Expression and purification of TAT-NDRG2 recombinant protein and evaluation of its anti-proliferative effect on LNCaP cell line

Protein Expression and Purification 138 (2017) 25e33

Contents lists available at ScienceDirect

Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep

Expression and purification of TAT-NDRG2 recombinant protein and evaluation of its anti-proliferative effect on LNCaP cell line Fahimeh Farokhinejad a, b, Abbas Behzad Behbahani a, b, Gholam Reza Rafiei Dehbidi a, b, Mohammad Ali Takhshid a, b, * a b

Department of Medical Biotechnology, School of Paramedical Sciences, Shiraz University of Medical Sciences, Shiraz, Iran Diagnostic Laboratory Sciences and Technology Research Center, School of Paramedical Sciences, Shiraz University of Medical Sciences, Shiraz, Iran

a r t i c l e i n f o

a b s t r a c t

Article history: Received 14 May 2017 Received in revised form 11 July 2017 Accepted 11 July 2017 Available online 13 July 2017

N-myc downstream regulated gene2 (NDRG2) belongs to tumor suppressor protein family of NDRG. Antiproliferative and anti-metastasis of NDRG2 overexpression has been demonstrated in a number of tumors. The aim of this study was to fuse the gene of Trans Activator of Transcription (TAT) protein transduction domain with NDRG2 gene and express and purify TAT-NDRG2 fusion protein in order to investigate the effects of TAT-NDRG2 protein on proliferation and apoptosis of LNCaP prostate carcinoma cell line. pET28a-TAT-NDRG2 and pET28a-NDRG2 plasmids were constructed and transformed into E. coli-BL21(DE3). TAT-NDRG2 and NDRG2 proteins were expressed in the bacteria, purified using affinity chromatography and verified using western blotting. The effects of TAT-NDRG2 and NDRG2 protein treatment on LNCaP cells proliferation and apoptosis were evaluated using MTT assay and AnnexinV, 7AAD flow cytometry assay, respectively. Western blot analysis confirmed the expression and purification of TAT-NDRG2 and NDRG2 proteins. Treatment of LNCaP cells with TAT-NDRG2 protein increased cell death and induced apoptosis significantly (P < 0.05) compared to control and NDRG2 protein-treated cells. These results suggest that TAT-NDRG2 protein can be considered as a therapeutic modality for the treatment of tumors. © 2017 Published by Elsevier Inc.

Keywords: TAT peptide NDRG2 Prostate cancer Apoptosis

Individual contribution Study conception and design Gholam Reza Rafiei Dehbidi, Fahimeh Farokhinejad, Mohammad Ali Takhshid, Abbas Behzad Behbahani.

Drafting of manuscript Fahimeh Farokhinejad, Mohammad Ali Takhshid. Critical revision Mohammad Ali Takhshid.

Acquisition of data Fahimeh Farokhinejad. Analysis and interpretation of data Mohammad Ali Takhshid.

* Corresponding author. Department of Medical Biotechnology, School of Paramedical Sciences, Shiraz University of Medical Sciences, Shiraz, Iran. E-mail addresses: [email protected] (F. Farokhinejad), behzadba@ gmail.com (A.B. Behbahani), [email protected] (G.R. Rafiei Dehbidi), [email protected] (M.A. Takhshid). http://dx.doi.org/10.1016/j.pep.2017.07.004 1046-5928/© 2017 Published by Elsevier Inc.

1. Introduction NDRG2 is an emerging tumor suppressor protein belongs to NDRG protein family. Reduced expression of NDRG2 which correlated with poor prognosis has been demonstrated in numerous cancers including breast cancer [1], esophageal squamous cell carcinoma [2], hepatoblastoma [3], pancreatic cancer [4], lung adenocarcinoma [5], gall bladder carcinoma [6], colon carcinoma [7] and prostatic carcinoma [8]. Furthermore, the inhibitory effects of NDRG2 overexpression on proliferation and metastatic potential of several human tumor cells has been reported in both in vitro and in vivo studies. For example in T24 cells and nude mouse

26

F. Farokhinejad et al. / Protein Expression and Purification 138 (2017) 25e33

xenografts, lentivirus mediated over expression of NDRG2 led to suppression of tumor cells proliferation and invasion [9]. Similar findings have been demonstrated in other human tumors, suggesting general anti-tumor effects of NDRG2. Several mechanisms including suppression of cell cycle [8,10], induction of cell apoptosis [11,12] and autophagy [13] are among mechanisms underlying antiproliferating effects of NDRG2. Gene therapy using adenoviral and lentiviral vectors was applied in the aforementioned studies [8,14]. However, gene therapy is usually accompanied by serious problems such as immune responses to viral vectors, permanent gene expression, and integration of the genes in undesired situation [15,16]. Thus, protein therapy using penetrable peptide decorated tumor suppressor protein has been introduced as an alternative therapeutic modality for cancer treatment. Among various cell penetrating peptides (CPPs), TAT (transactivator of transcription) peptide (YGRKKRRQRRR from HIV-1 TAT) is a commonly used peptide in protein therapy [17]. Nonimmunogenic, low-toxic and efficient cell penetration properties make TAT as a good candidate for protein delivery to the cells. This technique is successfully used for delivery of p53 [18], Cu, Znsuperoxide dismutase [19] and RhoGDI2 [20] to the cells. The aim of present work was to evaluate the effects of TAT-NDRG2 recombinant protein on cell death and apoptosis of LNCaP cell line. To this end, TAT-NDRG2 protein was expressed in E. coli using a TATNDRG2 recombinant plasmid. TAT-NDRG2 protein was purified and transduced to LNCaP cell line. The effects of TAT-NDRG2 protein to cell death and apoptosis of LNCaP cell line were then investigated. 2. Materials and methods 2.1. Reagents, strains, and cells Restriction endonucleases (NdeI, BamHI and HindIII), T4 DNA ligase and PFU polymerase purchased from Fermentas (Litvanya) and Page Ruler™ Pre stained Protein Ladder was obtained from Invitrogen (USA). The primers and oligonucleotides were synthesized in Bioneer (South Korea). The agarose gel extraction kit was purchased from Qiagen (Germany). The pET28a expression vector, the pEGFP vector, BL21 (DE3) and DH5a strains of E. coli were obtained from Diagnostic Laboratory Sciences and Technology Research Center- Shiraz, Iran. Anti-his-tag antibody was purchased from Sigma (St. Louis, MO). Kanamycin and ampicillin were purchased from Sigma- Aldrich (USA). Excel band 1 KB DNA ladder was obtained from SMOBio (Taiwan). The human prostate cancer LNCaP cell line was obtained from Iran's Pasteur Institute. 2.2. Construction of TAT coding sequence TAT coding sequence with two flanking NdeI and BamHI restriction sites in 50 and 30 ends was constructed using annealing of two complementary oligonucleotides (50 TATGGGCC GCAAAAAACGCCGCCAGCGCCGCCGCGGCGGCGGCGGCG 30 and 50 GATCCGCCG CCGCCGCCGCGGCGGCGCGGCGGCGTTTTTTGCGGCC CA 30 ). Briefly, the oligonucleotides were mixed and annealed with heating and gradually cooling reaction. 2.3. Construction of pET28a-TAT-EGFP plasmids pET28a-TAT-EGFP and pET28a-EGFP plasmids were constructed to evaluate the ability of the constructed-TAT to deliver the conjugated protein into the cell. To this end, EGFP gene was amplified from pEGFP using PCR with primers contained BamHI and HindIII restriction sites (Forward 50 CGATGGATCCGTGAGCAAGGG 30 and reverse 50 CT CTAAGCTTTTACTTGTACAGCTCGTCCATG 30 ). PCR was

initiated with denaturation at 95  C (5 min), continued with 35 cycles (30 'denaturation at 95  C, 30 0 annealing at 56  C, 1 min extension at 72  C) and 5 min final extension in 72  C. AmplifiedEGFP was digested with the BamHI and HindIII and ligated with TAT. TAT-EGFP fragments were ligated into pTZ57R/T (TA cloning vectorFermentas) and then sub cloned into a pET28a vector (Fig. 1). For construction of pET28a-EGFP control plasmids, digested EGFP were directly ligated into a pET28a. 2.4. Construction of pET28a-TAT- NDRG2 plasmids To construct the pET28a-TAT-NDRG2 plasmid (Fig. 1), NDRG2 cDNA was amplified with PCR from RG211577 vector (OriGene) using Forward (50 GGATGGATCCATGGCGGAG CTGCAGGAG 30 ) and reverse (50 CGCGTAAGCTTTTAACAGGAGACCTCCATGGTG 30 ) primers contained BamHI and HindIII restriction sites in 50 and 30 tails, respectively. Amplified-NDRG2 was digested with BamHI and HindIII and then cloned into downstream of TAT-sequenced in the pET28a-TAT sequence -containing plasmid. pET28a-NDRG2 control plasmids, was constructed using ligation of NDRG2 into a pET28a without TAT sequence. 2.5. Expression of recombinant proteins Constructed plasmids were transformed into E. coli-DH5a competent cells. After amplification, the plasmids were extracted from E. coli-DH5a by mini prep extraction kit and were sequenced. The plasmids separately were transformed into the expression host E. coli BL21 (DE3) on LB-agar plate contained 70 mg/mL kanamycin at 37  C. A single colony from transformed colonies was inoculated in 5 mL LB broth contained 70 mg/mL kanamycin and shaken at 160 rpm in a 37  C incubator overnight. 2.5 mL starter culture was inoculated in 250 mL fresh LB media supplemented with 70 mg/mL kanamycin at the same conditions. When the OD 600 was reached 0.4, to expression induction, isopropyl-beta-D-thiogalactopyranoside (IPTG) with final concentration of 1 mM were added to cultures and incubated for 4 h. 2.6. Purification of recombinant proteins 2.5 mL starter culture containing transformed bacteria was inoculated in 250 mL fresh LB media contained 70 mg/mL kanamycin and 1 mM IPTG and shaken at 160 rpm in a 37  C incubator for 4 h. The bacterial cells were harvested by centrifugation at 4000 rpm for 10 min at 4  C and 12.5 mL of cold 1x binding buffer (50 mM NaH2PO4, 500 mM NaCl, 10 mM imidazole and 8 M urea, pH 8) was added to the pellets and samples were lysed with sonication on ice. Following centrifugation (15 min at 13000 rpm) supernatant containing recombinant His tagged proteins was ready to load on Ni-NTA affinity chromatography column (Invitrogen). 1 mL of resin was poured into the column and allowed to settle completely. After washing the column with 6 mL binding buffer each of samples including EGFP, TAT-EGFP, NDRG2 and TAT-NDRG2 proteins that contained 6XHis tag was separately loaded on column at a flow rate of 0.5 ml/min. After washing the column with 6 mL washing buffer (50 mM NaH2PO4, 500 mM NaCl, 40 mM imidazole and 8 M urea, pH 8) recombinant proteins were eluted into 3 fractions using 3 mL of elution buffer (50 mM NaH2PO4, 500 mM NaCl, 250 mM imidazole and 8 M urea, pH 8) and then eluted fractions were analyzed on 12% SDS-PAGE. To solubilize the formed inclusion bodies, 8 M of urea was used in purification buffers so to remove urea and to achieve optimal biological activity, the proteins dialyzed against binding buffer that contained 6 M, 4 M, 2 M and 0 M of urea, respectively. The proteins concentrations were determined using Bradford assay. Following dialysis, to confirm the

F. Farokhinejad et al. / Protein Expression and Purification 138 (2017) 25e33

27

Fig. 1. Schematic representation of chimeric pET28a-TAT-NDRG2 plasmid and its elements. For the construction of TAT-NDRG2, EGFP was replaced with NDRG2 in pET28a-TATEGFP.

refolding of proteins and biological activities, the transduction and effects of recombinant proteins on LNCaP and HEK-293 cells was assessed. 2.7. Western blot analysis To verify production of TAT-NDRG2 and NDRG2 proteins, 20 ml of fraction 2 containing purified proteins was mixed with 20 ml of sample buffer and boiled at 100  C for 5 min and then analyzed on 12% SDS-PAGE. The samples were transferred to PVDF membrane using Semi-Dry Transfer protocol at 15 Amp for 1 h. PVDF membrane was rinsed with blocking buffer (5% skim milk) overnight at 4  C. After washing, the membrane was incubated with anti-His tag antibody conjugated with HRP for 1 h and then TMB substrate added on the PVDF surface and the bands were visualized. 2.8. Cell culture LNCaP and HEK-293 cells were grown in RPMI 1640 and DMEM (Thermo-Fisher scientific), respectively, contained 10% FBS (Gibco) and 1% penicillin/streptomycin (Gibco) at 37  C humidified incubator with 5% CO2. The cells were seeded into the 6-well and 96well plates at densities of 150000 and 8000 cells per well, respectively. 2.9. Transduction of TAT-EGFP protein into HEK-293 and LNCaP cell lines

2.10. The effect of TAT-NDRG2 protein on LNCap cells viability LNCaP cells were seeded into 96-well plates and after the confluency of 70%, the cells were treated with different concentrations of NDRG2 protein (0.1 mM, 0.5 mM, 1.5 mM and 2 mM), TAT-NDRG2 protein and vehicle (as control group). After 24 h 20 mL of MTT solution (5 mg/mL) was added to each well and incubated at 37  C for 4 h. Afterward, 100 mL DMSO was added per wells and shaken for 10 min. The absorbance were then measured at 490 nm wavelength using ELISA reader instrument. 2.11. The effect of TAT-NDRG2 protein on HEK-293 cells HEK-293 cells and LNCaP cells were seeded into 6-well plates. After reaching 70% of confluency, the cells were treated with 1.5 mM of TAT-NDRG2 protein. After 24 h microscopy images in HEK-293 as non-cancer cells and LNCaP cells as cancer cells were only used to qualitatively assess apoptotic activity. 2.12. The effect of TAT-NDRG2 protein on apoptosis of LNCap cells LNCaP cells were seeded into 6-well plates. After reaching 70% of confluency, the cells were treated with 1.5 mM of NDRG2 protein, 1.5 mM of TAT-NDRG2 protein and vehicle (control group). After 24 h apoptosis was detected using FITC AnnexinV/7AAD flow cytometric analysis. 3. Results

The cells were treated with various concentrations (0.1 mM, 0.5 mM, 1.5 mM and 2 mM) of EGFP and TAT-EGFP proteins in 96-well and 6-well plates when the cells were confluent. After 2 h, 16 h, 24 h and 48 h the cells were washed 3 times with PBS and then analyzed by fluorescent microscopy.

3.1. Expression and purification of TAT-EGFP protein In this study basic domain of HIV1-TAT was constructed using annealing of two complementary single strand oligonucleotides.

28

F. Farokhinejad et al. / Protein Expression and Purification 138 (2017) 25e33

The formation of the annealed double stranded oligonucleotides was checked using 3% agarose gel electrophoresis. Double stranded oligonucleotides were cut out from the agarose gel with a clean scalpel. The concentration of double stranded oligonucleotide was 156 ng per mL.As can be seen in the Fig. 2a, a 50 bp band that was visualized after electrophoresis, confirm construction of TAT double stranded DNA (Fig. 2a). To investigation of the ability of constructed-TAT DNA in producing of TAT peptide and transduction of proteins into cells, EGFP gene (714 bp) was amplified and ligated to TAT double stranded fragment. TAT-EGFP fragment was cloned in pET28a expression vector to produce pET28a-TAT-EGFP plasmid. Following transformation of recombinant plasmids into E. coliBL21(DE3) and induction of protein expression with 1 mM IPTG, over expression of EGFP (lane 4) and TAT-EGFP (lane 2) proteins was confirmed using SDS-PAGE (Fig. 2b). TAT-EGFP and EGFP proteins containing 6X-His tag were then purified using Ni-NTA column affinity chromatography. Each three eluted fractions of EGFP and TAT-EGFP proteins after washing with elution buffer were collected and analyzed on 12% SDS-PAGE. Fraction 2 was the most purified protein in both EGFP and TAT-EGFP proteins purification (Fig. 3) and purified proteins were confirmed using SDS-PAGE analysis (Fig. 2c). The concentration of TAT-EGFP and EGFP proteins was approximately 0.01 mg/mL and 0.02 mg/mL of cell culture, respectively. 3.2. Expression and purification of TAT-NDRG2 protein TAT-NDRG2 over-expressing plasmid (pET28a-TAT-NDRG2, Fig. 1) and NDRG2 over-expressing plasmid (pET28a-NDRG2) were constructed and transformed into E. coli-BL21 (DE3) cells. Protein expression was induced using 1 mM IPTG. NDRG2 (40 kDa) and TAT-NDRG2 (45 kDa) proteins were over-expressed in large scale expression system. The proteins were then purified using Ni-NTA column affinity chromatography. Each three eluted fractions of NDRG2 and TAT-NDRG2 proteins after washing with elution buffer were collected and analyzed on 12% SDS-PAGE. Fraction 2 was the most purified protein in both NDRG2 and TAT-NDRG2 proteins purification (Fig. 3). The purification of the proteins was confirmed using SDS-PAGE and western blotting analysis using HRPconjugated- anti His tag antibody (Fig. 4). The concentration of TAT-NDRG2 and NDRG2 proteins was approximately 0.01 mg/mL of cell culture. Concentration of TAT-EGFP, TAT-NDRG2, EGFP and NDRG2 proteins were extrapolated on the basis of standard curve

that obtained from Bradford assay and purity and yield of purification were calculated (Table 1). The concentration of TAT-NDRG2 and NDRG2 proteins were 0.5 mg/mL after dialysis. 3.3. Transduction of TAT-EGFP protein into HEK-293 and LNCaP cell line To assess the ability of constructed TAT peptide to transduce proteins into cells, HEK-293 and LNCaP cell lines were treated with different concentrations of purified EGFP and TAT-EGFP proteins. As shown in fluorescence microscopy images presented in Fig. 5, TATEGFP in optimized concentration of 1.5 mM after 24 h successfully transduce HEK-293 and LNCaP cells while no fluorescence detected in the cells treated with EGFP without TAT sequence (Fig. 5). No cellular toxicity was observed in both cell types studied following TAT-EGFP treatment. 3.4. The effect of TAT-NDRG2 protein on LNCap cell viability To evaluate the effect of TAT-NDRG2 protein on LNCap cells viability, LNCaP cells were treated with TAT-NDRG2 (1.5 mM) and NDRG2 (1.5 mM) for 24 h and cell viability was determined using MTT assay. The results revealed that treatment with TAT-NDRG2 protein reduced LNCaP cells viability to 52 ± 9% of control nontreated cells (P < 0.001), while treatment with NDRG2 had no significant effects on cell viability compared to untreated control cells (P ¼ 0.076) (Fig. 6). 3.5. The effect of TAT-NDRG2 protein on HEK-293 cells To assess the effect of TAT-NDRG2 on HEK-293 cells as noncancer cells, HEK-293 and LNCaP cells were treated with 1.5 mM TAT-NDG2 protein for 24 h. Microscopy images in HEK-293 and LNCaP cells were used to qualitatively assess apoptotic activity. Following TAT-NDRG2 treatment no cellular toxicity was observed in HEK-293 cells but LNCaP cells were strikingly changed and morphological characteristics of LNCaP cells were altered. (Fig. 7). 3.6. The effect of TAT-NDRG2 protein on apoptosis of LNCap cells In order to investigate the effects of NDRG2 and TAT-NDRG2 proteins on apoptosis of LNCap cells, the cells were treated with TAT-NDRG2 protein and NDRG2 protein for 24 h and the percentage

Fig. 2. Expression and purification of TAT-EGFP. a) The formation of the double stranded oligonucleotides. TAT double stranded DNA band with 50 bp was visualized on agarose gel electrophoresis. Lane 1, double stranded oligonucleotide of TAT. Lane 2, single strand of TAT oligonucleotide. b) SDS-PAGE analysis of EGFP and TAT-EGFP proteins expression. Lane 1 and 2 show expression of TAT-EGFP before and after addition of 1 mM IPTG, respectively. Lane 3 and 4 show expression of EGFP before and after addition of 1 mM IPTG, respectively. Lane M shows protein size marker. c) Purification of EGFP (25 kDa) and TAT-EGFP (29 kDa) proteins using Ni-NTA Purification System. Lane 1: EGFP protein, Lane 2: TAT-EGFP protein.

F. Farokhinejad et al. / Protein Expression and Purification 138 (2017) 25e33

29

Fig. 3. Purification of recombinant proteins and verification by SDS-PAGE. a) Purification of EGFP and TAT-EGFP proteins. Lane 1e3 show eluted fractions 1e3 of EGFP protein, respectively, after washing with elution buffer. Lane 4e6 show eluted fractions 1e3 of TAT-EGFP protein, respectively, after washing with elution buffer. As indicated, fractions 2 (lane 2 and 5) contained the most purified EGFP and TAT-EGFP proteins with 25 kDa and 29 kDa, respectively. Lanes 7 and 8 show fractions after washing EGFP and TAT-EGFP columns with washing buffer, respectively. Lanes 9 and 10 show flow through contained bacterial crude extract of EGFP and TAT-EGFP expression, respectively. b) Purification of NDRG2 and TAT-NDRG2 proteins. Lane 1e3 show eluted fractions 1e3 of NDRG2 protein, respectively, after washing with elution buffer. Lane 4e6 show eluted fractions 1e3 of TAT-NDRG2 protein, respectively, after washing with elution buffer. As indicated, fractions 2 (lane 2 and 5) contained the most purified NDRG2 and TAT-NDRG2 proteins with 40 kDa and 45 kDa, respectively. Lanes 7 and 8 show fractions after washing of NDRG2 and TAT-NDRG2 columns with washing buffer, respectively. Lanes 9 and 10 indicate flow through contained bacterial crude extract of NDRG2 and TAT-NDRG2, respectively. Lane M shows protein size marker.

Fig. 4. Verification of NDRG2 and TAT-NDRG2 purification using SDS-PAGE and western blot analysis. TAT-NDRG2 and NDRG2 were purified using Ni-NTA column affinity chromatography and purified proteins were loaded on SDS-PAGE (a). TAT-NDRG2 (45 kDa) and NDRG2 (40 kDa) appeared on SDS-PAGE. Western blot analysis (b) verified the His-tag in the 45 kDa recombinant TAT-NDRG2 protein and 40 kDa NDRG2 protein. M: size marker.

Table 1 Purification of recombinant proteins. Purification step

Total protein (mg)

Target protein (mg)

Purity (mg)

Overall yield (mg)

Crude extract (TAT-NDRG2) Affinity chromatography (TAT-NDRG2) Crude extract (NDRG2) Affinity chromatography (NDRG2) Crude extract (TAT-EGFP) Affinity chromatography (EGFP) Crude extract (EGFP) Affinity chromatography (EGFP)

8.3 0.65 3.33 0.54 4.85 1.26 4.85 1.26

0.71 0.62 0.6 0.51 1.16 1.14 1.16 1.14

8.5 95 18 18 24 90 24 90

100 87 100 100 100 98 100 98

30

F. Farokhinejad et al. / Protein Expression and Purification 138 (2017) 25e33

Fig. 5. Transduction of TAT-EGFP Protein into HEK-293 and LNCaP cells. (a) HEK-293 cells before treatment with TAT-EGFP. (b) HEK-293 cells, 24 h after treatment with 1.5 mM TATEGFP protein. (c) LNCaP cells before treatment with TAT-EGFP. (d) LNCaP cells, 24 h after treatment with 1.5 mM TAT-EGFP protein. No fluorescence was detected when the cells were treated with EGFP protein for 24 h (data was not shown). TAT-EGFP protein transduced HEK-293 and LNCaP cell lines greater than 80%. Images were captured using the 40 X objective on the fluorescence microscope.

4. Discussion

Fig. 6. The effect TAT-NDRG2 protein on viability of LNCap cells using MTT assay. LNCap cells were treated with NDRG2 protein (1.5 mM) and TAT-NDRG2 protein (1.5 mM) for 24 h and cell viability was evaluated using MTT assay. The results showed the mean ± S. D of at least three independent experiments (One way ANOVA followed by LSD post hoc test).

of cells of total apoptotic cells (early þ late apoptotic cells) were determined using AnnexinV/7-AAD flow cytometry method. The finding showed that treatment of LNCap cells with TAT-NDRG2 increased the percentage of apoptotic cells to 29 ± 3% which showed significant difference compared to no-treated control cells (P ¼ 0.008) and NDRG2 treated cells (P ¼ 0.035). Treatment with NDRG2 had no significant effects on LNCap apoptosis compared to control cells (P ¼ 0.076). (Fig. 8).

Since NDRG2 as a tumor suppressor was down-regulated in variety of cancers including prostate carcinoma [21e23], it was supposed that the restoration of this protein in tumor cells may have therapeutic potential. In this context, therapeutic effects of viral and non-viral mediated NDRG2 gene therapy against proliferation and invasion of numerous tumor cells has been demonstrated [8,14]. However, gene therapy has several limitations that restricts its usage in cancer treatment [15]. Protein therapy is introduced as an alternative therapeutic modality for gene therapy in cancer treatment. In this approach a protein with anti-cancer properties, such as a tumor suppressor protein, is produced exogenously and transduced into tumor cells by conjugating with a CPP. In this study TAT peptide-a member of the CPPs family and one of the most popular and efficient vectors for protein delivery into cells- [24,25] was recruited for NDRG2 protein delivery into LNCaP prostate cancer cells. It has been reported that the basic region of TAT peptide, (GRKKRRQRRRQ) had a good efficiency for delivering of proteins ranging from 10 to 120 kDa. Because of NDRG2 protein possess 40 kDa weight, we anticipated that NDRG2 can readily be transduced in to cells using TAT peptide. In this study, we constructed TAT coding DNA by annealing two complementary single strands of DNA. We selected EGFP to test the ability of the constructed TAT in protein transduction. The fluorescent property of EGFP makes it an ideal molecule for live monitoring of protein translocation and intercellular dynamics. Furthermore, the fluorescence of EGFP appeared only after its proper folding [26] so it can be used for evaluation of refolding condition of proteins.

F. Farokhinejad et al. / Protein Expression and Purification 138 (2017) 25e33

31

Fig. 7. The effect of TAT-NDRG2 protein on HEK-293 and LNCaP cells. (a) LNCaP cells before treatment with TAT-NDRG2. (b) LNCaP cells, 24 h after treatment with 1.5 mM TATNDRG2 protein. (c) HEK-293 cells before treatment with TAT-NDRG2. (d) HEK-293 cells, 24 h after treatment with 1.5 mM TAT-NDRG2 protein. No toxicity was detected when HEK-293 as non-cancer cells were treated with TAT-NDRG2 protein for 24 h. Images were captured using the 40 X objective on the fluorescence microscope.

Fig. 8. Flow cytometry analysis. The apoptotic cells were stained with FITC-labeled AnnexinV and 7-AAD and analyzed by flow cytometry. Untreated LNCap cells (a), LNCaP cells were treated with TAT-NDRG2 (b) and NDRG2 (c) for 24 h. The percentage of total apoptotic cells in different groups showed in the histogram (d). The represented data are mean ± SD of at least two independent experiments and were analyzed using one way ANOVA followed by LSD post hoc test. Q1, Q2, Q3, and Q4 show necrotic, late apoptotic, early apoptotic, and viable cells, respectively. Percent of total apoptotic cells is calculated from Q2þQ3.

32

F. Farokhinejad et al. / Protein Expression and Purification 138 (2017) 25e33

Following dialysis, EGFP and TAT-EGFP proteins were functional and they had their fluorescence property greater than 75%. Our findings also revealed that TAT-EGFP readily enters into HEK-293 and LNCaP cells greater than 80%, suggesting that refolding yield after dialysis was greater than 75% and our constructed TAT was functional for the transduction of recombinant proteins into cells. NDRG2 protein is a monomer without glycosylation sites and disulfide bonds [27], so we used a prokaryotic host (E. coli-BL21 (DE3)) for the expression of NDRG2 and TAT-NDRG2. Hwang et al. [27] determined protein structure of NDRG2 and showed that Helix a 6 in the structure of NDRG2 plays a pivotal role in its functions such as TCF/b-catenin signaling. Induction of cell death and apoptosis are well-documented effects of NDRG2 that has been demonstrated in many tumor cells, including prostate carcinoma cell lines [28]. After dialysis of the proteins by refolding yields of approximately 75%, to check the entry of TAT-NDRG2 into cells and its functionality, we treated LNCaP prostate cell line with TAT-NDRG2 or with NDRG2 alone and investigated their effects on cell viability. Based on MTT assay data, transduction of LNCaP cells with TAT-NDRG2 protein caused a significant decrease in cell viability to 52% while NDRG2 protein alone had no significant effect on cell viability. This observation confirmed that not only TAT-NDRG2 entered into the cells by the TAT moiety, but also kept its normal cell death-inducing effect. As apoptosis had been the most reported mode of NDRG2 causing cell death [12], our study was followed by the investigating the effects of TAT-NDRG2 and NDRG2 alone on LNCaP cells apoptosis using AnnexinV/7AAD flow cytometric analysis. Our finding clearly indicated that the TATNDRG2 protein had the ability to activate apoptosis by approximately 29% while NDRG2 alone had not significant effect on cell apoptosis, suggesting that TAT-NDRG2 protein was functionally active after transduction into LNCaP cell lines. Moreover, NDRG2 is a cytoplasmic protein that translocate into cell nucleus and affect the expression of genes involved in tumor cell proliferation and metastasis [29]. Considering the decrease of expression of NDRG2 in LNCaP prostate cancer cells [21e23], and according to the results of this study, transduction and accumulation of TAT-NDRG2 into LNCaP cells cause activation of apoptosis and cell death. To show that TAT-NDRG2 transduction in non-cancer cells result in no cytotoxic effects, HEK-293 cells as normal cells were treated with TAT-NDRG2 fusion protein. TAT-NDRG2 transduction into HEK-293 as non-cancer cells cause no toxicity (Fig. 7). So it can be concluded that transduction of TAT-NDRG2 into LNCaP cells whose NDRG2 expression decreased caused apoptosis induction and in non-cancer cells caused no effects. Gisela Tünnemann et al. showed that TAT transduced efficiently in a range of 0.1e10 mM [30]. Also K.A. Elliott et al. determined 2 mM E2F-1/TATHA as optimal concentration for cellular uptake [31]. The concentrations of TAT fusion proteins used in this study for transduction into cells was tested in 0.1 mM, 0.5 mM, 1.5 mM and 2 mM and optimized concentration was determined 1.5 mM. TAT-fused proteins entered the cells through direct penetration or endocytic mechanisms [30]. In this study, we did not investigate the mechanism of TATNDRG2 transduction into LNCaP cells, however the observation of apoptosis and cell death in LNCaP cells following treatment with TAT-NDRG2, suggesting that this protein was released in the cytoplasm of LNCaP cells. 5. Conclusion TAT-NDRG2 recombinant protein with the ability to transduce LNCaP cell line was expressed and purified in this study. TATdNDRG2 protein suppressed LNCaP cells proliferation via inducing cell apoptosis. These results suggest that TAT-NDRG2 may have clinical relevance for anti-cancer therapies.

Compliance with ethical standards Funding This study was supported by a grant (93-01-10-8611) from the Vice-Chancellor for Research Affairs of Shiraz University of Medical Sciences. Conflicts of interest Mohammad Ali Takhshid declares that he has no conflict interest. Fahimeh Farokhinejad declares that she has no conflict interest. Abbas Behzad Behbahani declares that he has no conflict interest. Gholam Reza Rafiei Dehbidi declares that he has no conflict interest.

of of of of

Ethical approval This article does not contain any studies with human participants or animals performed by any of the authors. Acknowledgment This manuscript was extracted from the MSc thesis of Fahimeh Farokhinejad (Project NO. 93-01-10-8611). It was supported by a grant (93-01-10-8611) from the Vice-Chancellor for Research Affairs of Shiraz University of Medical Sciences. We are also grateful to all staff of diagnostic laboratory sciences and technology research center for technical assistance in this work. References [1] A. Lorentzen, R.H. Lewinsky, J. Bornholdt, L.K. Vogel, C. Mitchelmore, Expression profile of the N-myc Downstream Regulated Gene 2 (NDRG2) in human cancers with focus on breast cancer, BMC Cancer 11 (2011) 14e21. [2] W. Cao, G. Yu, Q. Lu, J. Zhang, Low expression of N-myc downstream-regulated gene 2 in oesophageal squamous cell carcinoma correlates with a poor prognosis, BMC Cancer 13 (2013) 305e313. €deke, E. Luxenburger, F. Trippel, K. Becker, B. Ha €berle, J. Müller-Ho € cker, [3] J. Go D. von Schweinitz, R. Kappler, Low expression of N-myc downstreamregulated gene 2 (NDRG2) correlates with poor prognosis in hepatoblastoma, Hepatol. Int. 10 (2016) 370e376. [4] A. Yamamura, K. Miura, H. Karasawa, K. Morishita, K. Abe, Y. Mizuguchi, Y. Saiki, S. Fukushige, N. Kaneko, T. Sase, Suppressed expression of NDRG2 correlates with poor prognosis in pancreatic cancer, Biochem. Biophys. Res. Commun. 441 (2013) 102e107. [5] H. Wang, W. Wang, X. Wang, K. Cai, H. Wu, Q. Ju, Z. Huang, X. Gao, Reduced NMyc downstream-regulated gene 2 expression is associated with CD24 upregulation and poor prognosis in patients with lung adenocarcinoma, Med. Oncol. 29 (2012) 3162e3168. [6] S.-p. Song, S.-b. Zhang, R. Liu, L. Yao, Y.-q. Hao, M.-m. Liao, Z.-h. Li, NDRG2 down-regulation and CD24 up-regulation promote tumor aggravation and poor survival in patients with gallbladder carcinoma, Med. Oncol. 29 (2012) 1879e1885. [7] Y.-J. Kim, S.Y. Yoon, J.-T. Kim, E.Y. Song, H.G. Lee, H.J. Son, S.Y. Kim, D. Cho, I. Choi, J.H. Kim, NDRG2 expression decreases with tumor stages and regulates TCF/b-catenin signaling in human colon carcinoma, Carcinogenesis 30 (2009) 598e605. [8] C. Yu, G. Wu, N. Dang, W. Zhang, R. Zhang, W. Yan, Y. Zhao, L. Gao, Y. Wang, N. Beckwith, Inhibition of N-myc downstream-regulated gene 2 in prostatic carcinoma, Cancer Biol. Ther. 12 (2011) 304e313. [9] R. Li, C. Yu, F. Jiang, L. Gao, J. Li, Y. Wang, N. Beckwith, L. Yao, J. Zhang, G. Wu, Overexpression of N-Myc downstream-regulated gene 2 (NDRG2) regulates the proliferation and invasion of bladder cancer cells in vitro and in vivo, PLoS One 8 (2013) e76689. [10] T. Ichikawa, S. Nakahata, M. Fujii, H. Iha, K. Morishita, Loss of NDRG2 enhanced activation of the NF-kB pathway by PTEN and NIK phosphorylation for ATL and other cancer development, Sci. Rep. 5 (2015) 1e13. [11] C. Yu, G. Wu, R. Li, L. Gao, F. Yang, Y. Zhao, J. Zhang, R. Zhang, J. Zhang, L. Yao, NDRG2 acts as a negative regulator downstream of androgen receptor and inhibits the growth of androgen-dependent and castration-resistant prostate

F. Farokhinejad et al. / Protein Expression and Purification 138 (2017) 25e33 cancer, Cancer Biol. Ther. 16 (2015) 287e296. [12] W. Hu, Y. Yang, C. Fan, Z. Ma, C. Deng, T. Li, J. Lv, W. Yao, J. Gao, Clinical and pathological significance of N-Myc downstream-regulated gene 2 (NDRG2) in diverse human cancers, Apoptosis 21 (2016) 675e682. [13] Y. Guo, J. Liu, Y. Guan, Hypoxia induced upregulation of miR-301a/b contributes to increased cell autophagy and viability of prostate cancer cells by targeting NDRG2, Eur. Rev. Med. Pharmacol. Sci. 20 (2016) 101e108. [14] L. Gao, G.-J. Wu, X.-W. Liu, R. Zhang, L. Yu, G. Zhang, F. Liu, C.-G. Yu, J.-L. Yuan, H. Wang, Suppression of invasion and metastasis of prostate cancer cells by overexpression of NDRG2 gene, Cancer Lett. 310 (2011) 94e100. [15] I.M. Verma, N. Somia, Gene therapy-promises, problems and prospects, Nature 389 (1997) 239e242. [16] J.M. Gump, S.F. Dowdy, TAT transduction: the molecular mechanism and therapeutic prospects, Trends Mol. Med. 13 (2007) 443e448. [17] S. Piantavigna, M.E. Abdelhamid, C. Zhao, X. Qu, G.A. McCubbin, B. Graham, L. Spiccia, A.P. O'Mullane, L.L. Martin, Mechanistic details of the membrane perforation and passive translocation of TAT peptides, Chem. Plus. Chem. 80 (2015) 83e90. [18] J. Ryu, H.J. Lee, K.-A. Kim, J.Y. Lee, K.S. Lee, J. Park, S.Y. Choi, Intracellular delivery of p53 fused to the basic domain of HIV-1 Tat, Mol. Cells (Springer Sci. Bus. Media BV) 17 (2004) 353e359. [19] H.Y. Kwon, W.S. Eum, H.W. Jang, J.H. Kang, J. Ryu, B. Ryong Lee, L.H. Jin, J. Park, S.Y. Choi, Transduction of Cu, Zn-superoxide dismutase mediated by an HIV-1 Tat protein basic domain into mammalian cells, FEBS Lett. 485 (2000) 163e167. [20] R. Xu, Y. Dong, L. Wang, X. Tao, A. Sun, D. Wei, TAT-RhoGDI2, a novel tumor metastasis suppressor fusion protein: expression, purification and functional evaluation, Appl. Microbiol. Biotechnol. 98 (2014) 9633e9641. [21] A. Lorentzen, L.K. Vogel, R.H. Lewinsky, M. Sæbø, C.F. Skjelbred, S. Godiksen, G. Hoff, K.M. Tveit, I.M.B. Lothe, T. Ikdahl, Expression of NDRG2 is downregulated in high-risk adenomas and colorectal carcinoma, BMC Cancer 7 (2007) 192e199.

33

[22] L. Wang, N. Liu, L. Yao, F. Li, J. Zhang, Y. Deng, J. Liu, S. Ji, A. Yang, H. Han, NDRG2 is a new HIF-1 target gene necessary for hypoxia-induced apoptosis in A549 cells, Cell. Physiol. Biochem. 21 (2008) 239e250. [23] W. Cao, J.-l. Zhang, D.-y. Feng, X.-w. Liu, Y. Li, L.-f. Wang, L.-b. Yao, H. Zhang, J. Zhang, The effect of adenovirus-conjugated NDRG2 on p53-mediated apoptosis of hepatocarcinoma cells through attenuation of nucleotide excision repair capacity, Biomaterials 35 (2014) 993e1003. [24] F. Wang, Y. Wang, X. Zhang, W. Zhang, S. Guo, F. Jin, Recent progress of cellpenetrating peptides as new carriers for intracellular cargo delivery, J. Control. Release 174 (2014) 126e136. [25] M. Rizzuti, M. Nizzardo, C. Zanetta, A. Ramirez, S. Corti, Therapeutic applications of the cell-penetrating HIV-1 Tat peptide, Drug Discov. Today 20 (2015) 76e85. [26] N.J. Caron, Y. Torrente, G. Camirand, M. Bujold, P. Chapdelaine, K. Leriche, N. Bresolin, J.P. Tremblay, Intracellular delivery of a Tat-eGFP fusion protein into muscle cells, Mol. Ther. J. Am. Soc. Gene Ther. 3 (2001) 310e318. [27] J. Hwang, Y. Kim, H.B. Kang, L. Jaroszewski, A.M. Deacon, H. Lee, W.-C. Choi, K.J. Kim, C.-H. Kim, B.S. Kang, Crystal structure of the human N-Myc downstream-regulated gene 2 protein provides insight into its role as a tumor suppressor, J. Biol. Chem. 286 (2011) 12450e12460. [28] L. Gao, G.J. Wu, X.W. Liu, R. Zhang, L. Yu, G. Zhang, F. Liu, C.G. Yu, J.L. Yuan, H. Wang, L.B. Yao, Suppression of invasion and metastasis of prostate cancer cells by overexpression of NDRG2 gene, Cancer Lett. 310 (2011) 94e100. [29] W. Hu, C. Fan, P. Jiang, Z. Ma, X. Yan, S. Di, S. Jiang, T. Li, Y. Cheng, Y. Yang, Emerging role of N-myc downstream-regulated gene 2 (NDRG2) in cancer, Oncotarget 7 (2016) 209e223. [30] G. Tünnemann, R.M. Martin, S. Haupt, C. Patsch, F. Edenhofer, M.C. Cardoso, Cargo-dependent mode of uptake and bioavailability of TAT-containing proteins and peptides in living cells, FASEB J. 20 (2006) 1775e1784. [31] K.A. Elliott, L.F. Rickords, J.M. Labrum, Transduction of E2F-1 TAT fusion proteins represses expression of hTERT in primary ductal breast carcinoma cell lines, Mol. cancer 7 (2008) 28e37.