- Email: [email protected]
Entomopathogenic fungi as potential biocontrol agents of the ecto-parasitic mite, Varroa destructor, and their effect on the immune response of honey bees (Apis mellifera L.)
Journal of Invertebrate Pathology 111 (2012) 237–243
Contents lists available at SciVerse ScienceDirect
Journal of Invertebrate Pathology journal homepage: www.elsevier.com/locate/jip
Entomopathogenic fungi as potential biocontrol agents of the ecto-parasitic mite, Varroa destructor, and their effect on the immune response of honey bees (Apis mellifera L.) Mollah Md. Hamiduzzaman, Alice Sinia, Ernesto Guzman-Novoa ⇑, Paul H. Goodwin School of Environmental Sciences, University of Guelph, 50 Stone Road East, Guelph, Ontario, Canada N1G 2W1
a r t i c l e
i n f o
Article history: Received 20 April 2012 Accepted 7 September 2012 Available online 19 September 2012 Keywords: Varroa destructor Immune-related gene expression Induced resistance Hymenoptaecin Metarhizium anisopliae Beauveria bassiana
a b s t r a c t Three isolates of each of the entomopathogenic fungi, Metarhizium anisopliae, Beauveria bassiana and Clonostachys rosea, were assessed for their pathogenicity to the honey bee parasitic mite, Varroa destructor. The fungi were applied to varroa mites by immersing them in a spore solution, and then the inoculated mites were placed on honey bee brood inside capped cells. At 7 days post inoculation (dpi), the three fungi caused significant varroa mortality compared to non-inoculated mites. In brood treated only with varroa mites, expression of the honey bee genes, hymenoptaecin and poly U binding factor 68 Kd (pUf68), decreased over time, while expression of blue cheese (BlCh) and single minded (SiMd) was not affected. In brood inoculated directly only with M. anisopliae or B. bassiana, the emerged adults showed reduced weight indicating infection by the fungi, which was confirmed by observation of hyphae in the brood. Fungal infection of the brood resulted in increased expression of hymenoptaecin, pUf68 and BlCh, but not SiMd. In brood treated with varroa mites that had been inoculated with the fungi, expression of hymenoptaecin, pUf68 and BlCh, but not SiMd, was even more up-regulated. While varroa mites can suppress gene expression in honey bee brood, varroa mites infected with entomopathogenic fungi induced their expression. This may be due to a low level of fungal infection of the bee, which negated the immunosuppression by the mites. Therefore, entomopathogenic fungi could reduce varroa mite damage to honey bee brood by both infecting the parasite and preventing varroa-associated suppression of honey bee immunity. Ó 2012 Elsevier Inc. All rights reserved.
1. Introduction Beekeepers, crop growers, scientists and the general public are concerned with the mysterious die-offs of honey bee (Apis mellifera) colonies that have occurred during the last 5 years in many countries around the world. The phenomenon has been termed colony collapse disorder (CCD) in the USA. While many suspects have been suggested as causes of these losses, no clear explanation has yet been found (vanEngelsdorp et al., 2008). However, many scientists believe that it is due to a combination of factors (Stankus, 2008). One important factor associated with bee mortality is the parasitic mite, Varroa destructor. Without treatment, honey bee colonies typically die within 2 years after initial varroa infestation (De Jong et al., 1982). Thus, several synthetic miticides are used by beekeepers for their control. Although initially effective, the continuous use of these pesticides has led to the development of miticide resistance within a few years (Milani, 1999). Miticide ⇑ Corresponding author. Fax: +1 519 837 0442. E-mail address: [email protected] (E. Guzman-Novoa). 0022-2011/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.jip.2012.09.001
resistance is now widespread in Europe, USA and Canada (Elzen et al., 1998, 1999; Milani, 1999; Sprefacio et al., 2001; Elzen and Westervelt, 2002; Thompson et al., 2002; Skinner et al., 2003). A recent study showed that most (>85%) colony fatality cases during winter in Canada were significantly associated with varroa mite infestation despite colonies being treated with synthetic miticides (Guzman-Novoa et al., 2010). This suggests that mite populations are becoming more difficult to control in recent years. In addition, the use of synthetic miticides in bee hives raises the risk of contamination of honey and other hive products (Ruijter, 1995; Wallner, 1999). These disadvantages are a considerable incentive to develop new strategies for mite control that minimize miticide resistance and miticide accumulation in bee products. The ideal varroa control treatment should be environmentally friendly (i.e., limited non-target effects), varroa-selective (i.e., kills varroa at doses that are relatively harmless to bees) and should leave little to no residues in honey and wax. An alternative strategy for mite control in hives, therefore could be the use of entomopathogenic fungi as biological control agents of V. destructor. They can infect varroa, are non-toxic to humans, can be mass-cultured and occur naturally in the environment.
238
M.Md. Hamiduzzaman et al. / Journal of Invertebrate Pathology 111 (2012) 237–243
The entomopathogenic fungi, Beauveria bassiana and Metarhizium anisopliae, have been used as biocontrol agents against several insects in the genera Eurygaster and Aelia (Aquino de Muro et al., 2005), as well as cattle ticks (Frazzon et al., 2000). Application of M. anisopliae and B. bassiana to honey bee colonies has provided some degree of control against V. destructor under field conditions (Kanga et al., 2003, 2006; Meikle et al., 2007, 2008), although not in all cases (James et al., 2006). However, the relative pathogenicity of these fungi to bees and brood is largely unknown. Additionally, it would be desirable to test other fungi that have shown potential for the control of insects, such as Clonostachys rosea (Toledo et al., 2006; Vega, 2008). There are no reports thus far about whether exposure to entomopathogenic fungi can cause induction or suppression of gene expression in the honey bee. However, varroa mite parasitism can affect the expression of a number of honey bee genes (Yang and Cox-Foster, 2005; Navajas et al., 2008). For example, hymenoptaecin, which encodes an antimicrobial peptide as part of the immune system (Casteels-Josson et al., 1994), was down regulated by V. destructor parasitism (Yang and Cox-Foster, 2005). Similarly, both the genes for poly U binding factor 68Kd, pUf68, involved in pre-mRNA splicing (Foley and O’Farrell, 2004), and the basic helix-loop-helix-PAS transcription factor, SiMd, involved in locomotory behavior (Pielage et al., 2002), were down regulated by varroa mites (Navajas et al., 2008). In contrast, expression of the gene for the autophagy-linked FYVE protein, BlCh, involved in autophagasome trafficking to lysosomes and prevention of neural degeneration during aging (Finley et al., 2003), was up-regulated by varroa mite parasitism (Navajas et al., 2008). The objectives of this study were to evaluate the efficacy of selected entomopathogenic fungi as potential biocontrol agents of varroa mites on honey bee brood, and to investigate whether such entomopathogenic fungi could also detrimentally affect brood, as well as up or down regulate the expression of honey bee genes, such as those previously shown to be suppressed or induced by V. destructor parasitism. 2. Materials and methods 2.1. Collection of V. destructor Experiments were conducted at the Honey Bee Research Centre, University of Guelph, Guelph, Ontario, Canada. Adult V. destructor from heavily infested honey bee colonies that had not been treated with miticides for at least 6 months were harvested from brood cells using a fine paint brush. The harvested mites were held in Petri dishes lined with moist filter paper, and two white-eyed bee pupae collected from a non-infested colony served as the food source for the parasites. Varroa mites were used within 2 h from the time of collection. 2.2. Entomopathogenic fungal cultures From the University of Alberta Microfungi Collection, fungal isolates were obtained for M. anisopliae UAMH 4450, UAMH 9197, UAMH 9198, B. bassiana UAMH 1069, UAMH 9744 and C. rosea UAMH 7494, UAMH 9161. From the University of Guelph, C. rosea isolate EndofineÒ was provided by Dr. John Sutton, and B. bassiana isolate GHA (Botanigard 22WPÒ) was obtained from Laverlam International Corporation, Butte, MT, USA. All isolates were grown on Potato Dextrose Agar (PDA) containing 100 mg/L streptomycin sulfate at 26 °C and 80% RH. Conidia were harvested from 21day-old cultures by flooding the dishes with sterile 0.03% Tween 80 and gently scraping the surface of the culture with a soft-tipped sterile spatula. After vortexing, the conidial suspensions were fil-
tered through sterilized double cheese cloth. The conidial concentration was then adjusted to 1 108 conidia/mL in dd H2O (Shaw et al., 2002; Kanga et al., 2003; Rodriguez et al., 2009). 2.3. Honey bee brood inoculation with fungi-treated varroa mites Groups of 30 V. destructor were inoculated with the nine fungal isolates by individually immersing them in 5 mL of the conidial suspension for 10 s. The varroa mites were then dried by placing them onto filter paper in a Petri dish, which was sealed with micro-perforated Parafilm. To infest honey bee brood with varroa mites, groups of 10 newly-capped brood cells each from three brood frames obtained from a healthy colony, were colored on their outer rims with water based, non-toxic, paint markers (L551P2, Hunt Int., Mississauga, Ont., Canada). Colored capped cells containing brood were opened by cutting a thin slit approximately 2 mm long using a sterile blade, and then three fungal-inoculated V. destructor were transferred into each cell using a fine paintbrush. The slit was resealed by lightly brushing it with liquid beeswax. As the control, 30 varroa mites were used per replicate that had been immersed in dd H2O before introducing them into brood cells. The three frames were placed inside screened cages in an incubator at 33–35 °C and 80% RH for 10 days. Varroa mite mortality in each inoculated cell was recorded every 48 h by cutting open the cell cap as described above, removing the brood with a fine forceps and examining for dead mites. A mite was considered dead if it did not move after being probed with a pin. If a mite was alive, it was then transferred to another cell containing live brood in the same frame, and the cell was sealed and marked. Dead varroa mites retrieved from the treated cells were surface sterilized in 90% ethanol, cultured on PDA with streptomycin, and incubated for 36 h at 26 °C and 80% RH. The presence of mycelia growing from a varroa mite cadaver indicated fungal-caused mortality. The experiment was replicated three times for a total of 300 mites. Test frames were examined daily for emerged worker bees, which were swept off the frames to prevent them from removing brood in infested cells. 2.4. Honey bee brood inoculation with selected fungal isolates Inoculation of honey bee brood with M. anisopliae UAMH 9198 or B. bassiana GHA, selected for their high pathogenicity to varroa mites from the previously described experiment, was done by collecting three brood frames containing newly capped cells and incubating them overnight at 33–35 °C and 60% RH. Rows of brood cells on each side of each frame were transected and color-coded as described above, with each color corresponding to a fungal isolate or control treatment. Each transect was randomly assigned to be inoculated with 5 lL of the conidial suspension of B. bassiana, M. anisopliae or water. Each fungal treatment was applied to 30 brood in newly capped cells that were opened and resealed as previously mentioned. The brood cells were covered with a wire mesh screened cage that was manually embedded on the comb to capture the bees emerging from the treated cells. The frames were returned to the incubator and observed for bee emergence. Hatched bees were removed and held in feeding cages (12.7 8.5 14.5 cm) provided with water and sucrose syrup in gravity feeding bottles. Total number of bees that emerged and brood mortality (i.e., brood that did not hatch) were recorded. Body weights of emerged adult bees were determined for bees anesthetized using carbon dioxide. To determine the timing and extent of fungal colonization of the honey bee brood, cells were uncapped, and inoculated brood were removed with a fine forceps at 1 and 7 days post-inoculation (dpi). They were then washed with 90% ethanol and transferred to microscope slides where they were crushed and stained with lac-
239
M.Md. Hamiduzzaman et al. / Journal of Invertebrate Pathology 111 (2012) 237–243
tophenol cotton blue to observe spores and hyphae in different tissues under the microscope (Celestron LCD Deluxe Digital Microscope, Torrance, CA, USA) at 100. Twenty brood were examined (ten inoculated with M. anisopliae and ten inoculated with B. bassiana). 2.5. Expression of immune-related genes in honey bee brood The expression of hymenoptaecin was determined at 0 h, 1, 2, 5 and 7 dpi, and expression of pUf68, BlCh, and SiMd was measured at 7 dpi. For each measurement, individual brood cells were opened to introduce a single fungal-treated or non-treated V. destructor, re-sealed after inoculation and color coded as described above. Brood inside cells were also directly inoculated with M. anisopliae UAMH 9198 or B. bassiana GHA by placing 5 lL of the conidial suspension on their bodies and then re-sealing the cells without introducing a mite. Fifteen re-sealed brood cells were prepared per treatment and time point in each of three brood frames and incubated as above. For the control, cells were opened and re-sealed without introducing varroa mites or the fungi. For RNA extraction, the cells were opened, and the brood were removed and individually stored at 70 °C in 1.5 mL Eppendorf tubes. Three replications were conducted. 2.6. RNA extraction and cDNA synthesis Total RNA was extracted by homogenizing five frozen brood in extraction buffer as per Chen et al. (2000). The homogenates were extracted twice with chloroform, and the RNA was precipitated using LiCl (Sambrook et al., 1989). The amount of total RNA extracted was determined with a spectrophotometer (Nanovue GE Healthcare, Cambridge, UK). For cDNA synthesis, 2 lg of total RNA was reverse-transcribed using Oligo (dT)18 and M-MuLV RT with the RevertAidTM H Minus First Strand cDNA Synthesis Kit (Fermentas Life Sciences, Burlington, Ontario), following the instructions of the manufacturer.
conditions for pUf68, BlCh and SiMd, were 94 °C for 3 min, followed by 35 cycles of 30 s at 94 °C, 60 s at 55 °C and 60 s at 72 °C, and a final extension step at 72 °C for 10 min. Amplification conditions for hymenoptaecin were the same, except that the annealing temperature was 58 °C. 2.8. Separation and semi-quantification of PCR products PCR products were separated by electrophoresis in 1.1% agarose gels and stained with ethidium bromide. A 100 bp DNA ladder (Bio Basic Inc., Markham, Ontario) was used. The intensity of the amplified bands was measured in pixels using the Scion Image (Scion Corporation, Frederick, MD, USA) as per Dean et al. (2002). The ratio of band intensity between the target gene and the house-keeping gene was calculated to determine relative expression. To determine that the number of amplification cycles was not too great for relative quantification, samples were also amplified with three fewer PCR cycles, and the bands were again quantified. A similar ratio of band intensity between the target gene and the house-keeping gene was observed in all samples. 2.9. Statistical analysis Percent mite mortality or bee emergence caused by the fungi tested was calculated, arcsine square root transformed, and subjected to analysis of variance (ANOVA) using a completely randomized design. Data on gene expression were also subjected to ANOVA. Significant differences among means were separated with Fisher’s protected LSD or Tamhane’s T2 tests (a = 0.05). To obtain descriptive statistics and perform ANOVAS, the package IBM-SPSS v. 19 (SPSS Inc., Chicago, IL, USA) was used.
3. Results 3.1. Effect of entomopathogenic fungi on varroa mites
2.7. PCR reactions All PCR reactions were done with a Mastercycler (Eppendorf, Mississauga, Ontario). Each 15 lL of reaction contained 1 lL cDNA, 1.5 lL 10 PCR buffer (New England BioLabs, Pickering, Ontario), 0.5 lL 10 mM dNTPs (Bio Basic Inc., Markham, Ontario), 1 lL 10 lM of forward and reverse primers for the honey bee ribosomal protein RpS5 gene (Thompson et al., 2007) and for one gene of interest (Laboratory Services, University of Guelph), 0.2 lL 5U/lL Taq polymerase (New England BioLabs, Pickering, Ontario), and 7.8 lL of dd H2O. Primer sequences are listed in Table 1. Primers were designed using Gene Runner (Version 3.05, Hastings Software, Inc., NY, USA) and supplied by Laboratory Services of the University of Guelph (Guelph, Ontario, Canada). Amplification
Isolates UAMH 4450, UAMH 9197 and UAMH 9198 of M. anisopliae, isolates UAMH 1069, UAMH 9744 and GHA of B. bassiana and isolates UAMH 7494, UAMH 9161 and Endofine of C. rosea, all caused significant mortality following inoculation of V. destructor by 7 dpi (Fig. 1; F9,20 = 4.29; P < 0.05). The presence of mycelia on all the fungal-inoculated, surface-sterilized, varroa mite cadavers indicated that the dead mites had been colonized by the fungi. Seven of the isolates killed more than 50% of the varroa mites, but C. rosea isolates UAMH 7494 and Endofine caused less than 50% mite mortality. The three most pathogenic isolates were M. anisopliae UAMH 9197, M. anisopliae UAMH 9198 and B. bassiana GHA, which were the only isolates to cause more than 90% mite mortality. The two last isolates were used in all further experiments.
Table 1 List of primers used to amplify hymenoptaecin, pUf68, BlCh, SiMd and RpS5. Gene name
Primer sequence (50 to 30 )
Gene ID
Band size
Reference
Hymenopt-F Hymenopt-R pUf68-F pUf68-R BlCh-F BlCh-R SiMd-F SiMd-R RpS5-F RpS5-R
CTCTTCTGTGCCGTTGCATA GCGTCTCCTGTCATTCCATT CAAGACCTCCAACTAGCATG CAACAGGTGGTGGTGGTG GTGCTTGGGTTAGGATGTGTAC GTTAATCTTCTTCCGCTACTG GACAACAATTCCACTTCAGAC CAAGTAACTGGTCGTCAATCG AATTATTTGGTCGCTGGAATTG TAACGTCCAGCAGAATGTGGTA
GB17538
200 bp
Evans (2006)
GB13651
201 bp
This study
GB10249
218 bp
This study
GB11417
252 bp
This study
GB11132
115 bp
Thompson et al. (2007)
Note: F, forward primer and R, reverse primer.
240
M.Md. Hamiduzzaman et al. / Journal of Invertebrate Pathology 111 (2012) 237–243
Fig. 1. Mean percent mortality (±SE) of V. destructor inoculated with 1 108 conidia/mL of isolates UAMH 4450, UAMH 9197 and UAMH 9198 of Metarhizium anisopliae, UAMH 1069, UAMH 9744 and GHA of Beauveria bassiana and UAMH 7494, 9161 and EndofineÒ of Clonostachys rosea. Different letters indicate significant differences of means based on analyses of variance and Fisher’s protected LSD tests performed on arcsine square root transformed data. Non-transformed values are presented.
Table 2 Effect of M. anisopliae UAMH 9198 and B. bassiana GHA on honey bee emergence and body weight. Newly capped brood were inoculated with 5 lL of a 1 108 conidia/mL of either fungi, and the percentage of honey bees that emerged or died inside the cells was determined at 12 dpi. The weight of bees was determined after emergence. Treatment
% Emergence (±SE)
% Mortality (±SE)
Body weight (mg ± SE)
Control M. anisopliae B. bassiana
100 ± 0.0a 75.83 ± 6.8ab 40.83 ± 4.6b
0.0 ± 0.0b 24.17 ± 6.8ab 59.17 ± 4.6a
102 ± 4a 89 ± 1b 86 ± 1b
Different letters indicate significant differences of means based on analyses of variance and Fisher’s protected LSD tests performed on arcsine square root transformed data.
3.2. Effect of entomopathogenic fungi on honey bee brood Brood directly inoculated with M. anisopliae UAMH 9198 or mock inoculated with water had similar emergence into adult bees at 12 dpi, but inoculation of brood with B. bassiana GHA caused a significant reduction in adult bee emergence (Table 2). However, both fungi had a detrimental effect on development as the newly emerged bees from brood treated with either M. anisopliae UAMH 9198 or B. bassiana GHA weighed significantly less than bees from the control group at 12 dpi (F2,57 = 15.30; P < 0.05) (Table 2).
Fig. 3. Effect of V. destructor infestation on the expression of the immune-related gene, hymenoptaecin, in honey bee brood. RNA transcripts were quantified by RTPCR from brood artificially-infested with varroa mites at different time points. A, co-amplification of the PCR products specific for hymenoptaecin and the housekeeping gene, RpS5, used to estimate relative expression. Lane 1 shows the control treatment (brood without mites) at 0 h, while lanes 2, 3, 4, and 5, show bands at 1, 2, 5, and 7 dpi, respectively. Lane 6 shows another control treatment (brood without mites) at 7 dpi, whereas lane 7 is a control with no DNA. Lane M (far left) is a 100 bp DNA ladder. B, relative expression of hymenoptaecin in brood infested with varroa mites at the same time points described in part A. Numbers for each column match those of the lanes in the picture of the PCR products immediately above it. Values presented are means ± SE. Different letters indicate significant differences of means based on analyses of variance and Tamhane’s T2 test.
Reduced emergence was related to higher brood mortality associated with fungal inoculation compared to the control (F2,6 = 39.01; P < 0.05) (Table 2). At 1 dpi, all brood inoculated with M. anisopliae UAMH 9198, B. bassiana GHA, or control, showed no visible fungal colonization of the haemolymph or tissues when the brood were crushed and examined microscopically. At 7 dpi for live brood, both fungi showed varying degrees of colonization of the haemolymph and tissues. Greater amounts of hyphae were observed for B. bassiana GHA than for M. aniospliae UAMH 9198, particularly in tissues like the basement membrane of the cuticle. However, the center of the body of live brood was barely colonized by either fungus. At 7 dpi for dead brood, haemolymph and all tissues (particularly the abdomen and basement membrane of the cuticle) showed extensive colonization by B. bassiana GHA or M. aniospliae UAMH 9198 when examined microscopically (Fig. 2). No sporulation was ever observed in either live or dead inoculated brood, and no fungal colonization was ever observed in mock-inoculated control brood. 3.3. Effect of varroa mites and entomopathogenic fungi on gene expression in honey bee brood Infestation of honey bee brood by varroa mites resulted in lower expression of hymenoptaecin compared to the control. Expression
Fig. 2. Example images of the abdomen of honey bee brood at 7 dpi with a 5 lL conidial suspension (1 108 conidia/mL) of B. bassiana GHA, or M. anisopliae UAMH 9198. Brood were crushed, stained with lactophenol cotton blue and examined for hyphae and spores under a microscope at 100 power.
M.Md. Hamiduzzaman et al. / Journal of Invertebrate Pathology 111 (2012) 237–243
241
Fig. 4. Effect of B. bassiana GHA and M. anisopliae UAMH 9198 on the expression of hymenoptaecin, pUf68, BlCh and SiMd in brood artificially infested with V. destructor at 7 dpi. RNA transcripts were quantified by RT-PCR. Parts A, C, E and G show gel pictures of the PCR products for hymenoptaecin, pUf68, BlCh and SiMd, respectively, along with the house-keeping gene, RpS5, used to estimate relative expression. Samples in lanes 1, 2, 3, 4, 5 and 6, correspond to brood without mites or fungi, infested with varroa mites only, inoculated with B. bassiana, inoculated with M. anisopliae, infested with varroa mites inoculated with B. bassiana, and infested with varroa mites inoculated with M. anisopliae, respectively. Lane 7 is a control with no DNA. Lane M is a 100 bp DNA ladder. Parts B, D, F and H show the quantification of the relative expression of hymenoptaecin, pUf68, BlCh or SiMd, respectively, compared to RpS5. Numbers for each column match those of the lanes in the picture of the PCR products immediately above it. Values presented are means ± SE. Different letters indicate significant differences of means based on analyses of variance and Fisher’s protected LSD tests.
declined most rapidly at 1 dpi, which was followed by another major drop at 5 dpi and then remained low at 7 dpi (Fig. 3A and B). At 7 dpi, however, expression of hymenoptaecin was higher in brood directly inoculated with either B. bassiana or M. anisopliae compared to varroa-infested brood or the control (Fig. 4A and B). Thus, fungal parasitism of the brood appeared to have induced hymenoptaecin expression, while varroa mite parasitism suppressed it. The highest expression of hymenoptaecin was observed when brood was exposed to varroa mites that had been inoculated with either B. bassiana or M. anisopliae. The induced expression by fungal-infected varroa mites appeared to be due to non-feeding (i.e., dead) mites attached to the brood because all V. destructor inoculated with B. bassiana or M. anisopliae were dead by 7 dpi, while all mock infested mites were still alive. Expression of pUf68 (Fig. 4C and D) in varroa-infested brood was also significantly lower than the control at 7 dpi, but expression of BlCh (Fig. 4E and F) and SiMd (Fig. 4G and H) was not significantly different. Similar to hymenoptaecin, expression of pUf68 and BlCh was significantly greater than the control at 7 dpi for brood inoculated with B. bassiana or M. anisopliae. Also like hymenoptaecin, expression of pUf68 and BlCh was highest at 7 dpi for brood infested with varroa mites that had been inoculated with B. bassiana or M. anisopliae. In contrast, expression of SiMd was not significantly affected in any of the treatments.
4. Discussion V. destructor has been reported to be susceptible to the entomopathogenic fungi, M. anisopliae, B. bassiana, Verticillium lecanii,
Hirsutella spp. (Chandler et al., 2000, 2001; Shaw et al., 2002), Hirsutella thompsonii (Peng et al., 2002), B. bassiana and M. anisopliae (Rodriguez et al., 2009). The findings of this study confirm that B. bassiana and M. anisopliae are highly pathogenic to varroa mites with several isolates causing more than 90% mite mortality, and thus they have the potential to be biocontrol agents of these parasites. However, C. rosea showed more limited pathogenicity against varroa mites, with none of the isolates tested killing more than 60% of the mites. This is the first report of inoculating varroa mites with C. rosea. One concern with the use of entomopathogenic fungi to control varroa mites is that they will also be pathogenic to honey bee brood. Previous studies have shown that adult honey bees inoculated with spores of B. bassiana or M. anisopliae by directly applying the spores onto their bodies had significantly higher mortality than non-inoculated bees (Alves et al., 1996; Al Mazraawi, 2007). B. bassiana may also infect honey bee brood as it sporulated on inoculated brood under laboratory conditions (Meikle et al., 2006). In another study, Boyle (2008) showed that inoculation with spores of M. anisopliae resulted in <50% adult bee emergence from treated brood cells, demonstrating high mortality. Boyle (2008) inoculated the brood using a different method to the one used in this study (i.e., injecting spores into unopened cells), which could have also caused mortality due to unintentional piercing of the brood. However, when spores of B. bassiana were sprayed inside hives, adult bee mortality did not differ from control treatments (Meikle et al., 2008; Al Mazraawi, 2007). The method of inoculation in this study (i.e., direct application of spores to the brood body) was similar to that of Alves et al. (1996) and Al Mazraawi (2007), and so increased mortality of the brood is not surprising. While both B.
242
M.Md. Hamiduzzaman et al. / Journal of Invertebrate Pathology 111 (2012) 237–243
bassiana and M. anisopliae caused greater brood mortality in this study relative to the control, the increase was only significant for B. bassiana. However, both fungi had a negative effect on the brood because they both reduced the body weight of the bees that emerged. Considering the range of virulence of the different isolates to varroa mites, it could be expected that the higher brood mortality rates reported by Boyle (2008) compared to our study for M. anisopliae may be related to the virulence of the fungal isolates used. Inoculation of brood by entomopathogenic fungi induced expression of hymenoptaecin, pUf68 and BlCh, but not SiMd. This suggests that B. bassiana and M. anisopliae not only acted as biocontrol agents against varroa mites, but also caused an infection in the brood. Crushing bees and observing hyphae inside their bodies showed that the fungi had penetrated the cuticle of the brood, resulting in limited colonization of live brood but extensive colonization of brood that had died. The entomopathogenic fungal infection appears to have triggered the immune system of the bee brood. Another example of this outcome is B. bassiana infection of the mosquito, Aedes aegypti, which induced expression of the defense-related genes, attacin, cecropin G, defensin A and C, and diptericin (Dong et al., 2012). However, not all defense-related genes of the mosquito were up-regulated, such as lysozyme C, which is similar to this study where there was no effect of fungal infection on expression of SiMd in the honey bee brood. In contrast to fungal infection, varroa parasitism of the brood resulted in down regulation of hymenoptaecin and pUf68, although it did not significantly affect expression of BlCh and SiMd. Other evidence for suppression of honey bee gene expression by varroa parasitism is that hymenoptaecin, pUf68 and SiMd were down-regulated by varroa infestation of adult honey bees (Yang and CoxFoster, 2005; Navajas et al., 2008). However, expression of BlCh was reported to be up-regulated in adult honey bees infested by V. destructor (Navajas et al., 2008). This study used brood rather than adult bees, which may explain why the response of SiMd and BlCh were different. Expression of hymenoptaecin, pUf68 and BlCh showed different responses to parasitism by varroa mites and entomopathogenic fungi. The down regulation of gene expression for hymenoptaecin and pUf68 in brood infested only with V. destructor in this study, indicates that suppression of honey bee gene expression could be a result of varroa effector-triggered susceptibility (ETS). This could be similar to ETS resulting from putative effectors in the larval salivary secretions of the Hessian fly (Mayetiola destructor) that down regulates host genes and induces susceptibility in wheat, thus increasing production of plant nutrients for the larvae (Williams et al., 2011). Other studies have also shown that parasitism by varroa mites suppressed genes for antimicrobial peptides, such as abaecin and defensin, as well as genes for phenoloxidase, glucose dehydrogenase, glucose oxidase and lysozyme, which are all defense-related enzymes (Gregory et al., 2005; Yang and Cox-Foster, 2005; Navajas et al., 2008). Therefore, successful varroa mite parasitism may require suppression of honey bee defense and stress-response gene expression, to avoid or suppress parasite/pathogen associated molecular pattern (PAMP)–triggered immunity (PTI) in honey bees, which could be caused by the mite while feeding on the bee. In contrast, both B. bassiana and M. anisopliae appear to induce PTI in honey bee brood, which is the first report of this effect by entomopathogenic fungi in honey bees. Surprisingly, inoculation of brood with varroa mites along with the fungi in the same cell resulted in the highest gene expression for hymenoptaecin, pUf68 and BlCh. It is possible that the brood were responding to a greater infection by B. bassiana and M. anisopliae as the fungi were growing on both the mite and brood. However, another explanation is that co-inoculation of brood with varroa mites along with the fungi may have negated the ETS by
V. destructor due to the fungi inducing PTI, which resulted in even higher honey bee gene expression than fungal infection alone. If correct, then fungal-induced PTI would permit the honey bee to better defend itself against varroa mite parasitism. Further work is needed to determine if induction of honey bee defenses contributes to the biological control of varroa mites by entomopathogenic fungi. The mechanism through which V. destructor inhibits expression of honey bee genes is unknown, but it might be due to effectors entering the haemolymph of the bee through the mite’s saliva when it penetrates the cuticle of the brood to feed upon the host’s haemolymph. Immune inhibition has been observed in mites belonging to the same order as V. destructor (Parasitiformes), such as the deer tick (Ixodes scapularis) and Western black-legged tick (I. pacificus), that immunosuppress their mammalian hosts with salivary secretions by inhibiting immune cell signaling and activation (Schorderet and Brossard, 1993; MacNair et al., 2009). The saliva of V. destructor contains at least 15 proteins, some of which could be acting as effectors causing ETS in honey bees (Richards et al., 2011). A functional genomics approach, analogous to what was done to identify the biological activity of salivary proteins using aphid (Myzus persicae) salivary gland expressed sequence tags, could be used to identify the V. destructor effectors (Bos et al., 2010). Our results show that entomopathogenic fungi, such as B. bassiana and M. anisopliae, can control varroa mites. However, the beneficial effects of these fungi on honey bee health may be outweighed by their detrimental impact on brood development, both in mortality and reduced body weight of the emerged adult bees. These effects must be a consideration in the development of such biocontrol agents. However, this study also shows that isolates of entomopathogenic fungi can differ considerably in their virulence to different organisms. M. anisopliae UAMH 9198 caused 93% mortality to varroa mites, while only 24% mortality to honey bee brood. Perhaps strains of B. bassiana and M. anisopliae can be found that have even higher mortality to varroa mites with lower mortality as well as less of an effect on honey bee body weight. This study also indicates that PTI occurs in honey bees. Thus, the possible triggers of PTI in brood could be isolated from B. bassiana or M. anisopliae, and then these PAMPs could be applied to brood to induce defense gene expression to determine if that would help reduce the ability of varroa to parasitize bees. Acknowledgments We thank Paul Kelly for managing the colonies and for supplying the brood and mites used in these experiments. We also thank John Sutton for supplying one fungal isolate. This study was partially funded by a NSERC discovery Grant to EG, by a NSERC strategic Grant to P. Kevan (NSERC-CANPOLIN) and by a Grant from the agreement between the University of Guelph and the Ontario Ministry of Agriculture, Food and Rural Affairs to EG. This is publication # 61 of NSERC-CANPOLIN. References Al Mazraawi, M.S., 2007. Impact of the entomopathogenic fungus Beauveria bassiana on the honey bees, Apis mellifera L (Hymenoptera: Apidae). World J. Agric. Sci. 3, 7–11. Alves, S.B., Marchinin, L.C., Pereira, R.M., Baumgratz, L., 1996. Effects of some insect pathogens on the Africanized honey bees Apis mellifera L (Hymenoptera: Apidae). J. Appl. Entomol. 120, 559–564. Aquino de Muro, M., Elliott, S., Moore, D., Parker, B.L., Skinner, M., Reid, W., ElBouhssini, M., 2005. Molecular characterization of Beauveria bassiana isolates obtained from overwintering sites of Sunn Pests (Eurygaster and Aelia species). Mycol. Res. 109, 294–306. Bos, J.I.B., Prince, D., Pitino, M., Maffei, M.E., Win, J., Hogenhout, S.A., 2010. A functional genomics approach identifies candidate effectors from the aphid species Myzus persicae (Green Peach Aphid). PLoS Genet. 6, e1001216.
M.Md. Hamiduzzaman et al. / Journal of Invertebrate Pathology 111 (2012) 237–243 Boyle, D. 2008. Integrated pest management-compatible biological control of varroa mite of honey bee. MicroBiologicals (MMB1). Casteels-Josson, K., Zhang, W., Capaci, T., Casteels, P., Tempst, P., 1994. Acute transcriptional response of the honeybee peptide-antibiotics gene repertoire and required post-translational conversion of the precursor structures. J. Biol. Chem. 269, 28569–28575. Chandler, D., Dadidson, G., Pell, J., Vall, B., Shaw, K., Sunderland, K., 2000. Fungal biocontrol of acari. Biocontrol Sci. Technol. 10, 357–384. Chandler, D., Sunderland, K.D., Ball, B.V., Davison, G., 2001. Prospective biological control agents of Varroa destructor n. sp., an important pest of the European honey bee, Apis mellifera. Biocontrol Sci. Technol. 11, 429–448. Chen, C.Y.J., Jin, S., Goodwin, P.H., 2000. An improved method for the isolation of total RNA from Malva pusilla tissues infected with Colletotrichum qloeosporioides. J. Phytopathol. 148, 57–60. Dean, J.D., Goodwin, P.H., Hsiang, T., 2002. Comparison of relative RT-PCR and Northern blot analyses to measure expression of ß-1,3-glucanase in Nicotiana benthamiana infected with Colletotrichum destructivum. Plant Mol. Biol. Report. 20, 347–356. De Jong, D., De Jong, P.H., Goncales, L.S., 1982. Weight loss and other damage to developing worker honey bees from infestation with Varroa jacobsoni. J. Apic. Res. 21, 165–167. Dong, Y., Morton Jr., J.C., Ramirez, J.L., Souza-Neto, J.A., Dimopoulos, G., 2012. The entomopathogenic fungus Beauveria bassiana activate toll and JAK-STAT pathway-controlled effector genes and anti-dengue activity in Aedes aegypti. Insect Biochem. Mol. Biol. 42, 126–132. Elzen, P.J., Baxter, J.R., Spivak, M., Wilson, W.T., 1999. Amitraz resistance in varroa: new discovery in North America. American Bee J. 139, 362. Elzen, P.J., Eischen, F.A., Baxter, J.B., Pettis, J., Elzen, G.W., Wilson, W.T., 1998. Taufluvalinate resistance in Varroa jocobsoni from several geographic locations. American Bee J. 138, 674–676. Elzen, P.J., Westervelt, D., 2002. Detection of coumaphos resistance in Varroa destructor in Florida. American Bee J. 142, 291–292. Evans, J.D., 2006. Beepath: an ordered quantitative-PCR array for exploring honey bee immunity and disease. J. Invertebr. Pathol. 93, 135–139. Finley, K.D., Edeen, P.T., Cumming, R.C., Mardahl-Dumesnil, M.D., Taylor, B.J., Rodriguez, M.H., Hwang, C.E., Benedetti, M., McKeown, M., 2003. Blue cheese mutations define a novel, conserved gene involved in progressive neural degeneration. J. Neurosci. 23, 1254–1264. Foley, E., O’Farrell, P.H., 2004. Functional dissection of an innate immune response by a genome-wide RNAi screen. PLoS Biol. 2, 1091–1106. Frazzon, A.P.G., Da Silva, V.J.I., Masuda, A., Schrank, A., Vainstein, M.H., 2000. In vitro assessment Metarhizium anisopliae isolates to control the cattle tick Boophilus microplus. Vet. Parasitol. 94, 117–125. Gregory, P.G., Evans, J.D., Rinderer, T., Guzman, L., 2005. Conditional immune-gene suppression of honey bees parasitized by Varroa mites. J. Insect Sci. 5, 1–5. Guzman-Novoa, E., Eccles, L., Calvete, Y., McGowan, J., Kelly, P.G., Correa- Benitez, A., 2010. Varroa destructor is the main culprit for the death and reduced populations of overwintered honey bee (Apis mellifera) colonies in Ontario, Canada. Apidologie 41, 443–450. James, R.R., Hayes, G., Leland, J.E., 2006. Field trials on the microbial control of varroa with the fungus Metarhizium anisopliae. Am. Bee J. 146, 968–972. Kanga, L.H.B., Jones, W.A., James, R.R., 2003. Field trials using the fungal pathogen, Metarhizium anisopliae (Deuteromycetes: Hyphomycetes) to control the ectoparasitic mite, Varroa destructor (Acari: Varroidae) in honey bees, Apis mellifera (Hymenoptera: Apidae) colonies. J. Econ. Entomol. 96, 1091–1099. Kanga, L.H.B., Jones, W.A., Garcia, C., 2006. Efficacy of strips coated with Metarhizium anisopliae for control of Varroa destructor (Acari: Varroidae) in honey bee colonies in Texas and Florida. Exp. Appl. Acarol. 40, 249–258. MacNair, C.M., Nisbet, A.J., Billingsley, P.F., Knox, D.P., 2009. Molecular characterization, expression and localization of a peroxiredoxin from the sheep scab mite, Psoroptes ovis. Parasitology 136, 453–460. Meikle, W.G., Mercadier, G., Girod, V., Derouané, F., Jones, W.A., 2006. Evaluation of Beauveria bassiana (Balsamo) Vuillemin (Deuteromycota: Hyphomycetes) strains isolated from varroa mites in southern France. J. Apicult. Res. 45, 219–220. Meikle, W.G., Mercadier, G., Holst, N., Nansen, C., Girod, V., 2007. Duration and spread of an entomopathogenic fungus, Beauveria bassiana (Balsamo) Viullemin (Deuteromycota: Hyphomycetes) used to treat varroa mites, Varroa destructor
243
Anderson and Trueman (Acari: Varroidae), in honey bee colonies. J. Econ. Entomol. 100, 1–10. Meikle, W.G., Mercadier, G., Holst, N., Nansen, C., Girod, V., 2008. Impact of two treatments of a formulation of Beauveria bassiana (Deuteromycota: Hyphomycetes) conidia on varroa mites (Acari: Varroidae) and on honey bee (Hymenoptera: Apidae) colony health. Exp. Appl. Acarol. 46, 105–177. Milani, N., 1999. The resistance of Varroa jacobsoni Oud. to acaricides. Apidologie 30, 229–234. Navajas, M., Migeon, A., Alaux, C., Martin-Magniette, M.L., Robinson, G.E., Evans, J.D., Cros-Arteil, S., Crauser, D., Le Conte, Y., 2008. Differential gene expression of the honey bee Apis mellifera associated with Varroa destructor infection. BMC Genom.. http://dx.doi.org/10.1186/1471-2164-9-301) 9, 301. Peng, Y.S.C., Zhou, X., Kaya, K.H., 2002. Virulence and site infection of the fungus, Hirsutella thompsonii, to the honey bee ectoparasite mite, Varroa destructor. J. Invert. Pathol. 81, 185–195. Pielage, J., Steffes, G., Lau, D.C., Parente, B.A., Crews, S.T., Strauss, R., Klambt, C., 2002. Novel behavioral and developmental defects associated with Drosophila singleminded. Dev. Biol. 249, 283–299. Richards, E.H., Jones, B., Bowman, A., 2011. Salivary secretions from the honeybee mite, Varroa destructor: effects on insect haemocytes and preliminary biochemical characterization. Parasitology 138, 602–608. Rodriguez, M., Gerding, M., France, A., 2009. Selection of entomopathogenic fungi to control Varroa destructor (Acari: Varroidae). Chilean J. Agric. Res. 69, 534–540. Ruijter, A., 1995. Issues in the control of varroa infestation. In: Matheson, A. (Ed.), New Perspectives on Varroa. International Bee Research Association, Cardiff, UK, pp. 24–26. Sambrook, J., Fritsch, E.F., Maniatis, T. 1989. Molecular cloning: a laboratory manual, second ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA. Schorderet, S., Brossard, M., 1993. Changes in immunity to Ixodes ricinus by rabbits infested at different levels. Med. Vet. Entomol. 7, 186–192. Shaw, K.E., Davidson, G., Clark, S.J., Ball, B.V., Pell, J.K., Chandler, D., Sunderland, K.D., 2002. Laboratory bioassays to assess the pathogenicity of mitosporic fungi of Varroa destructor (Acari: Mesostigmata), an ectoparasitic mite of honey bee Apis mellifera. Biol. Control 24, 266–276. Skinner, A., Tam, J., Melin, S., 2003. Monitoring for fluvalinate resistant varroa mites and coumaphos efficacy trials in honey bee colonies in Ontario. The Sting 21, 23–25. Sprefacio, M., Eordegh, F.R., Bernardinelli, I., Colombo, M., 2001. First detection of strains of Varroa destructor resistant to coumaphos. Results of laboratory tests and field trials. Apidologie 32, 49–55. Stankus, T., 2008. A review and bibliography of the literature of honey bee Colony Collapse Disorder: a poorly understood epidemic that clearly threatens the successful pollination of billions of dollars of crops in America. J. Agr. Food Inform. 9, 115–143. Thompson, H.M., Brown, M.A., Ball, R.F., Bew, M.H., 2002. First report of Varroa destructor resistance to pyrethroids in UK. Apidologie 33, 357–366. Thompson, G.J., Yockey, H., Lim, J., Oldroyd, B.P., 2007. Experimental manipulation of ovary activation and gene expression in honey bee (Apis mellifera) queens and workers: testing hypotheses of reproductive regulation. J. Exp. Zool. 307A, 600– 610. Toledo, A.V., Virla, E., Humber, R.A., Paradell, S.L., Lastra, C.C.L., 2006. First record of Clonostachys rosea (Ascomycota: Hypocreales) as an entomopathogenic fungus of Oncometopia tucumana and Sonesimia grossa (Hemiptera: Cicadellidae) in Argentina. J. Invertebr. Pathol. 92, 7–10. vanEngelsdorp, D., Hayes, J., Underwood, R.M., Pettis, J., 2008. A survey of honey bee colony losses in the US, fall 2007 to spring 2008. PloS ONE 3, 1–6. Vega, F.E., 2008. Insect pathology and fungal endophytes. J. Invertebr. Pathol. 98, 277–279. Wallner, K., 1999. Varroacides and their residues in bee products. Apidologie 30, 235–248. Williams, C.E., Nemacheck, J.A., Shukle, J.T., Subramanyam, S., Saltzmann, K.D., Shukle, R.H., 2011. Induced epidermal permeability modulates resistance and susceptibility of wheat seedlings to herbivory by Hessian fly larvae. J. Exp. Botany 62, 4521–4531. Yang, X., Cox-Foster, D.L., 2005. Impact of an ectoparasite on the immunity and pathology of an invertebrate: evidence for host immunosuppression and viral amplification. Proc. Natl. Acad. Sci. USA 102, 7470–7475.
Contents lists available at SciVerse ScienceDirect
Journal of Invertebrate Pathology journal homepage: www.elsevier.com/locate/jip
Entomopathogenic fungi as potential biocontrol agents of the ecto-parasitic mite, Varroa destructor, and their effect on the immune response of honey bees (Apis mellifera L.) Mollah Md. Hamiduzzaman, Alice Sinia, Ernesto Guzman-Novoa ⇑, Paul H. Goodwin School of Environmental Sciences, University of Guelph, 50 Stone Road East, Guelph, Ontario, Canada N1G 2W1
a r t i c l e
i n f o
Article history: Received 20 April 2012 Accepted 7 September 2012 Available online 19 September 2012 Keywords: Varroa destructor Immune-related gene expression Induced resistance Hymenoptaecin Metarhizium anisopliae Beauveria bassiana
a b s t r a c t Three isolates of each of the entomopathogenic fungi, Metarhizium anisopliae, Beauveria bassiana and Clonostachys rosea, were assessed for their pathogenicity to the honey bee parasitic mite, Varroa destructor. The fungi were applied to varroa mites by immersing them in a spore solution, and then the inoculated mites were placed on honey bee brood inside capped cells. At 7 days post inoculation (dpi), the three fungi caused significant varroa mortality compared to non-inoculated mites. In brood treated only with varroa mites, expression of the honey bee genes, hymenoptaecin and poly U binding factor 68 Kd (pUf68), decreased over time, while expression of blue cheese (BlCh) and single minded (SiMd) was not affected. In brood inoculated directly only with M. anisopliae or B. bassiana, the emerged adults showed reduced weight indicating infection by the fungi, which was confirmed by observation of hyphae in the brood. Fungal infection of the brood resulted in increased expression of hymenoptaecin, pUf68 and BlCh, but not SiMd. In brood treated with varroa mites that had been inoculated with the fungi, expression of hymenoptaecin, pUf68 and BlCh, but not SiMd, was even more up-regulated. While varroa mites can suppress gene expression in honey bee brood, varroa mites infected with entomopathogenic fungi induced their expression. This may be due to a low level of fungal infection of the bee, which negated the immunosuppression by the mites. Therefore, entomopathogenic fungi could reduce varroa mite damage to honey bee brood by both infecting the parasite and preventing varroa-associated suppression of honey bee immunity. Ó 2012 Elsevier Inc. All rights reserved.
1. Introduction Beekeepers, crop growers, scientists and the general public are concerned with the mysterious die-offs of honey bee (Apis mellifera) colonies that have occurred during the last 5 years in many countries around the world. The phenomenon has been termed colony collapse disorder (CCD) in the USA. While many suspects have been suggested as causes of these losses, no clear explanation has yet been found (vanEngelsdorp et al., 2008). However, many scientists believe that it is due to a combination of factors (Stankus, 2008). One important factor associated with bee mortality is the parasitic mite, Varroa destructor. Without treatment, honey bee colonies typically die within 2 years after initial varroa infestation (De Jong et al., 1982). Thus, several synthetic miticides are used by beekeepers for their control. Although initially effective, the continuous use of these pesticides has led to the development of miticide resistance within a few years (Milani, 1999). Miticide ⇑ Corresponding author. Fax: +1 519 837 0442. E-mail address: [email protected] (E. Guzman-Novoa). 0022-2011/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.jip.2012.09.001
resistance is now widespread in Europe, USA and Canada (Elzen et al., 1998, 1999; Milani, 1999; Sprefacio et al., 2001; Elzen and Westervelt, 2002; Thompson et al., 2002; Skinner et al., 2003). A recent study showed that most (>85%) colony fatality cases during winter in Canada were significantly associated with varroa mite infestation despite colonies being treated with synthetic miticides (Guzman-Novoa et al., 2010). This suggests that mite populations are becoming more difficult to control in recent years. In addition, the use of synthetic miticides in bee hives raises the risk of contamination of honey and other hive products (Ruijter, 1995; Wallner, 1999). These disadvantages are a considerable incentive to develop new strategies for mite control that minimize miticide resistance and miticide accumulation in bee products. The ideal varroa control treatment should be environmentally friendly (i.e., limited non-target effects), varroa-selective (i.e., kills varroa at doses that are relatively harmless to bees) and should leave little to no residues in honey and wax. An alternative strategy for mite control in hives, therefore could be the use of entomopathogenic fungi as biological control agents of V. destructor. They can infect varroa, are non-toxic to humans, can be mass-cultured and occur naturally in the environment.
238
M.Md. Hamiduzzaman et al. / Journal of Invertebrate Pathology 111 (2012) 237–243
The entomopathogenic fungi, Beauveria bassiana and Metarhizium anisopliae, have been used as biocontrol agents against several insects in the genera Eurygaster and Aelia (Aquino de Muro et al., 2005), as well as cattle ticks (Frazzon et al., 2000). Application of M. anisopliae and B. bassiana to honey bee colonies has provided some degree of control against V. destructor under field conditions (Kanga et al., 2003, 2006; Meikle et al., 2007, 2008), although not in all cases (James et al., 2006). However, the relative pathogenicity of these fungi to bees and brood is largely unknown. Additionally, it would be desirable to test other fungi that have shown potential for the control of insects, such as Clonostachys rosea (Toledo et al., 2006; Vega, 2008). There are no reports thus far about whether exposure to entomopathogenic fungi can cause induction or suppression of gene expression in the honey bee. However, varroa mite parasitism can affect the expression of a number of honey bee genes (Yang and Cox-Foster, 2005; Navajas et al., 2008). For example, hymenoptaecin, which encodes an antimicrobial peptide as part of the immune system (Casteels-Josson et al., 1994), was down regulated by V. destructor parasitism (Yang and Cox-Foster, 2005). Similarly, both the genes for poly U binding factor 68Kd, pUf68, involved in pre-mRNA splicing (Foley and O’Farrell, 2004), and the basic helix-loop-helix-PAS transcription factor, SiMd, involved in locomotory behavior (Pielage et al., 2002), were down regulated by varroa mites (Navajas et al., 2008). In contrast, expression of the gene for the autophagy-linked FYVE protein, BlCh, involved in autophagasome trafficking to lysosomes and prevention of neural degeneration during aging (Finley et al., 2003), was up-regulated by varroa mite parasitism (Navajas et al., 2008). The objectives of this study were to evaluate the efficacy of selected entomopathogenic fungi as potential biocontrol agents of varroa mites on honey bee brood, and to investigate whether such entomopathogenic fungi could also detrimentally affect brood, as well as up or down regulate the expression of honey bee genes, such as those previously shown to be suppressed or induced by V. destructor parasitism. 2. Materials and methods 2.1. Collection of V. destructor Experiments were conducted at the Honey Bee Research Centre, University of Guelph, Guelph, Ontario, Canada. Adult V. destructor from heavily infested honey bee colonies that had not been treated with miticides for at least 6 months were harvested from brood cells using a fine paint brush. The harvested mites were held in Petri dishes lined with moist filter paper, and two white-eyed bee pupae collected from a non-infested colony served as the food source for the parasites. Varroa mites were used within 2 h from the time of collection. 2.2. Entomopathogenic fungal cultures From the University of Alberta Microfungi Collection, fungal isolates were obtained for M. anisopliae UAMH 4450, UAMH 9197, UAMH 9198, B. bassiana UAMH 1069, UAMH 9744 and C. rosea UAMH 7494, UAMH 9161. From the University of Guelph, C. rosea isolate EndofineÒ was provided by Dr. John Sutton, and B. bassiana isolate GHA (Botanigard 22WPÒ) was obtained from Laverlam International Corporation, Butte, MT, USA. All isolates were grown on Potato Dextrose Agar (PDA) containing 100 mg/L streptomycin sulfate at 26 °C and 80% RH. Conidia were harvested from 21day-old cultures by flooding the dishes with sterile 0.03% Tween 80 and gently scraping the surface of the culture with a soft-tipped sterile spatula. After vortexing, the conidial suspensions were fil-
tered through sterilized double cheese cloth. The conidial concentration was then adjusted to 1 108 conidia/mL in dd H2O (Shaw et al., 2002; Kanga et al., 2003; Rodriguez et al., 2009). 2.3. Honey bee brood inoculation with fungi-treated varroa mites Groups of 30 V. destructor were inoculated with the nine fungal isolates by individually immersing them in 5 mL of the conidial suspension for 10 s. The varroa mites were then dried by placing them onto filter paper in a Petri dish, which was sealed with micro-perforated Parafilm. To infest honey bee brood with varroa mites, groups of 10 newly-capped brood cells each from three brood frames obtained from a healthy colony, were colored on their outer rims with water based, non-toxic, paint markers (L551P2, Hunt Int., Mississauga, Ont., Canada). Colored capped cells containing brood were opened by cutting a thin slit approximately 2 mm long using a sterile blade, and then three fungal-inoculated V. destructor were transferred into each cell using a fine paintbrush. The slit was resealed by lightly brushing it with liquid beeswax. As the control, 30 varroa mites were used per replicate that had been immersed in dd H2O before introducing them into brood cells. The three frames were placed inside screened cages in an incubator at 33–35 °C and 80% RH for 10 days. Varroa mite mortality in each inoculated cell was recorded every 48 h by cutting open the cell cap as described above, removing the brood with a fine forceps and examining for dead mites. A mite was considered dead if it did not move after being probed with a pin. If a mite was alive, it was then transferred to another cell containing live brood in the same frame, and the cell was sealed and marked. Dead varroa mites retrieved from the treated cells were surface sterilized in 90% ethanol, cultured on PDA with streptomycin, and incubated for 36 h at 26 °C and 80% RH. The presence of mycelia growing from a varroa mite cadaver indicated fungal-caused mortality. The experiment was replicated three times for a total of 300 mites. Test frames were examined daily for emerged worker bees, which were swept off the frames to prevent them from removing brood in infested cells. 2.4. Honey bee brood inoculation with selected fungal isolates Inoculation of honey bee brood with M. anisopliae UAMH 9198 or B. bassiana GHA, selected for their high pathogenicity to varroa mites from the previously described experiment, was done by collecting three brood frames containing newly capped cells and incubating them overnight at 33–35 °C and 60% RH. Rows of brood cells on each side of each frame were transected and color-coded as described above, with each color corresponding to a fungal isolate or control treatment. Each transect was randomly assigned to be inoculated with 5 lL of the conidial suspension of B. bassiana, M. anisopliae or water. Each fungal treatment was applied to 30 brood in newly capped cells that were opened and resealed as previously mentioned. The brood cells were covered with a wire mesh screened cage that was manually embedded on the comb to capture the bees emerging from the treated cells. The frames were returned to the incubator and observed for bee emergence. Hatched bees were removed and held in feeding cages (12.7 8.5 14.5 cm) provided with water and sucrose syrup in gravity feeding bottles. Total number of bees that emerged and brood mortality (i.e., brood that did not hatch) were recorded. Body weights of emerged adult bees were determined for bees anesthetized using carbon dioxide. To determine the timing and extent of fungal colonization of the honey bee brood, cells were uncapped, and inoculated brood were removed with a fine forceps at 1 and 7 days post-inoculation (dpi). They were then washed with 90% ethanol and transferred to microscope slides where they were crushed and stained with lac-
239
M.Md. Hamiduzzaman et al. / Journal of Invertebrate Pathology 111 (2012) 237–243
tophenol cotton blue to observe spores and hyphae in different tissues under the microscope (Celestron LCD Deluxe Digital Microscope, Torrance, CA, USA) at 100. Twenty brood were examined (ten inoculated with M. anisopliae and ten inoculated with B. bassiana). 2.5. Expression of immune-related genes in honey bee brood The expression of hymenoptaecin was determined at 0 h, 1, 2, 5 and 7 dpi, and expression of pUf68, BlCh, and SiMd was measured at 7 dpi. For each measurement, individual brood cells were opened to introduce a single fungal-treated or non-treated V. destructor, re-sealed after inoculation and color coded as described above. Brood inside cells were also directly inoculated with M. anisopliae UAMH 9198 or B. bassiana GHA by placing 5 lL of the conidial suspension on their bodies and then re-sealing the cells without introducing a mite. Fifteen re-sealed brood cells were prepared per treatment and time point in each of three brood frames and incubated as above. For the control, cells were opened and re-sealed without introducing varroa mites or the fungi. For RNA extraction, the cells were opened, and the brood were removed and individually stored at 70 °C in 1.5 mL Eppendorf tubes. Three replications were conducted. 2.6. RNA extraction and cDNA synthesis Total RNA was extracted by homogenizing five frozen brood in extraction buffer as per Chen et al. (2000). The homogenates were extracted twice with chloroform, and the RNA was precipitated using LiCl (Sambrook et al., 1989). The amount of total RNA extracted was determined with a spectrophotometer (Nanovue GE Healthcare, Cambridge, UK). For cDNA synthesis, 2 lg of total RNA was reverse-transcribed using Oligo (dT)18 and M-MuLV RT with the RevertAidTM H Minus First Strand cDNA Synthesis Kit (Fermentas Life Sciences, Burlington, Ontario), following the instructions of the manufacturer.
conditions for pUf68, BlCh and SiMd, were 94 °C for 3 min, followed by 35 cycles of 30 s at 94 °C, 60 s at 55 °C and 60 s at 72 °C, and a final extension step at 72 °C for 10 min. Amplification conditions for hymenoptaecin were the same, except that the annealing temperature was 58 °C. 2.8. Separation and semi-quantification of PCR products PCR products were separated by electrophoresis in 1.1% agarose gels and stained with ethidium bromide. A 100 bp DNA ladder (Bio Basic Inc., Markham, Ontario) was used. The intensity of the amplified bands was measured in pixels using the Scion Image (Scion Corporation, Frederick, MD, USA) as per Dean et al. (2002). The ratio of band intensity between the target gene and the house-keeping gene was calculated to determine relative expression. To determine that the number of amplification cycles was not too great for relative quantification, samples were also amplified with three fewer PCR cycles, and the bands were again quantified. A similar ratio of band intensity between the target gene and the house-keeping gene was observed in all samples. 2.9. Statistical analysis Percent mite mortality or bee emergence caused by the fungi tested was calculated, arcsine square root transformed, and subjected to analysis of variance (ANOVA) using a completely randomized design. Data on gene expression were also subjected to ANOVA. Significant differences among means were separated with Fisher’s protected LSD or Tamhane’s T2 tests (a = 0.05). To obtain descriptive statistics and perform ANOVAS, the package IBM-SPSS v. 19 (SPSS Inc., Chicago, IL, USA) was used.
3. Results 3.1. Effect of entomopathogenic fungi on varroa mites
2.7. PCR reactions All PCR reactions were done with a Mastercycler (Eppendorf, Mississauga, Ontario). Each 15 lL of reaction contained 1 lL cDNA, 1.5 lL 10 PCR buffer (New England BioLabs, Pickering, Ontario), 0.5 lL 10 mM dNTPs (Bio Basic Inc., Markham, Ontario), 1 lL 10 lM of forward and reverse primers for the honey bee ribosomal protein RpS5 gene (Thompson et al., 2007) and for one gene of interest (Laboratory Services, University of Guelph), 0.2 lL 5U/lL Taq polymerase (New England BioLabs, Pickering, Ontario), and 7.8 lL of dd H2O. Primer sequences are listed in Table 1. Primers were designed using Gene Runner (Version 3.05, Hastings Software, Inc., NY, USA) and supplied by Laboratory Services of the University of Guelph (Guelph, Ontario, Canada). Amplification
Isolates UAMH 4450, UAMH 9197 and UAMH 9198 of M. anisopliae, isolates UAMH 1069, UAMH 9744 and GHA of B. bassiana and isolates UAMH 7494, UAMH 9161 and Endofine of C. rosea, all caused significant mortality following inoculation of V. destructor by 7 dpi (Fig. 1; F9,20 = 4.29; P < 0.05). The presence of mycelia on all the fungal-inoculated, surface-sterilized, varroa mite cadavers indicated that the dead mites had been colonized by the fungi. Seven of the isolates killed more than 50% of the varroa mites, but C. rosea isolates UAMH 7494 and Endofine caused less than 50% mite mortality. The three most pathogenic isolates were M. anisopliae UAMH 9197, M. anisopliae UAMH 9198 and B. bassiana GHA, which were the only isolates to cause more than 90% mite mortality. The two last isolates were used in all further experiments.
Table 1 List of primers used to amplify hymenoptaecin, pUf68, BlCh, SiMd and RpS5. Gene name
Primer sequence (50 to 30 )
Gene ID
Band size
Reference
Hymenopt-F Hymenopt-R pUf68-F pUf68-R BlCh-F BlCh-R SiMd-F SiMd-R RpS5-F RpS5-R
CTCTTCTGTGCCGTTGCATA GCGTCTCCTGTCATTCCATT CAAGACCTCCAACTAGCATG CAACAGGTGGTGGTGGTG GTGCTTGGGTTAGGATGTGTAC GTTAATCTTCTTCCGCTACTG GACAACAATTCCACTTCAGAC CAAGTAACTGGTCGTCAATCG AATTATTTGGTCGCTGGAATTG TAACGTCCAGCAGAATGTGGTA
GB17538
200 bp
Evans (2006)
GB13651
201 bp
This study
GB10249
218 bp
This study
GB11417
252 bp
This study
GB11132
115 bp
Thompson et al. (2007)
Note: F, forward primer and R, reverse primer.
240
M.Md. Hamiduzzaman et al. / Journal of Invertebrate Pathology 111 (2012) 237–243
Fig. 1. Mean percent mortality (±SE) of V. destructor inoculated with 1 108 conidia/mL of isolates UAMH 4450, UAMH 9197 and UAMH 9198 of Metarhizium anisopliae, UAMH 1069, UAMH 9744 and GHA of Beauveria bassiana and UAMH 7494, 9161 and EndofineÒ of Clonostachys rosea. Different letters indicate significant differences of means based on analyses of variance and Fisher’s protected LSD tests performed on arcsine square root transformed data. Non-transformed values are presented.
Table 2 Effect of M. anisopliae UAMH 9198 and B. bassiana GHA on honey bee emergence and body weight. Newly capped brood were inoculated with 5 lL of a 1 108 conidia/mL of either fungi, and the percentage of honey bees that emerged or died inside the cells was determined at 12 dpi. The weight of bees was determined after emergence. Treatment
% Emergence (±SE)
% Mortality (±SE)
Body weight (mg ± SE)
Control M. anisopliae B. bassiana
100 ± 0.0a 75.83 ± 6.8ab 40.83 ± 4.6b
0.0 ± 0.0b 24.17 ± 6.8ab 59.17 ± 4.6a
102 ± 4a 89 ± 1b 86 ± 1b
Different letters indicate significant differences of means based on analyses of variance and Fisher’s protected LSD tests performed on arcsine square root transformed data.
3.2. Effect of entomopathogenic fungi on honey bee brood Brood directly inoculated with M. anisopliae UAMH 9198 or mock inoculated with water had similar emergence into adult bees at 12 dpi, but inoculation of brood with B. bassiana GHA caused a significant reduction in adult bee emergence (Table 2). However, both fungi had a detrimental effect on development as the newly emerged bees from brood treated with either M. anisopliae UAMH 9198 or B. bassiana GHA weighed significantly less than bees from the control group at 12 dpi (F2,57 = 15.30; P < 0.05) (Table 2).
Fig. 3. Effect of V. destructor infestation on the expression of the immune-related gene, hymenoptaecin, in honey bee brood. RNA transcripts were quantified by RTPCR from brood artificially-infested with varroa mites at different time points. A, co-amplification of the PCR products specific for hymenoptaecin and the housekeeping gene, RpS5, used to estimate relative expression. Lane 1 shows the control treatment (brood without mites) at 0 h, while lanes 2, 3, 4, and 5, show bands at 1, 2, 5, and 7 dpi, respectively. Lane 6 shows another control treatment (brood without mites) at 7 dpi, whereas lane 7 is a control with no DNA. Lane M (far left) is a 100 bp DNA ladder. B, relative expression of hymenoptaecin in brood infested with varroa mites at the same time points described in part A. Numbers for each column match those of the lanes in the picture of the PCR products immediately above it. Values presented are means ± SE. Different letters indicate significant differences of means based on analyses of variance and Tamhane’s T2 test.
Reduced emergence was related to higher brood mortality associated with fungal inoculation compared to the control (F2,6 = 39.01; P < 0.05) (Table 2). At 1 dpi, all brood inoculated with M. anisopliae UAMH 9198, B. bassiana GHA, or control, showed no visible fungal colonization of the haemolymph or tissues when the brood were crushed and examined microscopically. At 7 dpi for live brood, both fungi showed varying degrees of colonization of the haemolymph and tissues. Greater amounts of hyphae were observed for B. bassiana GHA than for M. aniospliae UAMH 9198, particularly in tissues like the basement membrane of the cuticle. However, the center of the body of live brood was barely colonized by either fungus. At 7 dpi for dead brood, haemolymph and all tissues (particularly the abdomen and basement membrane of the cuticle) showed extensive colonization by B. bassiana GHA or M. aniospliae UAMH 9198 when examined microscopically (Fig. 2). No sporulation was ever observed in either live or dead inoculated brood, and no fungal colonization was ever observed in mock-inoculated control brood. 3.3. Effect of varroa mites and entomopathogenic fungi on gene expression in honey bee brood Infestation of honey bee brood by varroa mites resulted in lower expression of hymenoptaecin compared to the control. Expression
Fig. 2. Example images of the abdomen of honey bee brood at 7 dpi with a 5 lL conidial suspension (1 108 conidia/mL) of B. bassiana GHA, or M. anisopliae UAMH 9198. Brood were crushed, stained with lactophenol cotton blue and examined for hyphae and spores under a microscope at 100 power.
M.Md. Hamiduzzaman et al. / Journal of Invertebrate Pathology 111 (2012) 237–243
241
Fig. 4. Effect of B. bassiana GHA and M. anisopliae UAMH 9198 on the expression of hymenoptaecin, pUf68, BlCh and SiMd in brood artificially infested with V. destructor at 7 dpi. RNA transcripts were quantified by RT-PCR. Parts A, C, E and G show gel pictures of the PCR products for hymenoptaecin, pUf68, BlCh and SiMd, respectively, along with the house-keeping gene, RpS5, used to estimate relative expression. Samples in lanes 1, 2, 3, 4, 5 and 6, correspond to brood without mites or fungi, infested with varroa mites only, inoculated with B. bassiana, inoculated with M. anisopliae, infested with varroa mites inoculated with B. bassiana, and infested with varroa mites inoculated with M. anisopliae, respectively. Lane 7 is a control with no DNA. Lane M is a 100 bp DNA ladder. Parts B, D, F and H show the quantification of the relative expression of hymenoptaecin, pUf68, BlCh or SiMd, respectively, compared to RpS5. Numbers for each column match those of the lanes in the picture of the PCR products immediately above it. Values presented are means ± SE. Different letters indicate significant differences of means based on analyses of variance and Fisher’s protected LSD tests.
declined most rapidly at 1 dpi, which was followed by another major drop at 5 dpi and then remained low at 7 dpi (Fig. 3A and B). At 7 dpi, however, expression of hymenoptaecin was higher in brood directly inoculated with either B. bassiana or M. anisopliae compared to varroa-infested brood or the control (Fig. 4A and B). Thus, fungal parasitism of the brood appeared to have induced hymenoptaecin expression, while varroa mite parasitism suppressed it. The highest expression of hymenoptaecin was observed when brood was exposed to varroa mites that had been inoculated with either B. bassiana or M. anisopliae. The induced expression by fungal-infected varroa mites appeared to be due to non-feeding (i.e., dead) mites attached to the brood because all V. destructor inoculated with B. bassiana or M. anisopliae were dead by 7 dpi, while all mock infested mites were still alive. Expression of pUf68 (Fig. 4C and D) in varroa-infested brood was also significantly lower than the control at 7 dpi, but expression of BlCh (Fig. 4E and F) and SiMd (Fig. 4G and H) was not significantly different. Similar to hymenoptaecin, expression of pUf68 and BlCh was significantly greater than the control at 7 dpi for brood inoculated with B. bassiana or M. anisopliae. Also like hymenoptaecin, expression of pUf68 and BlCh was highest at 7 dpi for brood infested with varroa mites that had been inoculated with B. bassiana or M. anisopliae. In contrast, expression of SiMd was not significantly affected in any of the treatments.
4. Discussion V. destructor has been reported to be susceptible to the entomopathogenic fungi, M. anisopliae, B. bassiana, Verticillium lecanii,
Hirsutella spp. (Chandler et al., 2000, 2001; Shaw et al., 2002), Hirsutella thompsonii (Peng et al., 2002), B. bassiana and M. anisopliae (Rodriguez et al., 2009). The findings of this study confirm that B. bassiana and M. anisopliae are highly pathogenic to varroa mites with several isolates causing more than 90% mite mortality, and thus they have the potential to be biocontrol agents of these parasites. However, C. rosea showed more limited pathogenicity against varroa mites, with none of the isolates tested killing more than 60% of the mites. This is the first report of inoculating varroa mites with C. rosea. One concern with the use of entomopathogenic fungi to control varroa mites is that they will also be pathogenic to honey bee brood. Previous studies have shown that adult honey bees inoculated with spores of B. bassiana or M. anisopliae by directly applying the spores onto their bodies had significantly higher mortality than non-inoculated bees (Alves et al., 1996; Al Mazraawi, 2007). B. bassiana may also infect honey bee brood as it sporulated on inoculated brood under laboratory conditions (Meikle et al., 2006). In another study, Boyle (2008) showed that inoculation with spores of M. anisopliae resulted in <50% adult bee emergence from treated brood cells, demonstrating high mortality. Boyle (2008) inoculated the brood using a different method to the one used in this study (i.e., injecting spores into unopened cells), which could have also caused mortality due to unintentional piercing of the brood. However, when spores of B. bassiana were sprayed inside hives, adult bee mortality did not differ from control treatments (Meikle et al., 2008; Al Mazraawi, 2007). The method of inoculation in this study (i.e., direct application of spores to the brood body) was similar to that of Alves et al. (1996) and Al Mazraawi (2007), and so increased mortality of the brood is not surprising. While both B.
242
M.Md. Hamiduzzaman et al. / Journal of Invertebrate Pathology 111 (2012) 237–243
bassiana and M. anisopliae caused greater brood mortality in this study relative to the control, the increase was only significant for B. bassiana. However, both fungi had a negative effect on the brood because they both reduced the body weight of the bees that emerged. Considering the range of virulence of the different isolates to varroa mites, it could be expected that the higher brood mortality rates reported by Boyle (2008) compared to our study for M. anisopliae may be related to the virulence of the fungal isolates used. Inoculation of brood by entomopathogenic fungi induced expression of hymenoptaecin, pUf68 and BlCh, but not SiMd. This suggests that B. bassiana and M. anisopliae not only acted as biocontrol agents against varroa mites, but also caused an infection in the brood. Crushing bees and observing hyphae inside their bodies showed that the fungi had penetrated the cuticle of the brood, resulting in limited colonization of live brood but extensive colonization of brood that had died. The entomopathogenic fungal infection appears to have triggered the immune system of the bee brood. Another example of this outcome is B. bassiana infection of the mosquito, Aedes aegypti, which induced expression of the defense-related genes, attacin, cecropin G, defensin A and C, and diptericin (Dong et al., 2012). However, not all defense-related genes of the mosquito were up-regulated, such as lysozyme C, which is similar to this study where there was no effect of fungal infection on expression of SiMd in the honey bee brood. In contrast to fungal infection, varroa parasitism of the brood resulted in down regulation of hymenoptaecin and pUf68, although it did not significantly affect expression of BlCh and SiMd. Other evidence for suppression of honey bee gene expression by varroa parasitism is that hymenoptaecin, pUf68 and SiMd were down-regulated by varroa infestation of adult honey bees (Yang and CoxFoster, 2005; Navajas et al., 2008). However, expression of BlCh was reported to be up-regulated in adult honey bees infested by V. destructor (Navajas et al., 2008). This study used brood rather than adult bees, which may explain why the response of SiMd and BlCh were different. Expression of hymenoptaecin, pUf68 and BlCh showed different responses to parasitism by varroa mites and entomopathogenic fungi. The down regulation of gene expression for hymenoptaecin and pUf68 in brood infested only with V. destructor in this study, indicates that suppression of honey bee gene expression could be a result of varroa effector-triggered susceptibility (ETS). This could be similar to ETS resulting from putative effectors in the larval salivary secretions of the Hessian fly (Mayetiola destructor) that down regulates host genes and induces susceptibility in wheat, thus increasing production of plant nutrients for the larvae (Williams et al., 2011). Other studies have also shown that parasitism by varroa mites suppressed genes for antimicrobial peptides, such as abaecin and defensin, as well as genes for phenoloxidase, glucose dehydrogenase, glucose oxidase and lysozyme, which are all defense-related enzymes (Gregory et al., 2005; Yang and Cox-Foster, 2005; Navajas et al., 2008). Therefore, successful varroa mite parasitism may require suppression of honey bee defense and stress-response gene expression, to avoid or suppress parasite/pathogen associated molecular pattern (PAMP)–triggered immunity (PTI) in honey bees, which could be caused by the mite while feeding on the bee. In contrast, both B. bassiana and M. anisopliae appear to induce PTI in honey bee brood, which is the first report of this effect by entomopathogenic fungi in honey bees. Surprisingly, inoculation of brood with varroa mites along with the fungi in the same cell resulted in the highest gene expression for hymenoptaecin, pUf68 and BlCh. It is possible that the brood were responding to a greater infection by B. bassiana and M. anisopliae as the fungi were growing on both the mite and brood. However, another explanation is that co-inoculation of brood with varroa mites along with the fungi may have negated the ETS by
V. destructor due to the fungi inducing PTI, which resulted in even higher honey bee gene expression than fungal infection alone. If correct, then fungal-induced PTI would permit the honey bee to better defend itself against varroa mite parasitism. Further work is needed to determine if induction of honey bee defenses contributes to the biological control of varroa mites by entomopathogenic fungi. The mechanism through which V. destructor inhibits expression of honey bee genes is unknown, but it might be due to effectors entering the haemolymph of the bee through the mite’s saliva when it penetrates the cuticle of the brood to feed upon the host’s haemolymph. Immune inhibition has been observed in mites belonging to the same order as V. destructor (Parasitiformes), such as the deer tick (Ixodes scapularis) and Western black-legged tick (I. pacificus), that immunosuppress their mammalian hosts with salivary secretions by inhibiting immune cell signaling and activation (Schorderet and Brossard, 1993; MacNair et al., 2009). The saliva of V. destructor contains at least 15 proteins, some of which could be acting as effectors causing ETS in honey bees (Richards et al., 2011). A functional genomics approach, analogous to what was done to identify the biological activity of salivary proteins using aphid (Myzus persicae) salivary gland expressed sequence tags, could be used to identify the V. destructor effectors (Bos et al., 2010). Our results show that entomopathogenic fungi, such as B. bassiana and M. anisopliae, can control varroa mites. However, the beneficial effects of these fungi on honey bee health may be outweighed by their detrimental impact on brood development, both in mortality and reduced body weight of the emerged adult bees. These effects must be a consideration in the development of such biocontrol agents. However, this study also shows that isolates of entomopathogenic fungi can differ considerably in their virulence to different organisms. M. anisopliae UAMH 9198 caused 93% mortality to varroa mites, while only 24% mortality to honey bee brood. Perhaps strains of B. bassiana and M. anisopliae can be found that have even higher mortality to varroa mites with lower mortality as well as less of an effect on honey bee body weight. This study also indicates that PTI occurs in honey bees. Thus, the possible triggers of PTI in brood could be isolated from B. bassiana or M. anisopliae, and then these PAMPs could be applied to brood to induce defense gene expression to determine if that would help reduce the ability of varroa to parasitize bees. Acknowledgments We thank Paul Kelly for managing the colonies and for supplying the brood and mites used in these experiments. We also thank John Sutton for supplying one fungal isolate. This study was partially funded by a NSERC discovery Grant to EG, by a NSERC strategic Grant to P. Kevan (NSERC-CANPOLIN) and by a Grant from the agreement between the University of Guelph and the Ontario Ministry of Agriculture, Food and Rural Affairs to EG. This is publication # 61 of NSERC-CANPOLIN. References Al Mazraawi, M.S., 2007. Impact of the entomopathogenic fungus Beauveria bassiana on the honey bees, Apis mellifera L (Hymenoptera: Apidae). World J. Agric. Sci. 3, 7–11. Alves, S.B., Marchinin, L.C., Pereira, R.M., Baumgratz, L., 1996. Effects of some insect pathogens on the Africanized honey bees Apis mellifera L (Hymenoptera: Apidae). J. Appl. Entomol. 120, 559–564. Aquino de Muro, M., Elliott, S., Moore, D., Parker, B.L., Skinner, M., Reid, W., ElBouhssini, M., 2005. Molecular characterization of Beauveria bassiana isolates obtained from overwintering sites of Sunn Pests (Eurygaster and Aelia species). Mycol. Res. 109, 294–306. Bos, J.I.B., Prince, D., Pitino, M., Maffei, M.E., Win, J., Hogenhout, S.A., 2010. A functional genomics approach identifies candidate effectors from the aphid species Myzus persicae (Green Peach Aphid). PLoS Genet. 6, e1001216.
M.Md. Hamiduzzaman et al. / Journal of Invertebrate Pathology 111 (2012) 237–243 Boyle, D. 2008. Integrated pest management-compatible biological control of varroa mite of honey bee. MicroBiologicals (MMB1). Casteels-Josson, K., Zhang, W., Capaci, T., Casteels, P., Tempst, P., 1994. Acute transcriptional response of the honeybee peptide-antibiotics gene repertoire and required post-translational conversion of the precursor structures. J. Biol. Chem. 269, 28569–28575. Chandler, D., Dadidson, G., Pell, J., Vall, B., Shaw, K., Sunderland, K., 2000. Fungal biocontrol of acari. Biocontrol Sci. Technol. 10, 357–384. Chandler, D., Sunderland, K.D., Ball, B.V., Davison, G., 2001. Prospective biological control agents of Varroa destructor n. sp., an important pest of the European honey bee, Apis mellifera. Biocontrol Sci. Technol. 11, 429–448. Chen, C.Y.J., Jin, S., Goodwin, P.H., 2000. An improved method for the isolation of total RNA from Malva pusilla tissues infected with Colletotrichum qloeosporioides. J. Phytopathol. 148, 57–60. Dean, J.D., Goodwin, P.H., Hsiang, T., 2002. Comparison of relative RT-PCR and Northern blot analyses to measure expression of ß-1,3-glucanase in Nicotiana benthamiana infected with Colletotrichum destructivum. Plant Mol. Biol. Report. 20, 347–356. De Jong, D., De Jong, P.H., Goncales, L.S., 1982. Weight loss and other damage to developing worker honey bees from infestation with Varroa jacobsoni. J. Apic. Res. 21, 165–167. Dong, Y., Morton Jr., J.C., Ramirez, J.L., Souza-Neto, J.A., Dimopoulos, G., 2012. The entomopathogenic fungus Beauveria bassiana activate toll and JAK-STAT pathway-controlled effector genes and anti-dengue activity in Aedes aegypti. Insect Biochem. Mol. Biol. 42, 126–132. Elzen, P.J., Baxter, J.R., Spivak, M., Wilson, W.T., 1999. Amitraz resistance in varroa: new discovery in North America. American Bee J. 139, 362. Elzen, P.J., Eischen, F.A., Baxter, J.B., Pettis, J., Elzen, G.W., Wilson, W.T., 1998. Taufluvalinate resistance in Varroa jocobsoni from several geographic locations. American Bee J. 138, 674–676. Elzen, P.J., Westervelt, D., 2002. Detection of coumaphos resistance in Varroa destructor in Florida. American Bee J. 142, 291–292. Evans, J.D., 2006. Beepath: an ordered quantitative-PCR array for exploring honey bee immunity and disease. J. Invertebr. Pathol. 93, 135–139. Finley, K.D., Edeen, P.T., Cumming, R.C., Mardahl-Dumesnil, M.D., Taylor, B.J., Rodriguez, M.H., Hwang, C.E., Benedetti, M., McKeown, M., 2003. Blue cheese mutations define a novel, conserved gene involved in progressive neural degeneration. J. Neurosci. 23, 1254–1264. Foley, E., O’Farrell, P.H., 2004. Functional dissection of an innate immune response by a genome-wide RNAi screen. PLoS Biol. 2, 1091–1106. Frazzon, A.P.G., Da Silva, V.J.I., Masuda, A., Schrank, A., Vainstein, M.H., 2000. In vitro assessment Metarhizium anisopliae isolates to control the cattle tick Boophilus microplus. Vet. Parasitol. 94, 117–125. Gregory, P.G., Evans, J.D., Rinderer, T., Guzman, L., 2005. Conditional immune-gene suppression of honey bees parasitized by Varroa mites. J. Insect Sci. 5, 1–5. Guzman-Novoa, E., Eccles, L., Calvete, Y., McGowan, J., Kelly, P.G., Correa- Benitez, A., 2010. Varroa destructor is the main culprit for the death and reduced populations of overwintered honey bee (Apis mellifera) colonies in Ontario, Canada. Apidologie 41, 443–450. James, R.R., Hayes, G., Leland, J.E., 2006. Field trials on the microbial control of varroa with the fungus Metarhizium anisopliae. Am. Bee J. 146, 968–972. Kanga, L.H.B., Jones, W.A., James, R.R., 2003. Field trials using the fungal pathogen, Metarhizium anisopliae (Deuteromycetes: Hyphomycetes) to control the ectoparasitic mite, Varroa destructor (Acari: Varroidae) in honey bees, Apis mellifera (Hymenoptera: Apidae) colonies. J. Econ. Entomol. 96, 1091–1099. Kanga, L.H.B., Jones, W.A., Garcia, C., 2006. Efficacy of strips coated with Metarhizium anisopliae for control of Varroa destructor (Acari: Varroidae) in honey bee colonies in Texas and Florida. Exp. Appl. Acarol. 40, 249–258. MacNair, C.M., Nisbet, A.J., Billingsley, P.F., Knox, D.P., 2009. Molecular characterization, expression and localization of a peroxiredoxin from the sheep scab mite, Psoroptes ovis. Parasitology 136, 453–460. Meikle, W.G., Mercadier, G., Girod, V., Derouané, F., Jones, W.A., 2006. Evaluation of Beauveria bassiana (Balsamo) Vuillemin (Deuteromycota: Hyphomycetes) strains isolated from varroa mites in southern France. J. Apicult. Res. 45, 219–220. Meikle, W.G., Mercadier, G., Holst, N., Nansen, C., Girod, V., 2007. Duration and spread of an entomopathogenic fungus, Beauveria bassiana (Balsamo) Viullemin (Deuteromycota: Hyphomycetes) used to treat varroa mites, Varroa destructor
243
Anderson and Trueman (Acari: Varroidae), in honey bee colonies. J. Econ. Entomol. 100, 1–10. Meikle, W.G., Mercadier, G., Holst, N., Nansen, C., Girod, V., 2008. Impact of two treatments of a formulation of Beauveria bassiana (Deuteromycota: Hyphomycetes) conidia on varroa mites (Acari: Varroidae) and on honey bee (Hymenoptera: Apidae) colony health. Exp. Appl. Acarol. 46, 105–177. Milani, N., 1999. The resistance of Varroa jacobsoni Oud. to acaricides. Apidologie 30, 229–234. Navajas, M., Migeon, A., Alaux, C., Martin-Magniette, M.L., Robinson, G.E., Evans, J.D., Cros-Arteil, S., Crauser, D., Le Conte, Y., 2008. Differential gene expression of the honey bee Apis mellifera associated with Varroa destructor infection. BMC Genom.. http://dx.doi.org/10.1186/1471-2164-9-301) 9, 301. Peng, Y.S.C., Zhou, X., Kaya, K.H., 2002. Virulence and site infection of the fungus, Hirsutella thompsonii, to the honey bee ectoparasite mite, Varroa destructor. J. Invert. Pathol. 81, 185–195. Pielage, J., Steffes, G., Lau, D.C., Parente, B.A., Crews, S.T., Strauss, R., Klambt, C., 2002. Novel behavioral and developmental defects associated with Drosophila singleminded. Dev. Biol. 249, 283–299. Richards, E.H., Jones, B., Bowman, A., 2011. Salivary secretions from the honeybee mite, Varroa destructor: effects on insect haemocytes and preliminary biochemical characterization. Parasitology 138, 602–608. Rodriguez, M., Gerding, M., France, A., 2009. Selection of entomopathogenic fungi to control Varroa destructor (Acari: Varroidae). Chilean J. Agric. Res. 69, 534–540. Ruijter, A., 1995. Issues in the control of varroa infestation. In: Matheson, A. (Ed.), New Perspectives on Varroa. International Bee Research Association, Cardiff, UK, pp. 24–26. Sambrook, J., Fritsch, E.F., Maniatis, T. 1989. Molecular cloning: a laboratory manual, second ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA. Schorderet, S., Brossard, M., 1993. Changes in immunity to Ixodes ricinus by rabbits infested at different levels. Med. Vet. Entomol. 7, 186–192. Shaw, K.E., Davidson, G., Clark, S.J., Ball, B.V., Pell, J.K., Chandler, D., Sunderland, K.D., 2002. Laboratory bioassays to assess the pathogenicity of mitosporic fungi of Varroa destructor (Acari: Mesostigmata), an ectoparasitic mite of honey bee Apis mellifera. Biol. Control 24, 266–276. Skinner, A., Tam, J., Melin, S., 2003. Monitoring for fluvalinate resistant varroa mites and coumaphos efficacy trials in honey bee colonies in Ontario. The Sting 21, 23–25. Sprefacio, M., Eordegh, F.R., Bernardinelli, I., Colombo, M., 2001. First detection of strains of Varroa destructor resistant to coumaphos. Results of laboratory tests and field trials. Apidologie 32, 49–55. Stankus, T., 2008. A review and bibliography of the literature of honey bee Colony Collapse Disorder: a poorly understood epidemic that clearly threatens the successful pollination of billions of dollars of crops in America. J. Agr. Food Inform. 9, 115–143. Thompson, H.M., Brown, M.A., Ball, R.F., Bew, M.H., 2002. First report of Varroa destructor resistance to pyrethroids in UK. Apidologie 33, 357–366. Thompson, G.J., Yockey, H., Lim, J., Oldroyd, B.P., 2007. Experimental manipulation of ovary activation and gene expression in honey bee (Apis mellifera) queens and workers: testing hypotheses of reproductive regulation. J. Exp. Zool. 307A, 600– 610. Toledo, A.V., Virla, E., Humber, R.A., Paradell, S.L., Lastra, C.C.L., 2006. First record of Clonostachys rosea (Ascomycota: Hypocreales) as an entomopathogenic fungus of Oncometopia tucumana and Sonesimia grossa (Hemiptera: Cicadellidae) in Argentina. J. Invertebr. Pathol. 92, 7–10. vanEngelsdorp, D., Hayes, J., Underwood, R.M., Pettis, J., 2008. A survey of honey bee colony losses in the US, fall 2007 to spring 2008. PloS ONE 3, 1–6. Vega, F.E., 2008. Insect pathology and fungal endophytes. J. Invertebr. Pathol. 98, 277–279. Wallner, K., 1999. Varroacides and their residues in bee products. Apidologie 30, 235–248. Williams, C.E., Nemacheck, J.A., Shukle, J.T., Subramanyam, S., Saltzmann, K.D., Shukle, R.H., 2011. Induced epidermal permeability modulates resistance and susceptibility of wheat seedlings to herbivory by Hessian fly larvae. J. Exp. Botany 62, 4521–4531. Yang, X., Cox-Foster, D.L., 2005. Impact of an ectoparasite on the immunity and pathology of an invertebrate: evidence for host immunosuppression and viral amplification. Proc. Natl. Acad. Sci. USA 102, 7470–7475.