- Email: [email protected]
Establishment of a human iPSC line (MUSIi007-A) from peripheral blood of normal individual using Sendai viral vectors
Stem Cell Research 32 (2018) 43–46
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
Establishment of a human iPSC line (MUSIi007-A) from peripheral blood of normal individual using Sendai viral vectors Ponthip Potirata,b, Methichit Wattanapanitchc, Pakpoom Kheolamaid, Surapol Issaragrisilb,e,
T
⁎
a
Department of Immunology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand Siriraj Center of Excellence for Stem Cell Research, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand c Siriraj Center for Regenerative Medicine, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand d Division of Cell Biology, Department of Pre-clinical Sciences, Faculty of Medicine, Thammasat University, Pathumthani, Thailand e Division of Hematology, Department of Medicine, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand b
A B S T R A C T
Human induced pluripotent stem cell (iPSC) line was generated from peripheral blood mononuclear cells (PBMNCs) isolated from a 26-year-old healthy subject to use as a control group for the iPSC line carrying compound heterozygote for mutation in KLF1 gene. The cells were reprogrammed using integration-free method, Sendai viral (SeV) vectors containing KOS, hc-MYC and hKLF4. The established iPSC line (MUSIi007-A) exhibited a normal karyotype, expressed pluripotent markers and displayed in vitro and in vivo differentiation potential into cells of three embryonic germ layers. Resource table
Unique stem cell line MUSIi007-A identifier Alternative name(s) of SeV-iPSC stem cell line Institution Siriraj Center of Excellence for Stem Cell Research, Faculty of Medicine Siriraj Hospital, Mahidol University Contact information of Ponthip Potirat, [email protected] distributor Surapol Issaragrisil, [email protected] Type of cell line iPSCs Origin Human Additional origin info Age: 26-year-old Sex: Male Ethnicity: Thai Cell source Peripheral blood mononuclear cells Clonality Clonal Method of Integration-free Sendai viral vectors reprogramming Genetic modification N/A Type of modification N/A Associated disease N/A Gene/locus N/A Method of N/A modification Name of transgene or N/A resistance
⁎
Inducible/constitutive system Date archived/stock date Cell line repository/ bank Ethical approval
N/A December 2014 N/A Siriraj Institutional Review Board (SiRB), no. Si248/2011, Faculty of Medicine Siriraj Hospital, Mahidol University, Thailand.
Resource utility We generated a human iPSC line from PBMNCs of a healthy subject using a non-integrating Sendai viral vectors. This cell line was used as a control for comparison with the iPSC line carrying compound heterozygote for mutations in KLF1 gene and other iPSC lines. Resource details Peripheral blood was collected from a healthy 26-year-old subject and freshly isolated for mononuclear cells (Fig. 1A). The cells were reprogrammed into iPSCs by transducing with SeV vectors containing reprogramming factors: KOS, hc-MYC and hKLF4, and designated as MUSIi007-A cell line (Fig. 1B). SeV genome and transgenes were absent at passage 10 as confirmed by RT-PCR (Fig. 1C). The established
Corresponding author at: Siriraj Center of Excellence for Stem Cell Research, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand. E-mail address: [email protected] (S. Issaragrisil).
https://doi.org/10.1016/j.scr.2018.08.014 Received 30 July 2018; Accepted 10 August 2018 Available online 17 August 2018 1873-5061/ © 2018 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 32 (2018) 43–46
P. Potirat et al.
Fig. 1. Characterization of the MUSIi007-A iPSC line.
PBMNCs.
MUSIi007-A cell line was positive for pluripotent markers including OCT4, NANOG, SSEA-4, TRA-1-60 and TRA-1-81 as examined by immunofluorescence staining (Fig. 1D). By cell counting, 97% and 98.5% of the cells were positive for OCT4 and NANOG, respectively (Table 1. In vitro differentiation via embryoid body (EB) formation and teratoma formation assay demonstrated that the cells had ability to form cells or tissues of three embryonic germ layers as shown by immunofluorescence staining and hematoxylin and eosin (H&E) staining, respectively (Fig. 1E, F). The MUSIi007-A cell line also exhibited a normal karyotype (46, XY) (Fig. 1G) and was negative for mycoplasma contamination (Supplementary Table S1). Furthermore, their short tandem repeat (STR) profile showed the same identity to their parental
Materials and methods Cell culture and reprogramming Peripheral blood mononuclear cells (PBMNCs) were isolated from a healthy donor and cultured in Stempro™-34 serum-free medium (SFM) (Thermo Fisher Scientific) supplemented with the recombinant human cytokines as follows: 100 ng/ml stem cell factor (SCF), 100 ng/ml Flt3 ligand (Flt3L), 20 ng/ml interleukin 3 (IL-3), and 20 ng/ml interleukin 6 (IL-6) (all from R&D systems) for 4 days before transduction. The 44
Stem Cell Research 32 (2018) 43–46
P. Potirat et al.
Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Qualitative analysis (Immunofluorescence)
Normal Expression of pluripotency markers: OCT4, NANOG, SSEA-4, TRA-160 and TRA-1-81 Percentage of positive cells for pluripotent markers: OCT4: 97% NANOG: 98.5% 46XY, resolution 450–500 Not performed 16 sites tested, 100% match Not performed Not performed Mycoplasma testing by luminescence: Negative The embryoid bodies were positive for nestin, SMA, and AFP as indicated by immunofluorescence staining. iPSCs were capable of differentiating into tissues of three embryonic germ layers Not performed Not performed Not performed
Fig. 1 panel B Fig. 1 panel D
Genotype Identity Mutation analysis Microbiology and virology Differentiation potential
Donor screening Genotype additional info
Quantitative analysis (Immunofluorescence counting) Karyotype (G-banding) and resolution Microsatellite PCR (mPCR) OR STR analysis Sequencing Southern Blot OR WGS Mycoplasma Embryoid body formation and teratoma formation
HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
Fig. 1 panel D (representative) Fig. 1 panel G N/A Available with authors N/A N/A Supplementary Table S1 Fig. 1 panel E and F
N/A N/A N/A
Immunofluorescence staining
CytoTune®-iPS 2.0 Sendai reprogramming vectors (Thermo Fisher Scientific) encoding KOS, hc-MYC, hKLF4 were transduced into PBMNCs following the manufacturer's instruction. Individual iPS colonies were manually picked and transferred onto irradiated human foreskin fibroblast (iHFF) feeders. The established iPSCs were maintained in Matrigel™ (BD Biosciences, 1:30 dilution)-coated plate in mTeSR™1 medium (Stem Cell Technologies) at 37 °C with 5% CO2 and routinely passaged (1:10) using 50 mM EDTA in phosphate buffered saline (PBS) without calcium and magnesium. The cells were frozen and thawed in the presence of 10 μM Y-27632 (Axon Medchem).
Cells were fixed with 4% paraformaldehyde for 20 min. For intracellular markers, cells were permeabilized with 0.1% Triton X-100 in PBS for 10 min at room temperature. Non-specific binding was blocked with 3% BSA in PBS for 60 min followed by staining with primary antibodies overnight at 4 °C. After washing with PBS, the cells were incubated with secondary antibodies for 60 min at room temperature in the dark (Table 2). Nuclei were stained with Hoechst 33342 solution (Thermo Fisher Scientific) in 1% BSA for 30 min at room temperature. Images were taken using a fluorescence microscope (Eclipse Ti–U, Nikon) with NIS Elements D4.13.05 64-bit software. For quantitative analysis, cells positive for OCT4 and NANOG were manually counted from four images consisting of 1496 and 2679 Hoechst-positive cells, respectively.
Analysis of SeV genome and transgenes Total RNA was isolated from the MUSIi007-A cells and PBMNCs at day 3 post-transduction as a positive control using RNeasy Mini kit (Qiagen). One microgram of RNA was reverse-transcribed using the RevertAid First Strand cDNA synthesis kit (Thermo Fisher Scientific). PCR amplification was carried out on the T100™ Thermal Cycler (BioRad) using primer sets listed in Table 2. Cycle parameters were 35 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s and extension at 72 °C for 30 s.
In vitro differentiation assay Cells were treated with 1 mg/ml Dispase (Stem Cell Technologies) for 30 min at 37 °C until colonies were detached. The colonies were gently washed with DMEM/F12 medium, transferred to low-attachment
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-cytometry
Pluripotency markers
Differentiation markers
Secondary antibodies
Antibody
Dilution
Company Cat # and RRID
Mouse anti-OCT4 Rabbit anti-NANOG Mouse anti-TRA-1-60 Mouse anti-TRA-1-81 Mouse anti-SSEA-4 Mouse anti-AFP Mouse anti-SMA Mouse anti-NESTIN AlexaFlour488 goat anti-mouse IgG AlexaFlour488 goat anti-rabbit IgG
1:50 1:100 1:40 1:100 1:100 1:100 1:15 1:200 1:500 1:500
AbD Serotec Cat# MCA4958Z, RRID:AB_2167728 Millipore Cat# AB9220, RRID:AB_570613 Millipore Cat# MAB4360, RRID:AB_2119183 Millipore Cat# MAB4381, RRID:AB_177638 Millipore Cat# MAB4304, RRID:AB_177629 Millipore Cat# ST1673, RRID:AB_10693988 AbD Serotec Cat# MCA1906, RRID:AB_2222732 Millipore Cat# MAB5326, RRID:AB_11211837 Thermo Fisher Scientific Cat# A-11001, RRID:AB_2534069 Thermo Fisher Scientific Cat# A-11011, RRID:AB_143157
Primers
Sendai viral vector (RT-PCR)
Target
Forward/Reverse primer (5′-3′)
SeV KOS c-MYC GAPDH
GGATCACTAGGTGATATCGAGC/ACCAGACAAGAGTTTAAGAGATATGTATC ATGCACCGCTACGACGTGAGCGC/ACCTTGACAATCCTGATGTGG TAACTGACTAGCAGGCTTGTCG/TCCACATACAGTCCTGGATGATGATG GTCAACGGATTTGGTCGTATTG/CATGGGTGGAATCATATTGGAA
45
Stem Cell Research 32 (2018) 43–46
P. Potirat et al.
extracted using Gentra® Puregene® Cell Kit (Qiagen) and authenticated by STR analysis at 16 loci (Amelogenin, D8s1179, D21S11, D7S820, CSF1PO, D3S1358, TH01, D13S317, D16S539, D2S1338, D19S433, vWA, TPOX, D18S51, D5S818 and FGA) performed at Department of Forensic Medicine, Faculty of Medicine Siriraj Hospital.
dishes containing KO-DMEM supplemented with 20% KnockOut serum replacement, 2 mM GlutaMAX™, 0.1 mM non-essential amino acid (NEAA), 0.1 mM 2-mercaptoethanol, 1× insulin-transferrin‑selenium and 100 U/ml penicillin/streptomycin (all from Thermo Fisher Scientific) and cultured for a week with medium change every other day. EBs were plated onto 0.1% gelatin (Sigma-Aldrich)-coated plate in the same medium for additional 3–4 weeks to allow spontaneous differentiation.
Acknowledgements This study was supported by grants from the Thailand Research Fund (grant no. RTA 488–0007 to SI), the Commission on Higher Education (grant no. CHE-RES-RG-49 to SI). SI is a Senior Research Scholar of Thailand Research Fund. PP is supported by Siriraj Graduate Scholarship (grant no. B032/2556), Faculty of Medicine Siriraj Hospital, Mahidol University and the Thailand Research Fund through the Royal Golden Jubelee Ph.D. Program (grant no. PHD/0123/2556). MW is supported by Chalermphrakiat Grant, Faculty of Medicine Siriraj Hospital, Mahidol University.
Teratoma formation In vivo differentiation by teratoma formation was performed as described previously (Wattanapanitch et al., 2014). Karyotyping Cytogenetic analysis was performed with the MUSIi007-A cells. Cells were treated with KaryoMAX colcemid solution (Thermo Fisher Scientific) to stop cell division at metaphase stage. The standard Gbanded karyotyping was performed at 450–500 resolution at Siriraj Central Cytogenetic Laboratory, Faculty of Medicine Siriraj Hospital. At least 25 metaphases were karyotyped.
Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.scr.2018.08.014.
Mycoplasma contamination detection
References
The absence of mycoplasma was confirmed by a MycoAlert™ PLUS Mycoplasma Detection kit (Lonza) following the manufacturer's instruction.
Wattanapanitch, M., Klincumhom, N., Potirat, P., Amornpisutt, R., Lorthongpanich, C., Upratya, Y., Laowtammathron, C., Kheolamai, P., Poungvarin, N., Issaragrisil, S., 2014. Dual small-molecule targeting of SMAD signaling stimulates human induced pluripotent stem cells toward neural lineages. PLoS One 9 (9), e106952.
Short tandem repeat (STR) analysis Genomic DNA of the PBMNCs and the MUSIi007-A cells was
46
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
Establishment of a human iPSC line (MUSIi007-A) from peripheral blood of normal individual using Sendai viral vectors Ponthip Potirata,b, Methichit Wattanapanitchc, Pakpoom Kheolamaid, Surapol Issaragrisilb,e,
T
⁎
a
Department of Immunology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand Siriraj Center of Excellence for Stem Cell Research, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand c Siriraj Center for Regenerative Medicine, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand d Division of Cell Biology, Department of Pre-clinical Sciences, Faculty of Medicine, Thammasat University, Pathumthani, Thailand e Division of Hematology, Department of Medicine, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand b
A B S T R A C T
Human induced pluripotent stem cell (iPSC) line was generated from peripheral blood mononuclear cells (PBMNCs) isolated from a 26-year-old healthy subject to use as a control group for the iPSC line carrying compound heterozygote for mutation in KLF1 gene. The cells were reprogrammed using integration-free method, Sendai viral (SeV) vectors containing KOS, hc-MYC and hKLF4. The established iPSC line (MUSIi007-A) exhibited a normal karyotype, expressed pluripotent markers and displayed in vitro and in vivo differentiation potential into cells of three embryonic germ layers. Resource table
Unique stem cell line MUSIi007-A identifier Alternative name(s) of SeV-iPSC stem cell line Institution Siriraj Center of Excellence for Stem Cell Research, Faculty of Medicine Siriraj Hospital, Mahidol University Contact information of Ponthip Potirat, [email protected] distributor Surapol Issaragrisil, [email protected] Type of cell line iPSCs Origin Human Additional origin info Age: 26-year-old Sex: Male Ethnicity: Thai Cell source Peripheral blood mononuclear cells Clonality Clonal Method of Integration-free Sendai viral vectors reprogramming Genetic modification N/A Type of modification N/A Associated disease N/A Gene/locus N/A Method of N/A modification Name of transgene or N/A resistance
⁎
Inducible/constitutive system Date archived/stock date Cell line repository/ bank Ethical approval
N/A December 2014 N/A Siriraj Institutional Review Board (SiRB), no. Si248/2011, Faculty of Medicine Siriraj Hospital, Mahidol University, Thailand.
Resource utility We generated a human iPSC line from PBMNCs of a healthy subject using a non-integrating Sendai viral vectors. This cell line was used as a control for comparison with the iPSC line carrying compound heterozygote for mutations in KLF1 gene and other iPSC lines. Resource details Peripheral blood was collected from a healthy 26-year-old subject and freshly isolated for mononuclear cells (Fig. 1A). The cells were reprogrammed into iPSCs by transducing with SeV vectors containing reprogramming factors: KOS, hc-MYC and hKLF4, and designated as MUSIi007-A cell line (Fig. 1B). SeV genome and transgenes were absent at passage 10 as confirmed by RT-PCR (Fig. 1C). The established
Corresponding author at: Siriraj Center of Excellence for Stem Cell Research, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand. E-mail address: [email protected] (S. Issaragrisil).
https://doi.org/10.1016/j.scr.2018.08.014 Received 30 July 2018; Accepted 10 August 2018 Available online 17 August 2018 1873-5061/ © 2018 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 32 (2018) 43–46
P. Potirat et al.
Fig. 1. Characterization of the MUSIi007-A iPSC line.
PBMNCs.
MUSIi007-A cell line was positive for pluripotent markers including OCT4, NANOG, SSEA-4, TRA-1-60 and TRA-1-81 as examined by immunofluorescence staining (Fig. 1D). By cell counting, 97% and 98.5% of the cells were positive for OCT4 and NANOG, respectively (Table 1. In vitro differentiation via embryoid body (EB) formation and teratoma formation assay demonstrated that the cells had ability to form cells or tissues of three embryonic germ layers as shown by immunofluorescence staining and hematoxylin and eosin (H&E) staining, respectively (Fig. 1E, F). The MUSIi007-A cell line also exhibited a normal karyotype (46, XY) (Fig. 1G) and was negative for mycoplasma contamination (Supplementary Table S1). Furthermore, their short tandem repeat (STR) profile showed the same identity to their parental
Materials and methods Cell culture and reprogramming Peripheral blood mononuclear cells (PBMNCs) were isolated from a healthy donor and cultured in Stempro™-34 serum-free medium (SFM) (Thermo Fisher Scientific) supplemented with the recombinant human cytokines as follows: 100 ng/ml stem cell factor (SCF), 100 ng/ml Flt3 ligand (Flt3L), 20 ng/ml interleukin 3 (IL-3), and 20 ng/ml interleukin 6 (IL-6) (all from R&D systems) for 4 days before transduction. The 44
Stem Cell Research 32 (2018) 43–46
P. Potirat et al.
Table 1 Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Qualitative analysis (Immunofluorescence)
Normal Expression of pluripotency markers: OCT4, NANOG, SSEA-4, TRA-160 and TRA-1-81 Percentage of positive cells for pluripotent markers: OCT4: 97% NANOG: 98.5% 46XY, resolution 450–500 Not performed 16 sites tested, 100% match Not performed Not performed Mycoplasma testing by luminescence: Negative The embryoid bodies were positive for nestin, SMA, and AFP as indicated by immunofluorescence staining. iPSCs were capable of differentiating into tissues of three embryonic germ layers Not performed Not performed Not performed
Fig. 1 panel B Fig. 1 panel D
Genotype Identity Mutation analysis Microbiology and virology Differentiation potential
Donor screening Genotype additional info
Quantitative analysis (Immunofluorescence counting) Karyotype (G-banding) and resolution Microsatellite PCR (mPCR) OR STR analysis Sequencing Southern Blot OR WGS Mycoplasma Embryoid body formation and teratoma formation
HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
Fig. 1 panel D (representative) Fig. 1 panel G N/A Available with authors N/A N/A Supplementary Table S1 Fig. 1 panel E and F
N/A N/A N/A
Immunofluorescence staining
CytoTune®-iPS 2.0 Sendai reprogramming vectors (Thermo Fisher Scientific) encoding KOS, hc-MYC, hKLF4 were transduced into PBMNCs following the manufacturer's instruction. Individual iPS colonies were manually picked and transferred onto irradiated human foreskin fibroblast (iHFF) feeders. The established iPSCs were maintained in Matrigel™ (BD Biosciences, 1:30 dilution)-coated plate in mTeSR™1 medium (Stem Cell Technologies) at 37 °C with 5% CO2 and routinely passaged (1:10) using 50 mM EDTA in phosphate buffered saline (PBS) without calcium and magnesium. The cells were frozen and thawed in the presence of 10 μM Y-27632 (Axon Medchem).
Cells were fixed with 4% paraformaldehyde for 20 min. For intracellular markers, cells were permeabilized with 0.1% Triton X-100 in PBS for 10 min at room temperature. Non-specific binding was blocked with 3% BSA in PBS for 60 min followed by staining with primary antibodies overnight at 4 °C. After washing with PBS, the cells were incubated with secondary antibodies for 60 min at room temperature in the dark (Table 2). Nuclei were stained with Hoechst 33342 solution (Thermo Fisher Scientific) in 1% BSA for 30 min at room temperature. Images were taken using a fluorescence microscope (Eclipse Ti–U, Nikon) with NIS Elements D4.13.05 64-bit software. For quantitative analysis, cells positive for OCT4 and NANOG were manually counted from four images consisting of 1496 and 2679 Hoechst-positive cells, respectively.
Analysis of SeV genome and transgenes Total RNA was isolated from the MUSIi007-A cells and PBMNCs at day 3 post-transduction as a positive control using RNeasy Mini kit (Qiagen). One microgram of RNA was reverse-transcribed using the RevertAid First Strand cDNA synthesis kit (Thermo Fisher Scientific). PCR amplification was carried out on the T100™ Thermal Cycler (BioRad) using primer sets listed in Table 2. Cycle parameters were 35 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s and extension at 72 °C for 30 s.
In vitro differentiation assay Cells were treated with 1 mg/ml Dispase (Stem Cell Technologies) for 30 min at 37 °C until colonies were detached. The colonies were gently washed with DMEM/F12 medium, transferred to low-attachment
Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-cytometry
Pluripotency markers
Differentiation markers
Secondary antibodies
Antibody
Dilution
Company Cat # and RRID
Mouse anti-OCT4 Rabbit anti-NANOG Mouse anti-TRA-1-60 Mouse anti-TRA-1-81 Mouse anti-SSEA-4 Mouse anti-AFP Mouse anti-SMA Mouse anti-NESTIN AlexaFlour488 goat anti-mouse IgG AlexaFlour488 goat anti-rabbit IgG
1:50 1:100 1:40 1:100 1:100 1:100 1:15 1:200 1:500 1:500
AbD Serotec Cat# MCA4958Z, RRID:AB_2167728 Millipore Cat# AB9220, RRID:AB_570613 Millipore Cat# MAB4360, RRID:AB_2119183 Millipore Cat# MAB4381, RRID:AB_177638 Millipore Cat# MAB4304, RRID:AB_177629 Millipore Cat# ST1673, RRID:AB_10693988 AbD Serotec Cat# MCA1906, RRID:AB_2222732 Millipore Cat# MAB5326, RRID:AB_11211837 Thermo Fisher Scientific Cat# A-11001, RRID:AB_2534069 Thermo Fisher Scientific Cat# A-11011, RRID:AB_143157
Primers
Sendai viral vector (RT-PCR)
Target
Forward/Reverse primer (5′-3′)
SeV KOS c-MYC GAPDH
GGATCACTAGGTGATATCGAGC/ACCAGACAAGAGTTTAAGAGATATGTATC ATGCACCGCTACGACGTGAGCGC/ACCTTGACAATCCTGATGTGG TAACTGACTAGCAGGCTTGTCG/TCCACATACAGTCCTGGATGATGATG GTCAACGGATTTGGTCGTATTG/CATGGGTGGAATCATATTGGAA
45
Stem Cell Research 32 (2018) 43–46
P. Potirat et al.
extracted using Gentra® Puregene® Cell Kit (Qiagen) and authenticated by STR analysis at 16 loci (Amelogenin, D8s1179, D21S11, D7S820, CSF1PO, D3S1358, TH01, D13S317, D16S539, D2S1338, D19S433, vWA, TPOX, D18S51, D5S818 and FGA) performed at Department of Forensic Medicine, Faculty of Medicine Siriraj Hospital.
dishes containing KO-DMEM supplemented with 20% KnockOut serum replacement, 2 mM GlutaMAX™, 0.1 mM non-essential amino acid (NEAA), 0.1 mM 2-mercaptoethanol, 1× insulin-transferrin‑selenium and 100 U/ml penicillin/streptomycin (all from Thermo Fisher Scientific) and cultured for a week with medium change every other day. EBs were plated onto 0.1% gelatin (Sigma-Aldrich)-coated plate in the same medium for additional 3–4 weeks to allow spontaneous differentiation.
Acknowledgements This study was supported by grants from the Thailand Research Fund (grant no. RTA 488–0007 to SI), the Commission on Higher Education (grant no. CHE-RES-RG-49 to SI). SI is a Senior Research Scholar of Thailand Research Fund. PP is supported by Siriraj Graduate Scholarship (grant no. B032/2556), Faculty of Medicine Siriraj Hospital, Mahidol University and the Thailand Research Fund through the Royal Golden Jubelee Ph.D. Program (grant no. PHD/0123/2556). MW is supported by Chalermphrakiat Grant, Faculty of Medicine Siriraj Hospital, Mahidol University.
Teratoma formation In vivo differentiation by teratoma formation was performed as described previously (Wattanapanitch et al., 2014). Karyotyping Cytogenetic analysis was performed with the MUSIi007-A cells. Cells were treated with KaryoMAX colcemid solution (Thermo Fisher Scientific) to stop cell division at metaphase stage. The standard Gbanded karyotyping was performed at 450–500 resolution at Siriraj Central Cytogenetic Laboratory, Faculty of Medicine Siriraj Hospital. At least 25 metaphases were karyotyped.
Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.scr.2018.08.014.
Mycoplasma contamination detection
References
The absence of mycoplasma was confirmed by a MycoAlert™ PLUS Mycoplasma Detection kit (Lonza) following the manufacturer's instruction.
Wattanapanitch, M., Klincumhom, N., Potirat, P., Amornpisutt, R., Lorthongpanich, C., Upratya, Y., Laowtammathron, C., Kheolamai, P., Poungvarin, N., Issaragrisil, S., 2014. Dual small-molecule targeting of SMAD signaling stimulates human induced pluripotent stem cells toward neural lineages. PLoS One 9 (9), e106952.
Short tandem repeat (STR) analysis Genomic DNA of the PBMNCs and the MUSIi007-A cells was
46