0.038 0.225

−0.023 0.486

−0.050 0.645

0.111 0.112

−0.057 0.690

CF Adj. R2 P-Value

−0.106 0.848

−0.010 0.446

0.143 0.111

−0.012 0.453

0.003 0.404

−0.074 0.704

−0.093 0.792

0.076 0.215

0.062 0.244

due to relatively lower dietary lipid (11%) compared to those (12.4%–14.4%) of diets (PBMP50, PBMP60 and PBMP70) in trial 1. However, some hepatocytes swelling occurred in fish fed SBMP14, SBMP21 and SBMP28, which probably resulted from the anti-nutritional factors from SBM. The palatability of feed is one of the main concerns regarding the use of alternative protein sources to FM in diets. Our previous study (Yao et al., 2018) showed that high FM protein replacements with hemoglobin powder protein reduced feed palatability and the expression of feeding related genes such as NPY, AGRP and orexin in hybrid grouper. In this study, DFI of fish both in trial 1 and in trial 2 as well as the expression of feeding related genes (AGRP and POMC) of fish in trial 1 were not significantly influenced by the single supplementation of PBM or the combined supplementation of PBM and SBM, indicating

that 70% FM protein replacement by PBM protein or by the combination of PBMP and SBMP did not decrease feed palatability to hybrid grouper. Head kidney is a major immune organ (Kobayashi et al., 2006), and its normal structure and function is usually correlated with fish immunity (Rijkers et al., 1980; Taysse et al., 1998; Tort et al., 2003). In trial 2, expression of head-kidney Nrf2, Keap 1 and HSP70 which have been proved to be important antioxidant or immune factors (Baird and Dinkova-Kostova, 2011; Taguchi et al., 2011; Gu et al., 2012; Ma, 2013; O'Connell and Hayes, 2015), were not significantly different among various experimental treatments, demonstrating that 70% FM protein replacement by PBM protein or by the combination of PBMP and SBMP showed no adverse effects on the function of head kidney. For gut morphology, although foregut hF, hE, hMV and midgut hF,

Table 13 Gut micromorphology of hybrid grouper juveniles fed diets with different PBMP replacements by SBMP for 8 weeks in trial 2. Dietary treatments

Foregut

Midgut

Hindgut

hF (μm)

hE (μm)

hMV (μm)

hF (μm)

hE (μm)

hMV (μm)

hF (μm)

hE (μm)

hMV (μm)

FMP PBMP SBMP7 SBMP14 SBMP21 SBMP28

541 483 539 498 454 563

22.5 21.8 22.3 23.6 18.6 23.6

3.45 3.14 3.02 2.60 2.54 2.92

536 538 499 523 515 527

38.8 39.4 38.4 31.4 28.4 31.0

6.23 5.08 4.61 4.71 4.85 4.23

486 432 390 409 347 438

37.6 27.6 25.6 30.2 25.1 22.3

5.83 3.28 2.49 2.64 3.63 3.45

PSE

39.38

1.74

0.28

30.76

3.96

0.21

32.39

4.14

0.48

ANOVA P-Value Regression (N = 3)

0.123

0.113

0.060

0.811

0.057

< 0.001

0.019

0.040

< 0.001

L Adj. R2 P-Value

−0.036 0.487

−0.077 0.999

0.060 0.191

−0.076 0.925

0.359 0.011

0.262 0.029

−0.068 0.748

0.030 0.252

0.063 0.187

SOP Adj. R2 P-Value

−0.086 0.650

−0.145 0.893

0.220 0.089

−0.088 0.657

0.361 0.027

0.219 0.090

0.107 0.202

0.004 0.386

0.112 0.195

CF Adj. R2 P-Value

0.399 0.035

0.233 0.130

0.303 0.075

−0.134 0.724

0.427 0.028

0.407 0.033

0.112 0.249

−0.034 0.497

0.211 0.140

7

Aquaculture 516 (2020) 734503

Z. Zhou, et al.

s

Fig. 1. Light microscopy of the liver histology morphology of juvenile hybrid grouper fed diets with different FMP replacements by PBMP for 8 weeks in trial 1. (Scale bar: 50 μm; magnification ×400).Hepatic steatosis (

).

hE were no significantly affected by different experimental treatments in trial 2, midgut hMV and hindgut hF, hE, hMV were lowered by the 70% FMP replacement with PBMP or with the combination of PBMP and SBMP. This was in line with study of Gu et al. (2016) which reported that enteritis developed in the distal intestine of turbot fed diets with 26–54% SBM. In trial 1, the high HSI observed in fish fed FMP and PBMP10 was

due to high dietary starch levels. Dietary digestible carbohydrate often has a positive relation to hepatic glycogen or HSI (Rawles and Gatlin III, 1998; Gaylord and Gatlin III, 2000; Jiang et al., 2015; Luo et al., 2016; Gao et al., 2019). The high IPF ratio and lipid contents in whole body and muscle of fish fed high dietary lipid levels indicated that the elevated lipid inclusions in diets increased the lipid deposition of hybrid grouper. This was in accordance with our previous study (Jiang et al.,

Fig. 2. Light microscopy of the liver histology morphology of juvenile hybrid grouper fed diets with different PBMP replacements by SBMP for 8 weeks in trial 2. (Scale bar: 50 μm; magnification ×400). Hepatocytes swelling (

).

8

Aquaculture 516 (2020) 734503

Z. Zhou, et al.

Fig. 3. Expression of AgRP, POMC in hypothalamus of hybrid grouper juveniles fed diets with different FMP replacements by PBMP for 8 weeks in trial 1. Relative mRNA expression was evaluated by real-time quantitative PCR. The gene expression of the FMP group was set at 1.

Fig. 4. Expression of Keap1, Nrf2 and HSP70 in head kidney of hybrid grouper juveniles fed diets with different PBMP replacements by SBMP for 8 weeks in trial 2. Relative mRNA expression was evaluated by real-time quantitative PCR. The gene expression of the FMP group was set at 1.

2015). The high CF contained in fish fed high dietary starch levels agreed with the results of Luo et al. (2016). In conclusion, replacing 70% FM protein or reducing the FM inclusion level to about 26% with PBMP or the combination of PBMP and SBMP at 53.5% dietary crude protein level did not negatively affect growth, feed intake as well as feed utilization of hybrid grouper, but liver health and gut morphology of fish fed low FM diets need to be further focused on.

Bonaldo, A., Roem, A.J., Fagioli, P., Pecchini, A., Cipollini, I., Gatta, P.P., 2008. Influence of dietary levels of soybean meal on the performance and gut histology of gilthead sea bream (Sparus aurata L.) and European sea bass (Dicentrarchus labrax L.). Aquac. Res. 39 (9), 970–978. Carter, C.G., Hauler, R.C., 2000. Fish meal replacement by plant meals in extruded feeds for Atlantic salmon, Salmo salar L. Aquaculture 185 (3), 299–311. Cruz-Suárez, L.E., Nieto-López, M., Guajardo-Barbosa, C., Tapia-Salazar, M., Scholz, U., Ricque-Marie, D., 2007. Replacement of fish meal with poultry by-product meal in practical diets for Litopenaeus vannamei, and digestibility of the tested ingredients and diets. Aquaculture 272, 466–476. Davis, M.J., 2010. Contrast coding in multiple regression analysis: strengths, weaknesses, and utility of popular coding structures. J. Data Sci. 8, 61–73. Day, O.J., Plascencia-Gonzalez, H.G., 2000. Soybean protein concentrate as a protein source for turbot Scophthalmus maximus L. Aquac. Nutr. 6 (4), 221–228. Escaffre, A.M., Kaushik, S., Mambrini, M., 2007. Morphometric evaluation of changes in the digestive tract of rainbow trout (Oncorhynchus mykiss) due to fish meal replacement with soy protein concentrate. Aquaculture 273, 127–138. Ferrara, E., Gustinelli, A., Fioravanti, M.L., Restucci, B., Quaglio, F., Marono, S., Piccolo, G., 2015. Histological and micro−/macro-morphological evaluation of intestine in sharpsnout seabream (Diplodus puntazzo) fed soybean meal-based diets added with MOS and inulin as prebiotics. Aquac. Int. 23 (6), 1525–1537. Francis, G., Makkar, H.P., Becker, K., 2001. Antinutritional factors present in plant-derived alternate fish feed ingredients and their effects in fish. Aquaculture 199 (3), 197–227. Fuertes, J.B., Celada, J.D., Carral, J.M., Sáez-Royuela, M., González-Rodríguez, Á., 2013. Replacement of fish meal with poultry by-product meal in practical diets for juvenile crayfish (Pacifastacus leniusculus Dana, Astacidae) from the onset of exogenous feeding. Aquaculture 404–405, 22–27. Gao, Y.J., Lu, S.D., Wu, M.J., Yao, W., Jin, Z.B., Wu, X.Y., 2019. Effects of dietary protein levels on growth, feed utilization and expression of growth related genes of juvenile giant grouper (Epinephelus lanceolatus). Aquaculture 504, 369–374. Gaylord, T.G., Gatlin III, D.M., 2000. Dietary lipid level but not L-carnitine affects growth performance of hybrid striped bass (Morone chrysops ♀ × M. saxatilis ♂). Aquaculture 190, 237–246. Grisdalle-Helland, B., Helland, S.J., Baeverfjord, G., Berge, G.M., 2002. Full-fat soybean meal in diets for Atlantic halibut: growth, metabolism and intestinal histology.

Acknowledgements This study was supported by a grant (no.: ZDYF2018055) from Hainan key research and development Projects and grants (no.: 31760760) from The National Natural Science Fund of China. Authors wish to thank the Editor and anonymous reviewers for their valuable suggestions for improving our manuscript. References AOAC, 1990. Official Methods of Analysis. AOAC (Association of Official Analytical Chemists). pp. 1298. Baeverfjord, G., Krogdahl, Å., 1996. Development and regression of soybean meal induced enteritis in Atlantic salmon, Salmo salar L., distal intestine: a comparison with the intestines of fasted fish. J. Fish Dis. 19 (5), 375–387. Baird, L., Dinkova-Kostova, A.T., 2011. The cytoprotective role of the Keap1-Nrf2 pathway. Arch. Toxicol. 85, 241–272. Bansemer, M.S., Forder, R.E.A., Howarth, G.S., Suitor, G.M., Bowyer, J., Stone, D.A.J., 2015. The effect of dietary soybean meal and soy protein concentrate on the intestinal mucus layer and development of subacute enteritis in Yellowtail Kingfish (Seriola lalandi) at suboptimal water temperature. Aquac. Nutr. 21 (3), 300–310.

9

Aquaculture 516 (2020) 734503

Z. Zhou, et al. Aquac. Nutr. 8, 265–270. Gu, X.H., Hao, Y., Wang, X.L., 2012. Overexpression of heat shock protein 70 and its relationship to intestine under acute heat stress in broilers: 2. Intestinal oxidative stress. Poult. Sci. 91, 790–799. Gu, M., Bai, N., Zhang, Y.Z., Krogdahl, Å., 2016. Soybean meal induces enteritis in turbot Scophthalmus maximus at high supplementation levels. Aquaculture 464, 286–295. Jiang, S.T., Wu, X.Y., Li, W.F., Wu, M.J., Luo, Y., Lu, S.D., Lin, H.R., 2015. Effects of dietary protein and lipid levels on growth, feed utilization, body and plasma biochemical compositions of hybrid grouper (Epinephelus lanceolatus♂ × Epinephelus fuscoguttatus♀) juveniles. Aquaculture 446, 148–155. Jiang, S.T., Wu, X.Y., Luo, Y., Wu, M.J., Lu, S.D., Jin, Z.B., Yao, W., 2016. Optimal dietary protein level and protein to energy ratio for hybrid grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂) juveniles. Aquaculture 465, 28–36. Kobayashi, A., Kang, M.I., Watai, Y., Tong, K.I., Shibata, T., Uchida, K., Yamamoto, M., 2006. Oxidative and electrophilic stresses activate Nrf2 through inhibition of ubiquitination activity of Keap1. Mol. Cell. Biol. 26, 221–229. Kvalseth, T.O., 1985. Cautionary note about R2. Am. Stat. 39, 279–285. Lin, X.Y., Shiau, S.Y., 2003. Dietary lipid requirement of grouper, Epinephelus malabaricus, and effects on immune responses. Aquaculture 225, 243–250. Liu, H., Jin, J., Zhu, X., Han, D., Yang, Y., Xie, S., 2017. Effect of substitution of dietary fish meal by soybean meal on different sizes of gibel carp (Carassius auratus gibelio): digestive enzyme gene expressions and activities, and intestinal and hepatic histology. Aquac. Nutr. 23 (1), 129–147. Luo, Y., Wu, X.Y., Li, W.F., Jiang, S.T., Lu, S.D., Wu, M.J., 2016. Effects of different corn starch levels on growth, protein input, and feed utilization of juvenile hybrid grouper (male Epinephelus lanceolatus × female E. fuscoguttatus). N. Am. J. Aquac. 78, 168–173. Ma, Q., 2013. Role of Nrf2 in oxidative stress and toxicity. Annu. Rev. Pharmacol. Toxicol. 53, 401–426. Mata-Sotres, J.A., Tinajero-Chavez, A., Barreto-Curiel, F., Pares-Sierra, G., Rio-Zaragoza, O.B.D., Viana, M.T., Rombenso, A.N., 2018. DHA (22:6n-3) supplementation is valuable in Totoaba macdonaldi fish oil-free feeds containing poultry by-product meal and beef tallow. Aquaculture 497, 440–451. Merrifield, D.L., Dimitroglou, A., Bradley, G., Baker, R.T.M., Davies, S.J., 2009. Soybean meal alters autochthonous microbial populations, microvilli morphology and compromises intestinal enterocyte integrity of rainbow trout, Oncorhynchus mykiss (Walbaum). J. Fish Dis. 32 (9), 755–766. Nordrum, S., Bakke-McKellep, A.M., Krogdahl, A., Buddington, R.K., 2000. Effects of soybean meal and salinity on intestinal transport of nutrients in Atlantic salmon (Salmo salar L.) and rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 125 (3), 317–335. NRC, 2011. Nutrient Requirements of Fish and Shrimp. National Academies Press, Washington, D.C., USA. O'Connell, M.A., Hayes, J.D., 2015. The Keap1/Nrf2 pathway in health and disease: from the bench to the clinic. Biochem. Soc. Trans. 43, 687–689. Rawles, S.D., Gatlin III, D.M., 1998. Carbohydrate utilization in striped bass (Morone saxatilis) and sunshine bass (M. chrysops♀× M. saxatilis♂). Aquaculture 161 (1), 201–212. Riche, M., 2015. Nitrogen utilization from diets with refined and blended poultry byproducts as partial fish meal replacements in diets for low-salinity cultured Florida

pompano, Trachinotus carolinus. Aquaculture 435, 458–466. Rijkers, G.T., Frederixwolters, E.M., Muiswinkel, W.B.V., 1980. The immune system of cyprinid fish. Kinetics and temperature dependence of antibody-producing cells in carp (Cyprinus carpio). Immunology 41, 91–97. Romarheim, O.H., Skrede, A., Penn, M., Mydland, L.T., Krogdahl, Å., Storebakken, T., 2008. Lipid digestibility, bile drainage and development of morphological intestinal changes in rainbow trout (Oncorhynchus mykiss) fed diets containing defatted soybean meal. Aquaculture 274 (2), 329–338. Rossi Jr., W., Davis, D.A., 2012. Replacement of fishmeal with poultry by-product meal in the diet of Florida pompano Trachinotus carolinus L. Aquaculture 338-341, 160–166. Shapawi, R., Ng, W.K., Mustafa, S., 2007. Replacement of fish meal with poultry byproduct meal in diets formulated for the humpback grouper, Cromileptes altivelis. Aquaculture 273, 118–126. Taguchi, K., Motohashi, H., Yamamoto, M., 2011. Molecular mechanisms of the Keap1Nrf2 pathway in stress response and cancer evolution. Genes Cells 16, 123–140. Taysse, L., Chambras, C., Marionnet, D., Bosgiraud, C., Deschaux, P., 1998. Basal level and induction of cytochrome P450, EROD, UDPGT, and GST activities in carp (Cyprinus carpio) immune organs (spleen and head kidney). Bull. Environ. Contam. Toxicol. 60, 300–305. Tibaldi, E., Hakim, Y., Uni, Z., Tulli, F., de Francesco, M., Luzzana, U., Harpaz, S., 2006. Effects of the partial substitution of dietary fish meal by differently processed soybean meals on growth performance, nutrient digestibility and activity of intestinal brush border enzymes in the European sea bass (Dicentrarchus labrax). Aquaculture 261 (1), 182–193. Tort, L., Balasch, J.C., Mackenzie, S., 2003. Fish immune system. A crossroads between innate and adaptive responses. Inmunología 22, 277–286. Unnikrishnan, U., Paulraj, R., 2010. Dietary protein requirement of giant mud crab Scylla serrata juveniles fed iso-energetic formulated diets having graded protein levels. Aquac. Res. 41, 278–294. Urán, P.A., Gonçalves, A.A., Taverne-Thiele, J.J., Schrama, J.W., Verreth, J.A.J., Rombout, J.H.W.M., 2008. Soybean meal induces intestinal inflammation in common carp (Cyprinus carpio L.). Fish Shellfish Immunol. 25 (6), 751–760. Yao, C.L., Kong, P., Wang, Z.Y., Ji, P.F., Liu, X.D., Cai, M.Y., Han, X.Z., 2009. Molecular cloning and expression of MyD88 in large yellow croaker, Pseudosciaena crocea. Fish Shellfish Immunol. 26, 249–255. Yao, W., Wu, X.Y., Gao, Y.J., Wu, M.J., Lu, S.D., Li, X.J., Dong, Y., Jin, Z.B., Zhou, Z.Y., 2018. Effects of replacing fishmeal protein by hemoglobin powder protein on growth performance, food intake, feeding-related gene expression and gut histology of hybrid grouper (Epinephelus fuscoguttatus × Epinephelus lanceolatus) juveniles. Aquaculture 488, 235–243. Zhou, Q.C., Mai, K.S., Tan, B.P., Liu, Y.J., 2005. Partial replacement of fishmeal by soybean meal in diets for juvenile cobia (Rachycentron canadum). Aquac. Nutr. 11 (3), 175–182. Zhou, Q.C., Juan Zhao, J., Li, P., Wang, H.L., Wang, L.G., 2011a. Evaluation of poultry byproduct meal in commercial diets for juvenile cobia (Rachycentron canadum). Aquaculture 322–323, 122–127. Zhou, F., Song, W., Shao, Q., Peng, X., Xiao, J., Hua, Y., Ng, W.K., 2011b. Partial replacement of fish meal by fermented soybean meal in diets for black sea bream, Acanthopagrus schlegelii, juveniles. J. World Aquacult. Soc. 42 (2), 184–197.

10