- Email: [email protected]
Expression of adenosine A2a receptor gene in rat dorsal root and autonomic ganglia
Neuroscience Letters 246 (1998) 21–24
Expression of adenosine A2a receptor gene in rat dorsal root and autonomic ganglia Alain Kaelin-Lang*, Theres Lauterburg, Jean-Marc Burgunder Neuromorphological Laboratory, Department of Neurology, University Hospital, Inselspital, CH-3010 Bern, Switzerland Received 23 February 1998; accepted 2 March 1998
Abstract The adenosine A2a receptors (A2aR) play an important role in the purinergic mediated neuromodulation. The presence of A2aR in the brain is well established. In contrast, little is known about their expression in the periphery. The purpose of this study was to investigate the expression of A2aR gene in the autonomic (otic, sphenopalatine, ciliary, cervical superior ganglia and carotid body) and in the dorsal root ganglia of normal rat. Hybridization histochemistry with S35-labelled radioactive oligonucleotide probes was used. An expression of A2aR gene was found in the large neuronal cells of the rat dorsal root ganglia. The satellite cells showed no expression of A2aR gene. In the superior cervical ganglion, isolated ganglion cells expressed A2aR. In the carotid body clusters of cells with a strong A2aR gene expression were found. In contrast, the ciliary and otic ganglia did not expressed A2aR gene, and only few small sized A2aR expressing cells were demonstrated in the sphenopalatine ganglion. The discrete distribution of A2aR gene expression in the peripheral nervous system speaks for a role of this receptor in the purinergic modulation of sensory information as well as in the sympathetic nervous system. 1998 Published by Elsevier Science Ireland Ltd.
Keywords: Adenosine; A2a receptors; Rat; Peripheral nervous system; Autonomic ganglia; Spinal ganglia
The extracellular nucleoside adenosine (A) plays a role in the pre- and postsynaptic modulation of neuronal activity through several membrane receptors. Four receptors-subtypes have been cloned: the A1, A2a, A2b and A3 receptors [9]. The presence of high affinity A2a adenosine receptors (A2aR) in the central nervous system, particularly in the striatum is well known. In contrast, little is known about the presence of the A2a receptors in the peripheral nervous system, although pharmacological and physiological studies suggest a function of A2a receptors in the transmission of nociception [2] as well as in the control of vegetative functions [10]. In the developing rat nervous system a widespread, partly transient distribution of A2aR was found [15] and a RT-PCR study on tissue homogenates [7] has shown the presence of A2aR mRNA in several peripheral tissue. However, the cellular localisation of the A2a receptors in the peripheral nervous system is not known.
* Corresponding author. Tel.: +41 31 6322111; fax: +41 31 6329679; e-mail: [email protected]
The aim of the present study was to investigate the expression of A2aR gene in peripheral ganglia. Tissue samples included both sympathetic (superior cervical ganglion) and parasympathetic ganglia (otic, ciliary and sphenopalatine ganglia) as well as primary sensory ganglia (dorsal root ganglia). Adult female Wistar rats were killed by decapitation under carbon dioxide anaesthesia. The dorsal root ganglia were rapidly removed, frozen on dry ice or in nitrogencooled isopentane and kept at −70°C until further processing. Seven other adult male Wistar rats (200–250 g) were anaesthetized with intraperitoneal injection of sodium pentobarbital (50 mg/kg). They were killed by bleeding. Otic, sphenopalatine, ciliary and cervical superior ganglia were quickly removed and frozen in nitrogen-cooled isopentane. They were kept at −70°C until further use. The in situ hybridization histochemistry was done according to [16]. Briefly, series of 12 mm adjacent sections were mounted onto gelatin-coated slides. After fixation with 4% formaldehyde in phosphate buffered saline (PBS), the sections were washed twice in PBS. They were then placed in 0.25% acetic anhy-
0304-3940/98/$19.00 1998 Published by Elsevier Science Ireland Ltd. All rights reserved PII S0304- 3940(98) 00216- X
22
A. Kaelin-Lang et al. / Neuroscience Letters 246 (1998) 21–24
dride in 0.1 M triethanolamine/0.9% NaCl, pH 8, for 10 min and delipidated in ethanol and chloroform. The sections were treated with 0.5–1 × 106 d.p.m. of the oligonucleotide probe. An oligonucleotide (48 mer: gaccgagtccgctcccctggcaggggctggctctccatctgcttcagc) recognising the bases 891– 938 of the A2a rat gene [3] was commercially synthetised (Microsynth, Windisch, Switzerland). This probe has already been used for in situ hybridization histochemistry in the rat brain and characterized by others [8]. Labelling was performed using [a-35S]deoxyadenosine-triphosphate (Amersham) and terminal deoxynucleotidyl-transferase
(Boeh-ringer Mannheim). In order to exclude an unspecific binding, incubation was also performed with a 100× concentration of unlabelled probe together with the radioactive probe. Incubation was performed for 20 h at 37°C. After washing, the sections were placed for 1 week on X-ray film (Kodak Biomax MR1) for visualization. Slides were then dipped into Kodak autoradiography emulsion (NTB 3), developed after 8 weeks and then counterstained with 0.1% toluidine blue. The localization of A2aR mRNA was done with dark field microscopy (Zeiss Axiophot microscope).
Fig. 1. (A) Dark field microscopy of a dorsal root ganglia with A2aR gene expressing cells (arrows). (A’) Bright field microscopy (counterstained with toluidin blue). (B) Dark field microscopy of the carotid body. Cluster of small cells with a strong expression of A2aR gene as well as one isolated cell are seen (arrows). (B’) Bright field microscopy of the same region (counterstained with toluidin blue). (C) Dark field microscopy of the superior cervical ganglion. Isolated A2aR gene expressing neurons are shown (arrows). (C’) Bright field microscopy of the same region (counterstained with toluidin blue). Scale bar, 0.2 mm. spc, spinal cord; cab, carotid bifurcation; g, glomus caroticus cells; *, blood vessel; n, nerve; ca, carotid artery.
A. Kaelin-Lang et al. / Neuroscience Letters 246 (1998) 21–24
A specific expression of A2a receptors gene was found in large neuronal cells of the rat dorsal root ganglia (Fig. 1A). In each ganglion 5–10% of the large neuronal cells were positive. In contrast, no expression of A2a receptors gene was found in the satellite cells. In the cervical superior ganglion, isolated neurons expressed A2aR gene (Fig. 1C). Clusters of small flatter cells as well as few isolated cells with a strong expression of A2aR were found in the carotid body (Fig. 1B). These small cells are probably glomus cells type II. In contrast only a few small sized, probably non-neuronal A2aR gene expressing cells were found in the sphenopalatine ganglion. No expression of A2aR was demonstrated in both the otic and ciliary ganglia. Our results with an expression of A2a receptors gene in the dorsal root ganglia speaks for an important function of adenosine A2a receptors in the modulation of primary spinal afferences. Since adenosine can stimulate peripheral nerve and induces nociception [2] it is possible that the A2aR are localized on ganglion cells which mediate nociception. On the other hand, intrathecal injection of adenosine agonists produces antinociception [6,13]. Based on pharmacological and physiological studies, it was suggested that the antinociception induced by adenosine at the spinal level is mediated by A1 adenosine receptors [13], whereas the A2 receptors mediate nociception on the peripheral nerves [2]. Since ATP acting at the ionotropic receptors P2X is an important mediator of nociception in peripheral tissues [1,5], it is possible that adenosine resulting from extracellular ATP breakdown acts synergistically at A2aR. A knock out mouse model with defective A2a gene showed a higher nociceptive threshold suggesting also that the A2a receptors mediate nociception [11]. Our results are compatible with the hypothesis of a mediation of nociception by A2aR in the periphery. However, a function of the adenosine A2a receptors in the modulation of other sensory information is also possible. In the ciliary and otic ganglion, no expression of A2aR was found. In the sphenopalatine ganglion, another intracranial parasympathetic structure, only few, probably nonneuronal cells expressed A2aR gene. This suggests that the A2aR do not play a major physiological role in the parasympathetic information processing. In contrast a strong expression of A2aR gene was found in discrete cells of the cervical superior ganglia and of the carotid body. In the developing rat, A2aR expression was found in the carotid body [15]. Our results confirm this finding and suggest that the type II glomus cells express A2aR. Adenosine is a potent vasodilator in the periphery as well as in the central nervous system [14]. Although the effects of adenosine on the cardiovascular system is mediated in part by adenosine receptors on the heart and on the blood vessels, several studies suggest also an action of adenosine on the autonomic nervous system and on the central nervous system [12]. In fetal sheep, autonomic blockade reduces the chronotropic effects of adenosine [10] suggesting also that
23
the sympathetic autonomic nervous system is stimulated by adenosine. Moreover, CGS21680C, a specific A2aR agonist shows the same effects as adenosine, suggesting that the A2a receptors mediate some of the cardiovascular effects of adenosine [10]. On the other hand, adenosine analogues causes hyperpolarisation in the isolated rat superior cervical ganglion, acting probably trough A1 adenosine receptors [4]. Adenosine A1 receptors seem also to be responsible for the modulation of voltage gated calcium channels in isolated rat sympathetic neurons [17]. Therefore, adenosine is probably an important modulator of sympathetic activity and acts through several peripheral receptors. It is probable that this complex modulation of sympathetic activity is mediated, at least in part, by A2aR localized in the carotid body and in the superior cervical ganglion neurons. [1] Bardoni, R., Goldstein, P.A., Lee, C.J., Gu, J.G. and MacDermott, A.B., ATP P2X receptors mediate fast synaptic transmission in the dorsal horn of the rat spinal cord, J. Neurosci., 17 (1997) 5297–5304. [2] Burnstock, G. and Wood, J.N., Purinergic receptors: their role in nociception and primary afferent neurotransmission, Curr. Opin. Neurobiol., 6 (1996) 526–532. [3] Chern, Y., King, K. and Lai, H.T., Molecular cloning of a novel adenosine receptor gene from rat brain, Biochem. Biophys. Res. Commun., 185 (1992) 304–309. [4] Connolly, G.P., Stone, T.W. and Brown, F., Characterization of the adenosine receptors of the rat superior cervical ganglion, Br. J. Pharmacol., 110 (1993) 854–860. [5] Cook, S.P., Vulchanova, L., Hargreaves, K.M., Elde, R. and McCleskey, E.W., Distinct ATP receptors on pain-sensing and stretch sensing neurons, Nature, 387 (1997) 505– 508. [6] De Lander, G.E. and Keil, G.J., Antinociception induced by intrathecal coadministration of selective adenosine receptor and selective opioid receptor agonists in mice, J. Pharmacol. Exp. Ther., 268 (1994) 943–951. [7] Dixon, A.K., Gubitz, A.K., Sirinathsinghji, D.J.S., Richardson, P.J. and Freemann, T.C., Tissue distribution of adenosine receptor mRNAs in the rat, Br. J. Pharmacol., 118 (1996) 1461–1468. [8] Fink, J.S., Weaver, D.R., Rivkees, S.A., Peterfreund, R.A., Pollack, A.E., Adler, E.M. and Reppert, S.M., Molecular cloning of the rat adenosine receptor: selective co-expression with D2 dopamine receptors in rat striatum, Mol. Brain Res., 14 (1992) 186–195. [9] Fredholm, B.B., Abbracchio, M.P., Burnstock, M.P., Daly, J.W., Harden, T.K., Jacobson, K.A., Leff, P. and Williams, M., Nomenclature and classification of purinoceptors, Pharmacol. Rev., 46 (1994) 143–156. [10] Koos, B.J., Mason, B.A. and Ducsay, C.A., Cardiovascular responses to adenosine in fetal sheep: autonomic blockade, Am. J. Physiol., 264 (1993) 526–532. [11] Ledent, C., Vaugeois, J.M., Schiffmann, S.N., Pedrazzini, T., El Yacoubi, M., Vanderhaeghen, J.J., Costentin, J., Heath, J.K., Vassart, G. and Parmentier, M., Aggressiveness, hypoalgesia and high blood pressure in mice lacking the adenosine A2a receptor, Nature, 388 (1997) 674–678. [12] Phillis, J.W., Scislo, T.J. and O’Leary, D.S., Purines and the nucleus tractus solitarius: effects on cardiovascular and respiratory function, Clin. Exp. Pharmacol. Physiol., 24 (1997) 738– 742. [13] Sawynock, J., Sweeney, M.I. and White, T.D., Classification of
24
A. Kaelin-Lang et al. / Neuroscience Letters 246 (1998) 21–24
adenosine receptors mediating antinociception in the rat spinal cord, Br. J. Pharmacol., 88 (1986) 923–930. [14] Tucker, A.L. and Linden, J., Cloned receptors and cardiovascular responses to adenosine, Cardiovasc. Res., 27 (1993) 62–67. [15] Weaver, D.R., A2a adenosine receptor gene expression in developing rat brain, Mol. Brain Res., 20 (1993) 313–327.
[16] Young III, W.S., In situ hybridization histochemical detection of neuropeptide mRNA using DNA and RNA probes, Methods Enzymol., 168 (1989) 702–710. [17] Zhu, Y. and Ikeda, S.R., Adenosine modulates voltage-gated Ca2 + channels in adult rat sympathetic neurons, J. Neurophysiol., 70 (1993) 610–620.
Expression of adenosine A2a receptor gene in rat dorsal root and autonomic ganglia Alain Kaelin-Lang*, Theres Lauterburg, Jean-Marc Burgunder Neuromorphological Laboratory, Department of Neurology, University Hospital, Inselspital, CH-3010 Bern, Switzerland Received 23 February 1998; accepted 2 March 1998
Abstract The adenosine A2a receptors (A2aR) play an important role in the purinergic mediated neuromodulation. The presence of A2aR in the brain is well established. In contrast, little is known about their expression in the periphery. The purpose of this study was to investigate the expression of A2aR gene in the autonomic (otic, sphenopalatine, ciliary, cervical superior ganglia and carotid body) and in the dorsal root ganglia of normal rat. Hybridization histochemistry with S35-labelled radioactive oligonucleotide probes was used. An expression of A2aR gene was found in the large neuronal cells of the rat dorsal root ganglia. The satellite cells showed no expression of A2aR gene. In the superior cervical ganglion, isolated ganglion cells expressed A2aR. In the carotid body clusters of cells with a strong A2aR gene expression were found. In contrast, the ciliary and otic ganglia did not expressed A2aR gene, and only few small sized A2aR expressing cells were demonstrated in the sphenopalatine ganglion. The discrete distribution of A2aR gene expression in the peripheral nervous system speaks for a role of this receptor in the purinergic modulation of sensory information as well as in the sympathetic nervous system. 1998 Published by Elsevier Science Ireland Ltd.
Keywords: Adenosine; A2a receptors; Rat; Peripheral nervous system; Autonomic ganglia; Spinal ganglia
The extracellular nucleoside adenosine (A) plays a role in the pre- and postsynaptic modulation of neuronal activity through several membrane receptors. Four receptors-subtypes have been cloned: the A1, A2a, A2b and A3 receptors [9]. The presence of high affinity A2a adenosine receptors (A2aR) in the central nervous system, particularly in the striatum is well known. In contrast, little is known about the presence of the A2a receptors in the peripheral nervous system, although pharmacological and physiological studies suggest a function of A2a receptors in the transmission of nociception [2] as well as in the control of vegetative functions [10]. In the developing rat nervous system a widespread, partly transient distribution of A2aR was found [15] and a RT-PCR study on tissue homogenates [7] has shown the presence of A2aR mRNA in several peripheral tissue. However, the cellular localisation of the A2a receptors in the peripheral nervous system is not known.
* Corresponding author. Tel.: +41 31 6322111; fax: +41 31 6329679; e-mail: [email protected]
The aim of the present study was to investigate the expression of A2aR gene in peripheral ganglia. Tissue samples included both sympathetic (superior cervical ganglion) and parasympathetic ganglia (otic, ciliary and sphenopalatine ganglia) as well as primary sensory ganglia (dorsal root ganglia). Adult female Wistar rats were killed by decapitation under carbon dioxide anaesthesia. The dorsal root ganglia were rapidly removed, frozen on dry ice or in nitrogencooled isopentane and kept at −70°C until further processing. Seven other adult male Wistar rats (200–250 g) were anaesthetized with intraperitoneal injection of sodium pentobarbital (50 mg/kg). They were killed by bleeding. Otic, sphenopalatine, ciliary and cervical superior ganglia were quickly removed and frozen in nitrogen-cooled isopentane. They were kept at −70°C until further use. The in situ hybridization histochemistry was done according to [16]. Briefly, series of 12 mm adjacent sections were mounted onto gelatin-coated slides. After fixation with 4% formaldehyde in phosphate buffered saline (PBS), the sections were washed twice in PBS. They were then placed in 0.25% acetic anhy-
0304-3940/98/$19.00 1998 Published by Elsevier Science Ireland Ltd. All rights reserved PII S0304- 3940(98) 00216- X
22
A. Kaelin-Lang et al. / Neuroscience Letters 246 (1998) 21–24
dride in 0.1 M triethanolamine/0.9% NaCl, pH 8, for 10 min and delipidated in ethanol and chloroform. The sections were treated with 0.5–1 × 106 d.p.m. of the oligonucleotide probe. An oligonucleotide (48 mer: gaccgagtccgctcccctggcaggggctggctctccatctgcttcagc) recognising the bases 891– 938 of the A2a rat gene [3] was commercially synthetised (Microsynth, Windisch, Switzerland). This probe has already been used for in situ hybridization histochemistry in the rat brain and characterized by others [8]. Labelling was performed using [a-35S]deoxyadenosine-triphosphate (Amersham) and terminal deoxynucleotidyl-transferase
(Boeh-ringer Mannheim). In order to exclude an unspecific binding, incubation was also performed with a 100× concentration of unlabelled probe together with the radioactive probe. Incubation was performed for 20 h at 37°C. After washing, the sections were placed for 1 week on X-ray film (Kodak Biomax MR1) for visualization. Slides were then dipped into Kodak autoradiography emulsion (NTB 3), developed after 8 weeks and then counterstained with 0.1% toluidine blue. The localization of A2aR mRNA was done with dark field microscopy (Zeiss Axiophot microscope).
Fig. 1. (A) Dark field microscopy of a dorsal root ganglia with A2aR gene expressing cells (arrows). (A’) Bright field microscopy (counterstained with toluidin blue). (B) Dark field microscopy of the carotid body. Cluster of small cells with a strong expression of A2aR gene as well as one isolated cell are seen (arrows). (B’) Bright field microscopy of the same region (counterstained with toluidin blue). (C) Dark field microscopy of the superior cervical ganglion. Isolated A2aR gene expressing neurons are shown (arrows). (C’) Bright field microscopy of the same region (counterstained with toluidin blue). Scale bar, 0.2 mm. spc, spinal cord; cab, carotid bifurcation; g, glomus caroticus cells; *, blood vessel; n, nerve; ca, carotid artery.
A. Kaelin-Lang et al. / Neuroscience Letters 246 (1998) 21–24
A specific expression of A2a receptors gene was found in large neuronal cells of the rat dorsal root ganglia (Fig. 1A). In each ganglion 5–10% of the large neuronal cells were positive. In contrast, no expression of A2a receptors gene was found in the satellite cells. In the cervical superior ganglion, isolated neurons expressed A2aR gene (Fig. 1C). Clusters of small flatter cells as well as few isolated cells with a strong expression of A2aR were found in the carotid body (Fig. 1B). These small cells are probably glomus cells type II. In contrast only a few small sized, probably non-neuronal A2aR gene expressing cells were found in the sphenopalatine ganglion. No expression of A2aR was demonstrated in both the otic and ciliary ganglia. Our results with an expression of A2a receptors gene in the dorsal root ganglia speaks for an important function of adenosine A2a receptors in the modulation of primary spinal afferences. Since adenosine can stimulate peripheral nerve and induces nociception [2] it is possible that the A2aR are localized on ganglion cells which mediate nociception. On the other hand, intrathecal injection of adenosine agonists produces antinociception [6,13]. Based on pharmacological and physiological studies, it was suggested that the antinociception induced by adenosine at the spinal level is mediated by A1 adenosine receptors [13], whereas the A2 receptors mediate nociception on the peripheral nerves [2]. Since ATP acting at the ionotropic receptors P2X is an important mediator of nociception in peripheral tissues [1,5], it is possible that adenosine resulting from extracellular ATP breakdown acts synergistically at A2aR. A knock out mouse model with defective A2a gene showed a higher nociceptive threshold suggesting also that the A2a receptors mediate nociception [11]. Our results are compatible with the hypothesis of a mediation of nociception by A2aR in the periphery. However, a function of the adenosine A2a receptors in the modulation of other sensory information is also possible. In the ciliary and otic ganglion, no expression of A2aR was found. In the sphenopalatine ganglion, another intracranial parasympathetic structure, only few, probably nonneuronal cells expressed A2aR gene. This suggests that the A2aR do not play a major physiological role in the parasympathetic information processing. In contrast a strong expression of A2aR gene was found in discrete cells of the cervical superior ganglia and of the carotid body. In the developing rat, A2aR expression was found in the carotid body [15]. Our results confirm this finding and suggest that the type II glomus cells express A2aR. Adenosine is a potent vasodilator in the periphery as well as in the central nervous system [14]. Although the effects of adenosine on the cardiovascular system is mediated in part by adenosine receptors on the heart and on the blood vessels, several studies suggest also an action of adenosine on the autonomic nervous system and on the central nervous system [12]. In fetal sheep, autonomic blockade reduces the chronotropic effects of adenosine [10] suggesting also that
23
the sympathetic autonomic nervous system is stimulated by adenosine. Moreover, CGS21680C, a specific A2aR agonist shows the same effects as adenosine, suggesting that the A2a receptors mediate some of the cardiovascular effects of adenosine [10]. On the other hand, adenosine analogues causes hyperpolarisation in the isolated rat superior cervical ganglion, acting probably trough A1 adenosine receptors [4]. Adenosine A1 receptors seem also to be responsible for the modulation of voltage gated calcium channels in isolated rat sympathetic neurons [17]. Therefore, adenosine is probably an important modulator of sympathetic activity and acts through several peripheral receptors. It is probable that this complex modulation of sympathetic activity is mediated, at least in part, by A2aR localized in the carotid body and in the superior cervical ganglion neurons. [1] Bardoni, R., Goldstein, P.A., Lee, C.J., Gu, J.G. and MacDermott, A.B., ATP P2X receptors mediate fast synaptic transmission in the dorsal horn of the rat spinal cord, J. Neurosci., 17 (1997) 5297–5304. [2] Burnstock, G. and Wood, J.N., Purinergic receptors: their role in nociception and primary afferent neurotransmission, Curr. Opin. Neurobiol., 6 (1996) 526–532. [3] Chern, Y., King, K. and Lai, H.T., Molecular cloning of a novel adenosine receptor gene from rat brain, Biochem. Biophys. Res. Commun., 185 (1992) 304–309. [4] Connolly, G.P., Stone, T.W. and Brown, F., Characterization of the adenosine receptors of the rat superior cervical ganglion, Br. J. Pharmacol., 110 (1993) 854–860. [5] Cook, S.P., Vulchanova, L., Hargreaves, K.M., Elde, R. and McCleskey, E.W., Distinct ATP receptors on pain-sensing and stretch sensing neurons, Nature, 387 (1997) 505– 508. [6] De Lander, G.E. and Keil, G.J., Antinociception induced by intrathecal coadministration of selective adenosine receptor and selective opioid receptor agonists in mice, J. Pharmacol. Exp. Ther., 268 (1994) 943–951. [7] Dixon, A.K., Gubitz, A.K., Sirinathsinghji, D.J.S., Richardson, P.J. and Freemann, T.C., Tissue distribution of adenosine receptor mRNAs in the rat, Br. J. Pharmacol., 118 (1996) 1461–1468. [8] Fink, J.S., Weaver, D.R., Rivkees, S.A., Peterfreund, R.A., Pollack, A.E., Adler, E.M. and Reppert, S.M., Molecular cloning of the rat adenosine receptor: selective co-expression with D2 dopamine receptors in rat striatum, Mol. Brain Res., 14 (1992) 186–195. [9] Fredholm, B.B., Abbracchio, M.P., Burnstock, M.P., Daly, J.W., Harden, T.K., Jacobson, K.A., Leff, P. and Williams, M., Nomenclature and classification of purinoceptors, Pharmacol. Rev., 46 (1994) 143–156. [10] Koos, B.J., Mason, B.A. and Ducsay, C.A., Cardiovascular responses to adenosine in fetal sheep: autonomic blockade, Am. J. Physiol., 264 (1993) 526–532. [11] Ledent, C., Vaugeois, J.M., Schiffmann, S.N., Pedrazzini, T., El Yacoubi, M., Vanderhaeghen, J.J., Costentin, J., Heath, J.K., Vassart, G. and Parmentier, M., Aggressiveness, hypoalgesia and high blood pressure in mice lacking the adenosine A2a receptor, Nature, 388 (1997) 674–678. [12] Phillis, J.W., Scislo, T.J. and O’Leary, D.S., Purines and the nucleus tractus solitarius: effects on cardiovascular and respiratory function, Clin. Exp. Pharmacol. Physiol., 24 (1997) 738– 742. [13] Sawynock, J., Sweeney, M.I. and White, T.D., Classification of
24
A. Kaelin-Lang et al. / Neuroscience Letters 246 (1998) 21–24
adenosine receptors mediating antinociception in the rat spinal cord, Br. J. Pharmacol., 88 (1986) 923–930. [14] Tucker, A.L. and Linden, J., Cloned receptors and cardiovascular responses to adenosine, Cardiovasc. Res., 27 (1993) 62–67. [15] Weaver, D.R., A2a adenosine receptor gene expression in developing rat brain, Mol. Brain Res., 20 (1993) 313–327.
[16] Young III, W.S., In situ hybridization histochemical detection of neuropeptide mRNA using DNA and RNA probes, Methods Enzymol., 168 (1989) 702–710. [17] Zhu, Y. and Ikeda, S.R., Adenosine modulates voltage-gated Ca2 + channels in adult rat sympathetic neurons, J. Neurophysiol., 70 (1993) 610–620.