- Email: [email protected]
Expression of membrane progestin receptors (mPRs) α, β and γ in the bovine uterus during the oestrous cycle and pregnancy
Theriogenology 140 (2019) 171e179
Contents lists available at ScienceDirect
Theriogenology journal homepage: www.theriojournal.com
Expression of membrane progestin receptors (mPRs) a, b and g in the bovine uterus during the oestrous cycle and pregnancy Magdalena K. Kowalik*, Karolina Dobrzyn, Robert Rekawiecki, Jan Kotwica Institute of Animal Reproduction and Food Research, Polish Academy of Sciences, Tuwima 10, 10-747, Olsztyn, Poland
a r t i c l e i n f o
a b s t r a c t
Article history: Received 7 February 2019 Received in revised form 23 August 2019 Accepted 25 August 2019 Available online 26 August 2019
Progesterone (P4) affects cell function through the nuclear progesterone receptor and membrane-bound progesterone binding proteins, including the membrane progestin receptors (mPRs) alpha (mPRa), beta (mPRb) and gamma (mPRg), which belong to the progestin and adipoQ receptor family (PAQR7, 8 and 5, respectively). The aim of this study was to determine the mRNA and protein expression levels of mPRa, mPRb and mPRg through real-time PCR and Western blot analyses, respectively, and to determine the cellular localization of these proteins in the bovine endometrium and myometrium on days 2e5, 6e10, 11e16 and 17e20 of the oestrous cycle and weeks 3e5, 6e8 and 9e12 of pregnancy (n ¼ 5/each time period). The resulting data showed the highest (P < 0.05) mPRa and mPRb mRNA expression in the endometrium on days 11e16 of the oestrous cycle compared to the other stages. In the myometrium, the level of mPRa mRNA was the lowest (P < 0.05) on days 6e16 of the oestrous cycle, while mPRb was the lowest on days 11e16. There were no changes (P > 0.05) in mPRg mRNA expression in the endometrium and myometrium during the oestrous cycle. During pregnancy, in the endometrium and myometrium, the levels of mPRa and mPRb mRNA were comparable with those observed during the oestrous cycle. However, mPRg mRNA expression was the highest (P < 0.001) during all stages of pregnancy compared with that observed during the oestrous cycle in both uterine tissues. The mPRa protein level only changed in the myometrium and was the highest (P < 0.05) during weeks 9e12 of pregnancy. However, in the endometrium, the expression of mPRb protein was higher (P < 0.05) on days 6e10 of the oestrous cycle than during weeks 6e8 of pregnancy. Strong positive immunoreactions for all mPR proteins were observed in the luminal and glandular epithelium but were less evident in the stromal cells and myocytes. In addition, all proteins were also localized in the endothelial cells of blood vessels in the uterus, suggesting that P4 may affect blood flow in this organ through mPRs. The presence of mPR receptors in the uterus indicates their participation in the regulation of uterine functions. © 2019 Elsevier Inc. All rights reserved.
Keywords: Progesterone Membrane progestin receptor PAQR Nongenomic action Uterus Cow
1. Introduction Progesterone (P4) is a steroid hormone produced in the corpus luteum (CL) as well as the placenta (depending on the species) that is involved in regulating the length of the oestrous cycle and maintaining pregnancy and embryonic development in many species, including cattle. This hormone is responsible for morphological, functional and structural changes in the endometrial tissue during the luteal phase and for suppressing myometrial contractions that prepare the uterus for pregnancy [1]. The biological effects of P4 on cell function are exerted via
* Corresponding author. E-mail address: [email protected] (M.K. Kowalik). https://doi.org/10.1016/j.theriogenology.2019.08.028 0093-691X/© 2019 Elsevier Inc. All rights reserved.
binding to the nuclear progesterone receptor (PGR), which acts as a ligand-transcription factor and regulates the expression of P4dependent genes [2]. Nuclear PGRs exist in two major isoforms, PGR-A and PGR-B, which differ in molecular weight (94 and 116 kDa, respectively) and are under the control of different promotors despite being encoded by the same gene in several species [2,3]. Both of these PGR isoforms have been detected in the bovine uterus [4e7]. However, P4 may also act on cells via membrane progesterone receptors such as (a) progesterone receptor membrane component (PGRMC) 1 and its homologue PGRMC2, which belong to the membrane-associated progesterone receptor protein family [8e10], and (b) the membrane progestin receptors (mPRs), which are members of the progestin and adiponectin Q receptor family (PAQR) [9,11,12]. Our previous studies confirmed the nongenomic action of P4 on
172
M.K. Kowalik et al. / Theriogenology 140 (2019) 171e179
the secretory function of the bovine uterus [13e15]. Moreover, we observed variable mRNA and protein expression for PGRMC1, PGRMC2 and its binding partner SERPINE1 mRNA-binding protein (SERBP1) in the bovine endometrium [7] and myometrium [6] during the oestrous cycle and the first trimester of pregnancy in cows, indicating that PGRMC receptors or the PGRMC1/SERBP1 protein complex participate in regulating uterine cell function in cows [6,7,16]. SERBP1, also known as plasminogen activator inhibitor 1 RNA-binding protein (PAIRBP1), may create a complex with PGRMC1 and mediates the responsiveness to P4 via PGRMC1 [17]. This complex participates in the antiapoptotic actions of P4 in spontaneously immortalized granulosa cells [17]. On the other hand, more recently, it was discovered that mPRs may also mediate the rapid nongenomic actions of P4 in the bovine uterus. In recent studies, mPR mRNA and protein expression was detected in the bovine CL [18] and oviduct [19], suggesting that P4 may influence the function of these tissues through interactions with these membrane receptors. The mPRs were first described in spotted seatrout ovaries [20] and subsequently described in other species, including humans [9,11,21]. Initially, three isoforms of this receptor encoded by different genes, mPRa (PAQR7), mPRb (PAQR8), and mPRg (PAQR5) [9,11], were identified. In sheep, the expression of these mPR isoforms was observed in the tissues of the reproductive system as well as in the hypothalamus and pituitary gland [22,23], and to date, these isoforms have been detected in the endometrium [12] and myometrium of women [24]. Two additional mPR isoforms (d and ε) were detected in the tissues of the nervous system in rats [25] and humans [26]. The mPRs are 7-transmembrane proteins that are coupled to stimulatory or inhibitory G proteins depending on the mPR isoform and the cell type [9, 11 27]. Thus, mPRs participate in the regulation of intracellular signalling pathways involved in different functions [27]. The activation of mPR receptors by P4 may inhibit the activity of adenylyl cyclase and the production of cyclic AMP (cAMP) [9,24] or may stimulate MAP kinases or intracellular Ca2þ mobilization [8,22,23,27], which are involved in regulating numerous cellular processes, such as cell proliferation, apoptosis and migration. It has also been suggested that these mPRactivated intracellular pathways are responsible for blood vessel relaxation, gap junction communication between cells [28,29] and the development of cancer [30,31]. The presence of mPR mRNA and/or protein has been reported in cells of the female reproductive system for several species [11,12,18,19,22e24,32e35], and the results of several studies have indicated that mPR receptors are involved in regulating the of maturation [33] and transport of oocytes [34]; in preparing the uterus for implantation [9,22,23,33], pregnancy [12], labour [24]; and in the development of the placenta [35]. However, their physiological roles in uterine function during the oestrous cycle and early pregnancy in cows is not clear. Moreover, to our knowledge, the expression and localization of mPR protein receptors in the endometrium and myometrium of cows during the oestrous cycle and the first trimester of pregnancy have not yet been investigated. Therefore, the aim of the present study was to determine mPRa, mPRb and mPRg mRNA expression, protein expression and immunolocalization in the bovine endometrium and myometrium during the oestrous cycle and the first trimester of pregnancy in cows. 2. Materials and methods 2.1. Tissue collection All experiments were performed in accordance with principles and procedures approved by The Local Animal Care and Use Ethics Committee at the University of Warmia and Mazury in Olsztyn,
Poland. Uteri (ipsilateral to the ovary with a CL) from healthy cows were obtained at a commercial slaughterhouse under veterinary supervision within 20 min of sacrificing the animals. Tissues were collected from animals on days 2e5, 6e10, 11e16, 17e20 (n ¼ 6 per stage) of the oestrous cycle and during weeks 2e5, 6e8 and 9e12 (n ¼ 5 per stage) of pregnancy. The days of the oestrous cycle were assessed by morphological observations of ovaries (follicles and CL) and the uterus as previously described [36,37], while the stages of pregnancy were estimated according to Jainudeen and Hafez [38]. Additionally, the luteal P4 concentrations in the CL of each cow were determined to confirm the correctness of the oestrous cycle and first trimester of pregnancy evaluations. The level of P4 in luteal tissue was the highest on days 6e10 (P < 0.01) and 11e16 (P < 0.05) of the oestrous cycle and during early pregnancy (P < 0.001) compared to its levels on days 2e5 and 17e20 of the oestrous cycle (data not shown). These results supported our morphological assessment of the stages of the oestrous cycle and were consistent with earlier data [39,40]. Immediately following the collection of uteri, the endometrium and myometrium were separated from each other and snap frozen in liquid nitrogen, transported to the laboratory and stored at 80 C until further use. Deep-frozen tissues were homogenized using a vibratory mill (Retsch MM-2), and the resulting tissue powder was divided into individual portions for the determination of P4 levels and the isolation of RNA and protein. Moreover, uterine samples from the same animals were also fixed in 4% paraformaldehyde in 0.1 M PBS (pH 7.4) for 24 h, washed with distilled water, dehydrated in an ethanol gradient and subsequently embedded in paraffin for immunohistochemistry analysis. All materials used in these studies were obtained from SigmaAldrich Co. (St. Louis, MO, USA) unless otherwise stated. 2.2. Progesterone determination Progesterone was extracted from endometrial and myometrial tissues with petroleum ether, and levels were determined by enzyme immunoassay (EIA) [41] using horseradish peroxidaselabelled P4 as a tracer and the previously characterized P4 antiserum [42]. The final dilution of progesterone labelled with horseradish peroxidase and P4 antiserum (IFP4) was 1:60 000. The recovery of P4 averaged 85%. The range of the standard curve was 0.1e25 ng/ml, and the sensitivity of the procedure was 0.15 ng/ml. The intra- and inter-assay coefficients of variation were 8.7 and 11%, respectively. 2.3. RNA isolation and reverse transcription Total RNA was extracted from all homogenized samples using a Total RNA Prep Plus kit (A&A Biotechnology, Gdansk, Poland) according to the manufacturer's instructions. The quantity and purity of isolated RNA were determined with a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA), and RNA quality was assessed using an Agilent 2100 Bioanalyzer (Agilent Technologies, CA, USA). The RNA integrity number ranged from 8 to 10. One microgram of RNA was treated with DNase and reverse transcribed (RT) into cDNA in a 20-ml reaction that contained 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 5 mM dithiothreitol, 10 mM dNTP mix, 1 mg oligo (dT) 23 primers (Fermentas, Vilnius, Lithuania), and 200 IU of M-MLV reverse transcriptase (Promega, Madison, WI, USA). RNA was denatured at 70 C for 10 min, and then the RT reaction was conducted at 42 C for 60 min. The process was terminated by incubation at 70 C for 10 min. Reverse transcriptase products were diluted in nuclease-free water (Promega) to a final concentration of 200 ng/ml and stored at 20 C
M.K. Kowalik et al. / Theriogenology 140 (2019) 171e179
until real-time polymerase chain reaction (PCR) analysis. 2.4. Real-time PCR quantification Specific primer pairs used to amplify regions of mPRa, mPRb, mPRg and GAPDH (glyceraldehyde-3-phosphate dehydrogenase; reference gene) genes were the same as described by Kowalik et al. [19]. Primers were synthesized by Sigma (Warsaw, Poland), and their sequences, GenBank accession numbers and expected PCR product sizes are shown in Table 1. Real-time PCR was performed in duplicate for all samples using an ABI Prism 7300 sequence detection system with Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) as previously described [18,19]. Each PCR sample (25 ml volume) contained 5 ml of cDNA (200 ng), forward and reverse primers (200 pM each) and 12.5 ml of Power SYBR Green PCR Master Mix. The following PCR conditions were used: an initial denaturation (10 min at 95 C) followed by 40 cycles of denaturation (15 s at 95 C), annealing and extension (60 s at 60 C). After these steps, melting curves were obtained by stepwise temperature increases from 60 to 95 C to ensure single-product amplification. To exclude the possibility of genomic DNA contamination in the RNA samples or cross contamination between samples, the reactions were also run either on blank-only buffer samples or in the absence of reverse transcriptase. Furthermore, the specificity of the RT-PCR product was confirmed by gel electrophoresis and sequencing. Relative mRNA quantification data were analysed using the real-time PCR Miner algorithm [43]. The real-time PCR data obtained for the mPRa, mPRb, and mPRg mRNA contents were normalized to that of GAPDH. 2.5. Western blot analysis Protein extraction and Western blot analysis was performed as previously described [18,40]. Radioimmunoprecipitation assay (RIPA) buffer (25 mM Tris-HCl, 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 5 mM EDTA, and 0.1% SDS, pH 7.6) supplemented with protease inhibitor cocktail was used for protein sample preparation. Endometrial and myometrial tissues were homogenized on ice using an ultrasound homogenizer (Sonics & Materials Inc., Newton, CT, USA) and then centrifuged for 10 min at 1000 g at 4 C. The resultant supernatant, which contained the cytosol and membrane fractions, was collected, aliquoted, and stored at 80 C for Western blot analysis. The protein concentration was determined using the Bradford method [44]. Equal amounts of endometrial and myometrial proteins (50 mg) were dissolved in SDS gel-loading buffer (50 mM Tris-HCl, 4% SDS, 20% glycerol, and 2% b-mercaptoethanol, pH 6.8), heated at 95 C for 8 min and separated on 9% SDS-polyacrylamide gel electrophoresis. Separated proteins were transferred to a 0.2-mm Immobilon PVDF membranes (Millipore, Billerica, MA, USA) in transfer buffer (20 mM Tris-HCl, 150 mM glycine, and 20% methanol, pH 8.2). Thereafter, the membranes were blocked with 5% nonfat dry
173
milk in TBS buffer (50 mM Tris-HCl; 0.9% NaCl) containing 0.05% Tween-20 (TBS-T) for 1.5 h at room temperature. The membranes were then incubated overnight at 4 C with the following primary antibodies diluted in TBS-T: a polyclonal rabbit anti-mPRa antibody (1:100; cat. no HPA046936, Sigma) that recognizes the mPRa protein (molecular mass of approximately 40 kDa); a polyclonal goat anti-mPRb (1:100; cat. no sc-50109, Santa Cruz Biotechnology, Dallas, TX, USA) that recognizes the mPRb protein (molecular mass of approximately 41 kDa); a rabbit polyclonal anti-mPRg antibody (1:100, cat. HPA016507, Sigma) that recognizes the mPRg protein (molecular mass approximately 38 kDa); and a monoclonal mouse anti-GAPDH antibody (concentration 0.1 mg/ml; cat. no G-8795; Sigma) as a reference protein. To test the specificity of the antibodies for mPRa, mPRb and mPRg, we used the human myometrial tissue lysate as a positive control. Next, the membranes were washed three times for 10 min each in TBS-T buffer and subsequently treated with horseradish peroxidase-conjugated anti-rabbit IgG (dilution 1:50 000, Sigma), anti-goat IgG (dilution 1:50 000, Abcam) and anti-mouse IgG (dilution 1:50 000, Abcam) for 1.5 h at room temperature. Immunoreactive bands were detected using a stock solution of 4-nitroblue tetrazolium chloride (NBT) and 5bromo-4-chloro-3-indolyl phosphate (BCIP) with alkaline phosphatase assay buffer (0.1 M NaCl, 5 mM MgCl2, and 100 mM TrisHCl, pH 9.5). Band intensities were measured using Quantity One 1D analysis software (Bio-Rad, Berkeley, USA). The Western blot data obtained for mPRa, mPRb and mPRg were normalized to the GAPDH protein content.
2.6. Immunohistochemistry Immunohistochemistry was performed as described previously [18,19,40]. Serial tissue sections (6 mm) of uteri from all examined phases of the oestrous cycle and the first trimester of pregnancy were mounted on silane-coated slides (Superfrost plus, Menzel€ser, Braunschweig, Germany). To remove the paraffin, the secGla tions were heated at 56e60 C for 20 min and soaked in xylene (2 10 min). Subsequently, the sections were rehydrated in a series of ethanol dilutions (100, 96, and 70%, H2O) for 5 min per step. Next, the sections were subjected to pressure cooking in 0.01 M sodium citrate with 0.05% Tween 20 (pH 6.0) for antigen retrieval. The sections were cooled for 30 min at room temperature, washed three times in TBS for 5 min and then incubated with 10% hydrogen peroxide in H2O for 30 min to block endogenous peroxidase activity. Subsequently, the sections were washed three times in TBS for 5 min each and then incubated with 10% Normal Goat Serum (NGS; for mPRa) or Normal Rabbit serum (NRS; for mPRb and mPRg) in PAV buffer (containing 0.1 M PBS, 0.1% BSA and 0.05% thimerosal) to block nonspecific protein binding for 1 h at room temperature. Next, the sections were incubated overnight at 4 C with primary antibodies at the following dilutions: 1:80 for rabbit polyclonal anti-mPRa (Sigma); 1:20 for goat polyclonal anti-mPRb (Santa Cruz Biotechnology, Dallas, TX, USA); and 1:20 for goat
Table 1 Forward and reverse primer sequences, amplicon length in base pairs and GenBank accession numbers for real-time PCRs. Gene name
Primers sequence (forward/reverse)
GenBank Accession Number
Amplicon length
mPRa
Forward: CCGGCGGTCCATCTATGA Reverse: CCACCCCCTTCACTGAGTCTT Forward: TGCCCCTGCTCGTCTATGTC Reverse: CCCACGTAGTCCACGAAGTAGAA Forward: GGTTCTTCTCGTGGAGGTTTGT Reverse: GTTCCTGGACATGGAGCTGAA Forward: CCTGCCCGTTCGACAGATA Reverse: GGCGACGATGTCCACTTTG
NM_001038553
159
NM_001101135
120
XM_005193580
151
NM_001034034
150
mPRb mPRg GAPDH
174
M.K. Kowalik et al. / Theriogenology 140 (2019) 171e179
polyclonal anti-mPRg (Santa Cruz Biotechnology). The primary antibodies were omitted from the negative control during the immunostaining procedure. For the negative control sections, the primary antibodies were replaced with NGS or NRS (diluted 1:10). On the following day, the sections were washed four times in TBS for 5 min, incubated with biotinylated goat anti-rabbit IgG antibody (for mPRa, Vector Laboratories Inc., Burlingame, CA, USA) or a biotinylated rabbit anti-goat IgG antibody (for mPRb and mPRg, Vector Laboratories) diluted 1:400 in PAV buffer (with 10% NRS or NGS) for 30 min at 4 C. Specific binding was visualized with the ABC complex (Vector Laboratories) according to the manufacturer's instructions. Thereafter, the sections were washed 3 times in TBS and visualized with 3,30 -diaminobenzidine (DAB; DakoCytomation). Next, the sections were rinsed, counterstained with Mayer's haematoxylin, dehydrated and covered with mounting medium (DPX, POCh, Poland) before subsequent examination using a Zeiss Axio Imager Z1 microscope (Zeiss, Germany). 2.7. Statistical analysis Statistical analyses were conducted using one-way ANOVA followed by Tukey's post-test (GraphPad PRISM 6.0; Graph Pad Software, San Diego, CA, USA) after testing for normality. All data were expressed as the means (±SEM), and differences were considered significant at P < 0.05. Pearson's coefficient of correlation between was also calculated for the observed mRNA expression and P4 concentration in the endometrium and myometrium samples (GraphPad PRISM 7.0).
mPRa, mPRb and mPRg in bovine endometrial (Fig. 2AeC) and myometrial (Fig. 2DeF) tissues. The expression of mPRa mRNA during the oestrous cycle was the highest (P < 0.01) on days 11e16 in the endometrium (Fig. 2A) and on days 2e5 and 17e20 in the myometrium (P < 0.05; Fig. 2D). The level of mPRa mRNA in the endometrium during pregnancy was comparable with that observed during the oestrous cycle (Fig. 2A) but was higher (P < 0.05; Fig. 2D) in the myometrium during weeks 3e5 and 9e12 of pregnancy than on days 6e20 of the oestrous cycle. The expression of mPRb mRNA in the endometrium was the highest (P < 0.05) during days 11e16 of the oestrous cycle and all studied weeks of pregnancy (Fig. 2B). The expression of mPRb mRNA in the myometrium was the lowest (P < 0.05) on days 11e16 of the oestrous cycle and in weeks 6e8 of pregnancy, although higher levels of mPRb mRNA were observed during 3e5 and 9e12 weeks of pregnancy (Fig. 2E) than at the other assayed stages of the oestrous cycle and pregnancy (P < 0.05; Fig. 2E). No significant differences (P > 0.05) in mPRg mRNA expression were observed during the oestrous cycle in both the endometrium (Fig. 2C) and myometrium (Fig. 2F) tissues, although this gene was expressed at higher levels (P < 0.01) in pregnant animals than in cyclic animals (Fig. 2C, F). 3.3. Protein expression of mPRa, mPRb, and mPRg in the uterus
The P4 levels in both the endometrial and myometrial tissues were the highest on days 2e5 (P < 0.05) of the oestrous cycle (Fig. 1). From days 6e10 of the oestrous cycle, the P4 levels in both tissues decreased (P < 0.05) and were maintained at a similar level during days 11e20 of the oestrous cycle and the first trimester of pregnancy (Fig. 1). We did not find a correlation between the mRNA expression for each mPR receptor and the P4 concentration in the endometrium or myometrium samples, respectively.
The Western blot analysis results revealed the presence of mPR proteins in both the endometrium and myometrium tissues during all stages of the oestrous cycle and the first trimester of pregnancy (Fig. 3). The antibodies used in this study recognized major bands with predicted molecular masses of approximately 40 kDa for mPRa, mPRb, and mPRg in the examined bovine uterus tissues. The analysis performed on the endometrium samples did not reveal any significant differences in mPRa and mPRg expression at the protein level (Fig. 3A, C). Expression of mPRb was increased (P < 0.05) on days 6e10 compared to the expression in weeks 6e8 of pregnancy (Fig. 3B). In the myometrium, only the expression of mPRa protein was higher (P < 0.05) in weeks 9e12 of pregnancy than in all stages of the oestrous cycle (Fig. 3D). No significant differences (P > 0.05) were observed in the mPRb and mPRg protein expression profiles in bovine myometrium throughout the oestrous cycle and pregnancy (Fig. 3E and F).
3.2. mRNA expression of mPRa, mPRb and mPRg
3.4. Protein localization of mPRa, mPRb, and mPRg in the uterus
3. Results 3.1. P4 concentration
Quantitative real-time PCR analysis confirmed the expression of
Fig. 1. Progesterone (P4) concentrations (mean ± SEM) in bovine endometrium and myometrium samples collected during the oestrous cycle (days 2e5, 6e10, 11e16, and 17e20; n ¼ 6 uteri per stage) and first trimester of pregnancy (weeks 3e5, 6e8, and 9e12; n ¼ 5 uteri per stage). Values with different superscripts are different as determined by at least P < 0.05. Capital letters: endometrium; small letters: myometrium.
Positive mPR immunostaining was observed in all uterine compartments during days 2e5, 6e10, 11e16 and 17e20 of the oestrous cycle and the first trimester of pregnancy. The mPRa (Fig. 4AeC), mPRb (Fig. 4DeF) and mPRg (Fig. 4GeI) proteins were localized in the luminal and glandular epithelium as well as in stromal cells within the endometrium. In epithelial cells, immunostaining was very intense, whereas stroma cells showed weaker mPR immunoreactivity (Fig. 4). In the myometrium, mPR receptors were detected in myometrial cells within longitudinal and circular layers at all examined stages of the oestrous cycle (Fig. 4). Moreover, the mPRa, mPRb and mPRg proteins were detected in the endothelium of blood vessels in bovine endometrium and myometrium on all days of the oestrous cycle (Fig. 4). No staining was detected in the endometrium and myometrium when 0.01 M PBS or the rabbit universal negative control was used instead of primary antibodies. 4. Discussion The obtained data demonstrated the cellular localization and expression of mPRa, mPRb and mPRg mRNA and protein within the
M.K. Kowalik et al. / Theriogenology 140 (2019) 171e179
175
Fig. 2. Mean (±SEM) expression of mPRa (A,D), mPRb (B, E), and mPRg (C,F) mRNA determined by real-time PCR in bovine endometrium (A, B, C) and myometrium samples (D, E, F) during the oestrous cycle (days 2e5, 6e10, 11e16, and 17e20; n ¼ 6 uteri per stage) and first trimester of pregnancy (weeks 3e5, 6e8, and 9e12; n ¼ 5 uteri per stage). Values with different superscripts are significantly different as determined by at least P < 0.05. mPRa, membrane progestin receptor alpha; mPRb, membrane progestin receptor beta; mPRg, membrane progestin receptor gamma.
bovine endometrium and myometrium during the oestrous cycle and the first trimester of pregnancy. The mRNA and protein expression of mPRa, mPRb and mPRg were observed to depend on the stage of the oestrous cycle and/or pregnancy and on the type of uterine tissues. The localization of mPRs was observed in all compartments of the uterus during all stages of the oestrous cycle and early pregnancy. Immunostaining was particularly noticeable in the luminal and glandular epithelium, whereas this reaction was less evident in the stromal cells and in myocytes. Moreover, all mPRs were also localized in the endothelial cells of blood vessels in the uterus. Therefore, the obtained results confirm that mPRs may be involved in P4 activity in the bovine uterus independent of nuclear P4 and PGRMC receptors. It should be noted that the gene expression results obtained in this study did not coincide with the protein level profiles. This discrepancy may have been caused by various post-transcriptional or post-translational regulatory mechanisms [45] such as: gene silencing by siRNA and miRNA [46]; a negative feedback loop between mRNA synthesis and protein production [47]; or the time interval between mRNA formation and protein synthesis [45]. In detail, the highest mPRa and mPRb mRNA expression was
observed in the bovine endometrium on days 11e16 of the oestrous cycle and corresponded with the P4 concentration in CL tissues [40] during the mid-luteal phase of the oestrous cycle and the first trimester of pregnancy. It is possible that the P4 secreted from the CL may regulate mPR expression in the bovine endometrium and affect the function of endometrial tissue. It should be noted that in the bovine endometrium, the highest PGR mRNA and PGRA and PGRB protein expression was observed on days 1e5 and 17e20 of the oestrous cycle [7]. Moreover, the P4 concentration in the endometrium was the highest during days 2e5 of the oestrous cycle and then decreased to a low level on days 11e20, suggesting that P4 may act on endometrial function through the mPRa and mPRb receptors on these days. Our previous study showed that the expression of PGRMC1 and PGRMC2 mRNA in endometrial tissues remained relatively constant during the oestrous cycle [7]. Therefore, these results indicate that mPR receptors may intermediate in P4 action on endometrial function during the oestrous cycle. In the myometrium, we observed the lowest levels of mPRa and mPRb mRNA on days 6e16 and 11e16 of the oestrous cycle, respectively. It should be noted that the expression of PGR mRNA in the bovine myometrium is also downregulated on days 11e16 of
176
M.K. Kowalik et al. / Theriogenology 140 (2019) 171e179
Fig. 3. Mean (±SEM) protein expression of mPRa (A, D), mPRb (B, E), and mPRg (C, F) in bovine endometrium (A, B, C) and myometrium samples (D, E, F) during the oestrous cycle (days 2e5, 6e10, 11e16, and 17e20; n ¼ 6 uteri per stage) and first trimester of pregnancy (weeks 3e5, 6e8, and 9e12; n ¼ 5 uteri per stage). Upper panel: representative immunoblots; lower panel: densitometric analyses of mPRa, mPRb, and mPRg protein relative to GAPDH protein. Values with different superscripts are significantly different as determined by at least P < 0.05.
M.K. Kowalik et al. / Theriogenology 140 (2019) 171e179
177
Fig. 4. Representative photomicrographs of immunohistochemical localization of mPRa (AeC), mPRb (DeF) and mPRg (GeI) protein at 11e16 days of the oestrous cycle in the bovine uterus. Positive immunoreactions for all mPRs receptors were observed in the luminal epithelial cells (LE), glandular epithelial cells (GE) and stromal cells (S) of endometrium samples as well as in myometrial cells (M) and epithelial cells of blood vessels (black arrows). Upper corners: negative control. Bar ¼ 50 mm.
the oestrous cycle [6]. Furthermore, myometrial levels of PGRA and PGRB protein and the concentration of P4 decreased after day 6 of the oestrous cycle [6]. Consequently, it may be assumed that P4 directly acts on the myometrial tissues by binding to the mPR protein, as previously suggested [9,11], but the intensity of this process may depend on the stage of the oestrous cycle. During pregnancy, the levels of mPRa and mPRb mRNA in the endometrium remained stable and similar to those observed on days 11e16 of the oestrous cycle. However, in the myometrium, we observed decreased expression of mPRa and mPRb mRNA at weeks 6e8 of pregnancy compared to that at other stages of gestation. Moreover, in both uterine tissues, the expression of mPRg mRNA increased during the first trimester of pregnancy compared to that in the oestrous cycle. These results suggest that each mPR receptor may have a different role in regulating the uterus during pregnancy. The variable expression of mPRa and mPRb receptors in the bovine endometrium and myometrium during the oestrous cycle and gestation suggests an association between mPR expression in the bovine uterus and the stage of the oestrous cycle or pregnancy that may be a result of changes in ovarian steroid concentrations. This suggestion was confirmed by data obtained in human endometrium [12] and myometrium samples [24], where mPRa and mPRb expression were shown to be induced by P4 and oestradiol, respectively. However, the effect of steroids on the expression of the membrane P4 receptor seems to depend on the receptor isoforms and type of tissues [21,24,25,30], thus these data require further detailed studies. In this study, mPR proteins were observed to be highly expressed in luminal and glandular epithelial cells, whereas weaker staining was observed in the stroma and myometrial cells. The presence of mPRs, particularly in the uterine luminal and glandular epithelial cells, indicates the possible participation of these receptors in secretion (e.g., prostaglandins) and proliferation processes in endometrial tissues. Thus, these receptors can participate in the preparation of a suitable environment for embryo
implantation and embryo and foetus development. Moreover, we also demonstrated the expression of mPRa, mPRb and mPRg protein in the endothelial cells of blood vessels in endometrial tissue, similar to that observed for the oviduct [19] and CL [18] in cows. Expression of these receptors in myometrial tissue was less evident. It should be noted that the expression of PGRMC1 and PGRMC2 receptors was also observed in the endothelial cells of blood vessels in the bovine uterus, CL and oviduct [7,19,40]. Thus, it can be assumed that P4, through its membrane receptors in endothelial cells, may rapidly affect blood flow in the vessels of the reproductive tract in a transcription-independent manner. Similarly, it was previously suggested that PGR receptors are involved regulating vascular permeability, which may be important for successful implantation [48] and in the modulation of uterine blood flow [49]. However, it is difficult to clearly define which of the mechanisms of P4 action (genomic or nongenomic) is dominant and whether the dominant mechanism changes under different physiological states. It is possible that these alternative signalling pathways function in parallel. However, it is also possible that each of these pathways has a different role in cell homeostasis. Therefore, the collection of additional data to elucidate the role of membrane P4 receptors and their participation in activities within the endometrium and myometrium is crucial.
5. Conclusions In summary, our results indicate that mPRa, mPRb and mPRg are expressed in the bovine uterus at the gene and protein levels in both endometrium and myometrium tissues and that their level is dependent on the hormonal status of the animals. The presence of membrane progestin receptors in the uterus suggests their involvement in the regulation of uterine functions. However, additional studies are needed to determine the physiological role of these receptors in the bovine uterus.
178
M.K. Kowalik et al. / Theriogenology 140 (2019) 171e179
Acknowledgements We thank Professor S. Okrasa (University of Warmia and Mazury, Olsztyn, Poland) for providing the progesterone antiserum. This study was supported by the National Science Centre, Poland (project OPUS no. 2012/05/B/NZ4/01810 and no. 2017/27/B/NZ4/ 02973). References [1] Niswender GD, Juengel JL, Silvia PJ, Rollyson MK, McIntush EW. Mechanism controlling the function and life span of the corpus luteum. Physiol Rev 2000;80:1e29. [2] Mulac-Jericevic B, Conneely OM. Reproductive tissue selective actions of progesterone receptors. Reproduction 2004;128:139e46. [3] Kastner P, Krust A, Turcotte B, Strupp U, Tora L, Gronemeyer H, Chambon P. Two distinct estrogen-regulated promoters generate transcripts encoding the two functionally different human progesterone receptor forms A and B. EMBO J 1990;9:1603e14. [4] Kimmins S, MacLaren LA. Oestrous cycle and pregnancy effects on the distribution of oestrogen and progesterone receptors in bovine endometrium. Placenta 2001;22:742e8. [5] Robinson RS1, Mann GE, Lamming GE, Wathes DC. Expression of oxytocin, oestrogen and progesterone receptors in uterine biopsy samples throughout the oestrous cycle and early pregnancy in cows. Reproduction 2001;122: 965e79. [6] Slonina D, Kowalik MK, Kotwica J. Expression of progesterone receptor membrane component 1, serpine mRNA binding protein 1 and nuclear progesterone receptor A and B in the bovine myometrium during the estrous cycle and early pregnancy. J Reprod Dev 2012;58:288e94. [7] Kowalik MK, Slonina D, Rekawiecki R, Kotwica J. Expression of progesterone receptor membrane component (PGRMC) 1 and 2, serpine binding protein 1 (SERBP1) and nuclear progesterone receptor (PGR) in the bovine endometrium during the estrous cycle and the first trimester of pregnancy. Reprod Biol 2013;13:15e23. [8] Peluso JJ. Multiplicity of progesterone's actions and receptors in the mammalian ovary. Biol Reprod 2006;75:2e8. [9] Gellersen B, Fernandes MS, Brosens JJ. Non-genomic progesterone actions in female reproduction. Hum Reprod Update 2009;15:119e38. [10] Cahill MA. Progesterone receptor membrane component 1: an integrative review. J Steroid Biochem Mol Biol 2007;105:16e36. [11] Zhu Y, Bond J, Thomas P. Identification, classification, and partial characterization of genes in humans and other vertebrates homologous to a fish membrane progestin receptor. Proc Natl Acad Sci USA 2003;100:2237e42. [12] Fernandes MS, Pierron V, Michalovich D, Astle S, Thornton S, Peltoketo H, Lam EW, Gellersen B, Huhtaniemi I, Allen J, Brosens JJ. Regulated expression of putative membrane progestin receptor homologues in human endometrium and gestational tissues. J Endocrinol 2005;187:89e101. [13] Bogacki M, Silvia WJ, Rekawiecki R, Kotwica J. Direct inhibitory effect of progesterone on oxytocin-induced secretion of prostaglandin F2a from bovine endometrial tissue. Biol Reprod 2002;67:184e8. [14] Duras M, Mlynarczuk J, Kotwica J. Non-genomic effect of steroids on oxytocinstimulated intracellular mobilization of calcium and on prostaglandin F2 and E2 secretion from bovine endometrial cells. Prostaglandins Other Lipid Mediat 2005;76:105e16. [15] Kowalik MK, Slonina D, Kotwica J. Genomic and non-genomic effect of progesterone (P4) and pregnenolone (P5) on the function of bovine endometrial cells. Vet Med 2009;54:205e14. [16] Kowalik MK, Rekawiecki R, Kotwica J. The putative roles of nuclear and membrane-bound progesterone receptors in the female reproductive tract. Reprod Biol 2013;13:279e89. [17] Peluso JJ, Yuan A, Liu X, Lodde V. Plasminogen activator inhibitor 1 RNAbinding protein interacts with progesterone receptor membrane component 1 to regulate progesterone's ability to maintain the viability of spontaneously immortalized granulosa cells and rat granulosa cells. Biol Reprod 2013;88: 1e10. [18] Kowalik MK, Rekawiecki R, Kotwica J. Expression of membrane progestin receptors (mPRs) in the bovine corpus luteum during the estrous cycle and first trimester of pregnancy. Domest Anim Endocrinol 2018;63:69e79. [19] Kowalik MK, Martyniak M, Rekawiecki R, Kotwica J. Expression and immunolocalization of membrane progesterone receptors in the bovine oviduct. Domest Anim Endocrinol 2016;55:83e96. [20] Zhu Y, Rice CD, Pang Y, Pace M, Thomas P. Cloning, expression, and characterization of a membrane progestin receptor and evidence it is an intermediary in meiotic maturation of fish oocytes. Proc Natl Acad Sci USA 2003;100: 2231e6. n-Castela na L, Gonz [21] Valadez-Cosmesa P, Germa alez-Arenasb A, VelascoVel azquezc MA, Hansberg-Pastord V, Camacho-Arroyoa I. Expression and hormonal regulation of membrane progesterone receptors in human astrocytoma cells. J Steroid Biochem Mol Biol 2015;154:176e85.
[22] Ashley RL, Clay CM, Farmerie TA, Niswender GD, Nett TM. Cloning and characterization of an ovine intracellular seven transmembrane receptor for progesterone that mediates calcium mobilization. Endocrinology 2006;147: 4151e9. [23] Ashley RL, Arreguin-Arevalo JA, Nett TM. Binding characteristics of the ovine membrane progesterone receptor alpha and expression of the receptor during the estrous cycle. Reprod Biol Endocrinol 2009;7:42. [24] Karteris E, Zervou S, Pang Y, Dong J, Hillhouse EW, Randeva HS, Thomas P. Progesterone signaling in human myometrium through two novel membrane G protein-coupled receptors: potential role in functional progesterone withdrawal at term. Mol Endocrinol 2006;20:1519e34. [25] Intlekofer KA, Petersen SL. 17b-estradiol and progesterone regulate multiple progestin signalling molecules in the anteroventral periventricular nucleus, ventromedial nucleus and sexually dimorphic nucleus of the preoptic area in female rats. Neuroscience 2011;176:86e92. [26] Pang Y, Dong J, Thomas P. Characterization, neurosteroid binding and brain distribution of human membrane progesterone receptors delta and {epsilon} (mPRdelta and mPR{epsilon}) and mPRdelta involvement in neurosteroid inhibition of apoptosis. Endocrinology 2013;154:283e95. [27] Thomas P, Pang Y, Dong J, Groenen P, Kelder J, de Vlieg J, Zhu Y, Tubbs C. Steroid and G protein binding characteristics of the seatrout and human progestin membrane receptor alpha subtypes and their evolutionary origins. Endocrinology 2007;148:705e18. [28] Bishop CV, Stormshak F. Non-genomic actions of progesterone and estrogens in regulating reproductive events in domestic animals. Vet J 2008;176: 270e80. [29] Thomas P, Pang Y. Protective actions of progesterone in the cardiovascular system: potential role of membrane progesterone receptors (mPRs) in mediating rapid effects. Steroids 2013;78:583e8. [30] Dressing GE, Goldberg JE, Charles NJ, Schwertfeger KL, Lange CA. Membrane progesterone receptor expression in mammalian tissues: a review of regulation and physiological implications. Steroids 2011;76:11e7. [31] Vares G, Sai S, Wang B, Fujimori A, Nenoi M, Nakajima T. Progesterone generates cancer stem cells through membrane progesterone receptor-triggered signaling in basal-like human mammary cells. Cancer Lett 2015;362(2): 167e73. [32] Cai Z, Stocco C. Expression and regulation of progestin membrane receptors in the rat corpus luteum. Endocrinology 2005;146:5522e32. [33] Qiu HB, Lu SS, Ji KL, Song XM, Lu YQ, Zhang M, Lu KH. Membrane progestin receptor beta (mPR-b): a protein related to cumulus expansion that is involved in in vitro maturation of pig cumuluseoocyte complexes. Steroids 2008;73:1416e23. [34] Nutu M, Weijdegard B, Thomas P, Thurin-Kjellberg A, Billig H, Larsson DGJ. Distribution and hormonal regulation of membrane progesterone receptors b and g in ciliated epithelial cells of mouse and human fallopian tubes. Reprod Biol Endocrinol 2009;7:89. [35] Reynolds LP, Haring JS, Johnson ML, Ashley RL, Redmer DA, Borowicz PP, Grazul-Bilska AT. Placental development during early pregnancy in sheep: estrogen and progesterone receptor messenger RNA expression in pregnancies derived from in vivo-produced and in vitro-produced embryos. Domest Anim Endocrinol 2015;53:60e9. [36] Ireland JJ, Murphee RL, Coulson PB. Accuracy of predicting stages of bovine estrous cycle by gross appearance of the corpus luteum. J Dairy Sci 1980;63: 155e60. [37] Fields MJ, Fields PA. Morphological characteristics of the bovine corpus luteum during the estrous cycle and pregnancy. Theriogenology 1996;45: 1295e325. [38] Jainudeen MR, Hafez ESE. Gestation, prenatal physiology and parturition. In: Hafez ESE, editor. Reproduction in farm animals. Philadelphia: Lea & Febiger; 1980. p. 247e83. [39] Miszkiel G, Skarzynski D, Bogacki M, Kotwica J. Concentrations of catecholamines, ascorbic acid, progesterone and oxytocin in the corpora lutea of cyclic and pregnant cattle. Reprod Nutr Dev 1999;39:509e16. [40] Kowalik MK, Rekawiecki R, Kotwica J. Expression and localization of progesterone receptor membrane component 1 and 2 and serpine mRNA binding protein 1 in the bovine corpus luteum during the estrous cycle and the first trimester of pregnancy. Theriogenology 2014;82:1086e93. [41] Prakash BS, Meyer HD, Schallenberger E, Van de Weil DF. Development of sensitive enzymeimmunoassay (EIA) for progesterone determination in unextracted bovine plasma using the second antibody technique. J Steroid Biochem 1987;28:623e7. [42] Kotwica J, Skarzynski DJ, Jaroszewski JJ, Bogacki M. Noradrenaline affects secretory function of corpus luteum independently on prostaglandins in conscious cattle. Prostaglandins 1994;48:1e9. [43] Zhao S, Fernald RD. Comprehensive algorithm for quantitative real-time polymerase chain reaction. J Comput Biol 2005;12:1047e64. [44] Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of proteinedye binding. Anal Biochem 1976;72:248e54. [45] Greenbaum D, Colangelo C, Williams K, Gerstein M. Comparing protein abundance and mRNA expression levels on a genomic scale. Genome Biol 2003;4:117. [46] Scherr M, Eder M. Gene silencing by small regulatory RNAs in mammalian
M.K. Kowalik et al. / Theriogenology 140 (2019) 171e179 cells. Cell Cycle 2007;6:444e9. [47] Stormshak F, Orwig KE, Bertrand JE. Dynamics of molecular mechanisms underlying ovarian oxytocin secretion. J Reprod Fertil 1995;49:379e90. [48] Goddard LM, Murphy TJ, Org T, Enciso JM, Hashimoto-Partyka MK, Warren CM, et al. Progesterone receptor in the vascular endothelium triggers
179
physiological uterine permeability pre-implantation. Cell 2014;156:549e62. [49] Perrot-Applanat M, Deng M, Fernandez H, Lelaidier C, Meduri G, Bouchard P. Immunohistochemical localization of estradiol and progesterone receptors in human uterus throughout pregnancy: expression in endometrial blood vessels. J Clin Endocrinol Metab 1994;78:216e24.
Contents lists available at ScienceDirect
Theriogenology journal homepage: www.theriojournal.com
Expression of membrane progestin receptors (mPRs) a, b and g in the bovine uterus during the oestrous cycle and pregnancy Magdalena K. Kowalik*, Karolina Dobrzyn, Robert Rekawiecki, Jan Kotwica Institute of Animal Reproduction and Food Research, Polish Academy of Sciences, Tuwima 10, 10-747, Olsztyn, Poland
a r t i c l e i n f o
a b s t r a c t
Article history: Received 7 February 2019 Received in revised form 23 August 2019 Accepted 25 August 2019 Available online 26 August 2019
Progesterone (P4) affects cell function through the nuclear progesterone receptor and membrane-bound progesterone binding proteins, including the membrane progestin receptors (mPRs) alpha (mPRa), beta (mPRb) and gamma (mPRg), which belong to the progestin and adipoQ receptor family (PAQR7, 8 and 5, respectively). The aim of this study was to determine the mRNA and protein expression levels of mPRa, mPRb and mPRg through real-time PCR and Western blot analyses, respectively, and to determine the cellular localization of these proteins in the bovine endometrium and myometrium on days 2e5, 6e10, 11e16 and 17e20 of the oestrous cycle and weeks 3e5, 6e8 and 9e12 of pregnancy (n ¼ 5/each time period). The resulting data showed the highest (P < 0.05) mPRa and mPRb mRNA expression in the endometrium on days 11e16 of the oestrous cycle compared to the other stages. In the myometrium, the level of mPRa mRNA was the lowest (P < 0.05) on days 6e16 of the oestrous cycle, while mPRb was the lowest on days 11e16. There were no changes (P > 0.05) in mPRg mRNA expression in the endometrium and myometrium during the oestrous cycle. During pregnancy, in the endometrium and myometrium, the levels of mPRa and mPRb mRNA were comparable with those observed during the oestrous cycle. However, mPRg mRNA expression was the highest (P < 0.001) during all stages of pregnancy compared with that observed during the oestrous cycle in both uterine tissues. The mPRa protein level only changed in the myometrium and was the highest (P < 0.05) during weeks 9e12 of pregnancy. However, in the endometrium, the expression of mPRb protein was higher (P < 0.05) on days 6e10 of the oestrous cycle than during weeks 6e8 of pregnancy. Strong positive immunoreactions for all mPR proteins were observed in the luminal and glandular epithelium but were less evident in the stromal cells and myocytes. In addition, all proteins were also localized in the endothelial cells of blood vessels in the uterus, suggesting that P4 may affect blood flow in this organ through mPRs. The presence of mPR receptors in the uterus indicates their participation in the regulation of uterine functions. © 2019 Elsevier Inc. All rights reserved.
Keywords: Progesterone Membrane progestin receptor PAQR Nongenomic action Uterus Cow
1. Introduction Progesterone (P4) is a steroid hormone produced in the corpus luteum (CL) as well as the placenta (depending on the species) that is involved in regulating the length of the oestrous cycle and maintaining pregnancy and embryonic development in many species, including cattle. This hormone is responsible for morphological, functional and structural changes in the endometrial tissue during the luteal phase and for suppressing myometrial contractions that prepare the uterus for pregnancy [1]. The biological effects of P4 on cell function are exerted via
* Corresponding author. E-mail address: [email protected] (M.K. Kowalik). https://doi.org/10.1016/j.theriogenology.2019.08.028 0093-691X/© 2019 Elsevier Inc. All rights reserved.
binding to the nuclear progesterone receptor (PGR), which acts as a ligand-transcription factor and regulates the expression of P4dependent genes [2]. Nuclear PGRs exist in two major isoforms, PGR-A and PGR-B, which differ in molecular weight (94 and 116 kDa, respectively) and are under the control of different promotors despite being encoded by the same gene in several species [2,3]. Both of these PGR isoforms have been detected in the bovine uterus [4e7]. However, P4 may also act on cells via membrane progesterone receptors such as (a) progesterone receptor membrane component (PGRMC) 1 and its homologue PGRMC2, which belong to the membrane-associated progesterone receptor protein family [8e10], and (b) the membrane progestin receptors (mPRs), which are members of the progestin and adiponectin Q receptor family (PAQR) [9,11,12]. Our previous studies confirmed the nongenomic action of P4 on
172
M.K. Kowalik et al. / Theriogenology 140 (2019) 171e179
the secretory function of the bovine uterus [13e15]. Moreover, we observed variable mRNA and protein expression for PGRMC1, PGRMC2 and its binding partner SERPINE1 mRNA-binding protein (SERBP1) in the bovine endometrium [7] and myometrium [6] during the oestrous cycle and the first trimester of pregnancy in cows, indicating that PGRMC receptors or the PGRMC1/SERBP1 protein complex participate in regulating uterine cell function in cows [6,7,16]. SERBP1, also known as plasminogen activator inhibitor 1 RNA-binding protein (PAIRBP1), may create a complex with PGRMC1 and mediates the responsiveness to P4 via PGRMC1 [17]. This complex participates in the antiapoptotic actions of P4 in spontaneously immortalized granulosa cells [17]. On the other hand, more recently, it was discovered that mPRs may also mediate the rapid nongenomic actions of P4 in the bovine uterus. In recent studies, mPR mRNA and protein expression was detected in the bovine CL [18] and oviduct [19], suggesting that P4 may influence the function of these tissues through interactions with these membrane receptors. The mPRs were first described in spotted seatrout ovaries [20] and subsequently described in other species, including humans [9,11,21]. Initially, three isoforms of this receptor encoded by different genes, mPRa (PAQR7), mPRb (PAQR8), and mPRg (PAQR5) [9,11], were identified. In sheep, the expression of these mPR isoforms was observed in the tissues of the reproductive system as well as in the hypothalamus and pituitary gland [22,23], and to date, these isoforms have been detected in the endometrium [12] and myometrium of women [24]. Two additional mPR isoforms (d and ε) were detected in the tissues of the nervous system in rats [25] and humans [26]. The mPRs are 7-transmembrane proteins that are coupled to stimulatory or inhibitory G proteins depending on the mPR isoform and the cell type [9, 11 27]. Thus, mPRs participate in the regulation of intracellular signalling pathways involved in different functions [27]. The activation of mPR receptors by P4 may inhibit the activity of adenylyl cyclase and the production of cyclic AMP (cAMP) [9,24] or may stimulate MAP kinases or intracellular Ca2þ mobilization [8,22,23,27], which are involved in regulating numerous cellular processes, such as cell proliferation, apoptosis and migration. It has also been suggested that these mPRactivated intracellular pathways are responsible for blood vessel relaxation, gap junction communication between cells [28,29] and the development of cancer [30,31]. The presence of mPR mRNA and/or protein has been reported in cells of the female reproductive system for several species [11,12,18,19,22e24,32e35], and the results of several studies have indicated that mPR receptors are involved in regulating the of maturation [33] and transport of oocytes [34]; in preparing the uterus for implantation [9,22,23,33], pregnancy [12], labour [24]; and in the development of the placenta [35]. However, their physiological roles in uterine function during the oestrous cycle and early pregnancy in cows is not clear. Moreover, to our knowledge, the expression and localization of mPR protein receptors in the endometrium and myometrium of cows during the oestrous cycle and the first trimester of pregnancy have not yet been investigated. Therefore, the aim of the present study was to determine mPRa, mPRb and mPRg mRNA expression, protein expression and immunolocalization in the bovine endometrium and myometrium during the oestrous cycle and the first trimester of pregnancy in cows. 2. Materials and methods 2.1. Tissue collection All experiments were performed in accordance with principles and procedures approved by The Local Animal Care and Use Ethics Committee at the University of Warmia and Mazury in Olsztyn,
Poland. Uteri (ipsilateral to the ovary with a CL) from healthy cows were obtained at a commercial slaughterhouse under veterinary supervision within 20 min of sacrificing the animals. Tissues were collected from animals on days 2e5, 6e10, 11e16, 17e20 (n ¼ 6 per stage) of the oestrous cycle and during weeks 2e5, 6e8 and 9e12 (n ¼ 5 per stage) of pregnancy. The days of the oestrous cycle were assessed by morphological observations of ovaries (follicles and CL) and the uterus as previously described [36,37], while the stages of pregnancy were estimated according to Jainudeen and Hafez [38]. Additionally, the luteal P4 concentrations in the CL of each cow were determined to confirm the correctness of the oestrous cycle and first trimester of pregnancy evaluations. The level of P4 in luteal tissue was the highest on days 6e10 (P < 0.01) and 11e16 (P < 0.05) of the oestrous cycle and during early pregnancy (P < 0.001) compared to its levels on days 2e5 and 17e20 of the oestrous cycle (data not shown). These results supported our morphological assessment of the stages of the oestrous cycle and were consistent with earlier data [39,40]. Immediately following the collection of uteri, the endometrium and myometrium were separated from each other and snap frozen in liquid nitrogen, transported to the laboratory and stored at 80 C until further use. Deep-frozen tissues were homogenized using a vibratory mill (Retsch MM-2), and the resulting tissue powder was divided into individual portions for the determination of P4 levels and the isolation of RNA and protein. Moreover, uterine samples from the same animals were also fixed in 4% paraformaldehyde in 0.1 M PBS (pH 7.4) for 24 h, washed with distilled water, dehydrated in an ethanol gradient and subsequently embedded in paraffin for immunohistochemistry analysis. All materials used in these studies were obtained from SigmaAldrich Co. (St. Louis, MO, USA) unless otherwise stated. 2.2. Progesterone determination Progesterone was extracted from endometrial and myometrial tissues with petroleum ether, and levels were determined by enzyme immunoassay (EIA) [41] using horseradish peroxidaselabelled P4 as a tracer and the previously characterized P4 antiserum [42]. The final dilution of progesterone labelled with horseradish peroxidase and P4 antiserum (IFP4) was 1:60 000. The recovery of P4 averaged 85%. The range of the standard curve was 0.1e25 ng/ml, and the sensitivity of the procedure was 0.15 ng/ml. The intra- and inter-assay coefficients of variation were 8.7 and 11%, respectively. 2.3. RNA isolation and reverse transcription Total RNA was extracted from all homogenized samples using a Total RNA Prep Plus kit (A&A Biotechnology, Gdansk, Poland) according to the manufacturer's instructions. The quantity and purity of isolated RNA were determined with a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA), and RNA quality was assessed using an Agilent 2100 Bioanalyzer (Agilent Technologies, CA, USA). The RNA integrity number ranged from 8 to 10. One microgram of RNA was treated with DNase and reverse transcribed (RT) into cDNA in a 20-ml reaction that contained 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 5 mM dithiothreitol, 10 mM dNTP mix, 1 mg oligo (dT) 23 primers (Fermentas, Vilnius, Lithuania), and 200 IU of M-MLV reverse transcriptase (Promega, Madison, WI, USA). RNA was denatured at 70 C for 10 min, and then the RT reaction was conducted at 42 C for 60 min. The process was terminated by incubation at 70 C for 10 min. Reverse transcriptase products were diluted in nuclease-free water (Promega) to a final concentration of 200 ng/ml and stored at 20 C
M.K. Kowalik et al. / Theriogenology 140 (2019) 171e179
until real-time polymerase chain reaction (PCR) analysis. 2.4. Real-time PCR quantification Specific primer pairs used to amplify regions of mPRa, mPRb, mPRg and GAPDH (glyceraldehyde-3-phosphate dehydrogenase; reference gene) genes were the same as described by Kowalik et al. [19]. Primers were synthesized by Sigma (Warsaw, Poland), and their sequences, GenBank accession numbers and expected PCR product sizes are shown in Table 1. Real-time PCR was performed in duplicate for all samples using an ABI Prism 7300 sequence detection system with Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) as previously described [18,19]. Each PCR sample (25 ml volume) contained 5 ml of cDNA (200 ng), forward and reverse primers (200 pM each) and 12.5 ml of Power SYBR Green PCR Master Mix. The following PCR conditions were used: an initial denaturation (10 min at 95 C) followed by 40 cycles of denaturation (15 s at 95 C), annealing and extension (60 s at 60 C). After these steps, melting curves were obtained by stepwise temperature increases from 60 to 95 C to ensure single-product amplification. To exclude the possibility of genomic DNA contamination in the RNA samples or cross contamination between samples, the reactions were also run either on blank-only buffer samples or in the absence of reverse transcriptase. Furthermore, the specificity of the RT-PCR product was confirmed by gel electrophoresis and sequencing. Relative mRNA quantification data were analysed using the real-time PCR Miner algorithm [43]. The real-time PCR data obtained for the mPRa, mPRb, and mPRg mRNA contents were normalized to that of GAPDH. 2.5. Western blot analysis Protein extraction and Western blot analysis was performed as previously described [18,40]. Radioimmunoprecipitation assay (RIPA) buffer (25 mM Tris-HCl, 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 5 mM EDTA, and 0.1% SDS, pH 7.6) supplemented with protease inhibitor cocktail was used for protein sample preparation. Endometrial and myometrial tissues were homogenized on ice using an ultrasound homogenizer (Sonics & Materials Inc., Newton, CT, USA) and then centrifuged for 10 min at 1000 g at 4 C. The resultant supernatant, which contained the cytosol and membrane fractions, was collected, aliquoted, and stored at 80 C for Western blot analysis. The protein concentration was determined using the Bradford method [44]. Equal amounts of endometrial and myometrial proteins (50 mg) were dissolved in SDS gel-loading buffer (50 mM Tris-HCl, 4% SDS, 20% glycerol, and 2% b-mercaptoethanol, pH 6.8), heated at 95 C for 8 min and separated on 9% SDS-polyacrylamide gel electrophoresis. Separated proteins were transferred to a 0.2-mm Immobilon PVDF membranes (Millipore, Billerica, MA, USA) in transfer buffer (20 mM Tris-HCl, 150 mM glycine, and 20% methanol, pH 8.2). Thereafter, the membranes were blocked with 5% nonfat dry
173
milk in TBS buffer (50 mM Tris-HCl; 0.9% NaCl) containing 0.05% Tween-20 (TBS-T) for 1.5 h at room temperature. The membranes were then incubated overnight at 4 C with the following primary antibodies diluted in TBS-T: a polyclonal rabbit anti-mPRa antibody (1:100; cat. no HPA046936, Sigma) that recognizes the mPRa protein (molecular mass of approximately 40 kDa); a polyclonal goat anti-mPRb (1:100; cat. no sc-50109, Santa Cruz Biotechnology, Dallas, TX, USA) that recognizes the mPRb protein (molecular mass of approximately 41 kDa); a rabbit polyclonal anti-mPRg antibody (1:100, cat. HPA016507, Sigma) that recognizes the mPRg protein (molecular mass approximately 38 kDa); and a monoclonal mouse anti-GAPDH antibody (concentration 0.1 mg/ml; cat. no G-8795; Sigma) as a reference protein. To test the specificity of the antibodies for mPRa, mPRb and mPRg, we used the human myometrial tissue lysate as a positive control. Next, the membranes were washed three times for 10 min each in TBS-T buffer and subsequently treated with horseradish peroxidase-conjugated anti-rabbit IgG (dilution 1:50 000, Sigma), anti-goat IgG (dilution 1:50 000, Abcam) and anti-mouse IgG (dilution 1:50 000, Abcam) for 1.5 h at room temperature. Immunoreactive bands were detected using a stock solution of 4-nitroblue tetrazolium chloride (NBT) and 5bromo-4-chloro-3-indolyl phosphate (BCIP) with alkaline phosphatase assay buffer (0.1 M NaCl, 5 mM MgCl2, and 100 mM TrisHCl, pH 9.5). Band intensities were measured using Quantity One 1D analysis software (Bio-Rad, Berkeley, USA). The Western blot data obtained for mPRa, mPRb and mPRg were normalized to the GAPDH protein content.
2.6. Immunohistochemistry Immunohistochemistry was performed as described previously [18,19,40]. Serial tissue sections (6 mm) of uteri from all examined phases of the oestrous cycle and the first trimester of pregnancy were mounted on silane-coated slides (Superfrost plus, Menzel€ser, Braunschweig, Germany). To remove the paraffin, the secGla tions were heated at 56e60 C for 20 min and soaked in xylene (2 10 min). Subsequently, the sections were rehydrated in a series of ethanol dilutions (100, 96, and 70%, H2O) for 5 min per step. Next, the sections were subjected to pressure cooking in 0.01 M sodium citrate with 0.05% Tween 20 (pH 6.0) for antigen retrieval. The sections were cooled for 30 min at room temperature, washed three times in TBS for 5 min and then incubated with 10% hydrogen peroxide in H2O for 30 min to block endogenous peroxidase activity. Subsequently, the sections were washed three times in TBS for 5 min each and then incubated with 10% Normal Goat Serum (NGS; for mPRa) or Normal Rabbit serum (NRS; for mPRb and mPRg) in PAV buffer (containing 0.1 M PBS, 0.1% BSA and 0.05% thimerosal) to block nonspecific protein binding for 1 h at room temperature. Next, the sections were incubated overnight at 4 C with primary antibodies at the following dilutions: 1:80 for rabbit polyclonal anti-mPRa (Sigma); 1:20 for goat polyclonal anti-mPRb (Santa Cruz Biotechnology, Dallas, TX, USA); and 1:20 for goat
Table 1 Forward and reverse primer sequences, amplicon length in base pairs and GenBank accession numbers for real-time PCRs. Gene name
Primers sequence (forward/reverse)
GenBank Accession Number
Amplicon length
mPRa
Forward: CCGGCGGTCCATCTATGA Reverse: CCACCCCCTTCACTGAGTCTT Forward: TGCCCCTGCTCGTCTATGTC Reverse: CCCACGTAGTCCACGAAGTAGAA Forward: GGTTCTTCTCGTGGAGGTTTGT Reverse: GTTCCTGGACATGGAGCTGAA Forward: CCTGCCCGTTCGACAGATA Reverse: GGCGACGATGTCCACTTTG
NM_001038553
159
NM_001101135
120
XM_005193580
151
NM_001034034
150
mPRb mPRg GAPDH
174
M.K. Kowalik et al. / Theriogenology 140 (2019) 171e179
polyclonal anti-mPRg (Santa Cruz Biotechnology). The primary antibodies were omitted from the negative control during the immunostaining procedure. For the negative control sections, the primary antibodies were replaced with NGS or NRS (diluted 1:10). On the following day, the sections were washed four times in TBS for 5 min, incubated with biotinylated goat anti-rabbit IgG antibody (for mPRa, Vector Laboratories Inc., Burlingame, CA, USA) or a biotinylated rabbit anti-goat IgG antibody (for mPRb and mPRg, Vector Laboratories) diluted 1:400 in PAV buffer (with 10% NRS or NGS) for 30 min at 4 C. Specific binding was visualized with the ABC complex (Vector Laboratories) according to the manufacturer's instructions. Thereafter, the sections were washed 3 times in TBS and visualized with 3,30 -diaminobenzidine (DAB; DakoCytomation). Next, the sections were rinsed, counterstained with Mayer's haematoxylin, dehydrated and covered with mounting medium (DPX, POCh, Poland) before subsequent examination using a Zeiss Axio Imager Z1 microscope (Zeiss, Germany). 2.7. Statistical analysis Statistical analyses were conducted using one-way ANOVA followed by Tukey's post-test (GraphPad PRISM 6.0; Graph Pad Software, San Diego, CA, USA) after testing for normality. All data were expressed as the means (±SEM), and differences were considered significant at P < 0.05. Pearson's coefficient of correlation between was also calculated for the observed mRNA expression and P4 concentration in the endometrium and myometrium samples (GraphPad PRISM 7.0).
mPRa, mPRb and mPRg in bovine endometrial (Fig. 2AeC) and myometrial (Fig. 2DeF) tissues. The expression of mPRa mRNA during the oestrous cycle was the highest (P < 0.01) on days 11e16 in the endometrium (Fig. 2A) and on days 2e5 and 17e20 in the myometrium (P < 0.05; Fig. 2D). The level of mPRa mRNA in the endometrium during pregnancy was comparable with that observed during the oestrous cycle (Fig. 2A) but was higher (P < 0.05; Fig. 2D) in the myometrium during weeks 3e5 and 9e12 of pregnancy than on days 6e20 of the oestrous cycle. The expression of mPRb mRNA in the endometrium was the highest (P < 0.05) during days 11e16 of the oestrous cycle and all studied weeks of pregnancy (Fig. 2B). The expression of mPRb mRNA in the myometrium was the lowest (P < 0.05) on days 11e16 of the oestrous cycle and in weeks 6e8 of pregnancy, although higher levels of mPRb mRNA were observed during 3e5 and 9e12 weeks of pregnancy (Fig. 2E) than at the other assayed stages of the oestrous cycle and pregnancy (P < 0.05; Fig. 2E). No significant differences (P > 0.05) in mPRg mRNA expression were observed during the oestrous cycle in both the endometrium (Fig. 2C) and myometrium (Fig. 2F) tissues, although this gene was expressed at higher levels (P < 0.01) in pregnant animals than in cyclic animals (Fig. 2C, F). 3.3. Protein expression of mPRa, mPRb, and mPRg in the uterus
The P4 levels in both the endometrial and myometrial tissues were the highest on days 2e5 (P < 0.05) of the oestrous cycle (Fig. 1). From days 6e10 of the oestrous cycle, the P4 levels in both tissues decreased (P < 0.05) and were maintained at a similar level during days 11e20 of the oestrous cycle and the first trimester of pregnancy (Fig. 1). We did not find a correlation between the mRNA expression for each mPR receptor and the P4 concentration in the endometrium or myometrium samples, respectively.
The Western blot analysis results revealed the presence of mPR proteins in both the endometrium and myometrium tissues during all stages of the oestrous cycle and the first trimester of pregnancy (Fig. 3). The antibodies used in this study recognized major bands with predicted molecular masses of approximately 40 kDa for mPRa, mPRb, and mPRg in the examined bovine uterus tissues. The analysis performed on the endometrium samples did not reveal any significant differences in mPRa and mPRg expression at the protein level (Fig. 3A, C). Expression of mPRb was increased (P < 0.05) on days 6e10 compared to the expression in weeks 6e8 of pregnancy (Fig. 3B). In the myometrium, only the expression of mPRa protein was higher (P < 0.05) in weeks 9e12 of pregnancy than in all stages of the oestrous cycle (Fig. 3D). No significant differences (P > 0.05) were observed in the mPRb and mPRg protein expression profiles in bovine myometrium throughout the oestrous cycle and pregnancy (Fig. 3E and F).
3.2. mRNA expression of mPRa, mPRb and mPRg
3.4. Protein localization of mPRa, mPRb, and mPRg in the uterus
3. Results 3.1. P4 concentration
Quantitative real-time PCR analysis confirmed the expression of
Fig. 1. Progesterone (P4) concentrations (mean ± SEM) in bovine endometrium and myometrium samples collected during the oestrous cycle (days 2e5, 6e10, 11e16, and 17e20; n ¼ 6 uteri per stage) and first trimester of pregnancy (weeks 3e5, 6e8, and 9e12; n ¼ 5 uteri per stage). Values with different superscripts are different as determined by at least P < 0.05. Capital letters: endometrium; small letters: myometrium.
Positive mPR immunostaining was observed in all uterine compartments during days 2e5, 6e10, 11e16 and 17e20 of the oestrous cycle and the first trimester of pregnancy. The mPRa (Fig. 4AeC), mPRb (Fig. 4DeF) and mPRg (Fig. 4GeI) proteins were localized in the luminal and glandular epithelium as well as in stromal cells within the endometrium. In epithelial cells, immunostaining was very intense, whereas stroma cells showed weaker mPR immunoreactivity (Fig. 4). In the myometrium, mPR receptors were detected in myometrial cells within longitudinal and circular layers at all examined stages of the oestrous cycle (Fig. 4). Moreover, the mPRa, mPRb and mPRg proteins were detected in the endothelium of blood vessels in bovine endometrium and myometrium on all days of the oestrous cycle (Fig. 4). No staining was detected in the endometrium and myometrium when 0.01 M PBS or the rabbit universal negative control was used instead of primary antibodies. 4. Discussion The obtained data demonstrated the cellular localization and expression of mPRa, mPRb and mPRg mRNA and protein within the
M.K. Kowalik et al. / Theriogenology 140 (2019) 171e179
175
Fig. 2. Mean (±SEM) expression of mPRa (A,D), mPRb (B, E), and mPRg (C,F) mRNA determined by real-time PCR in bovine endometrium (A, B, C) and myometrium samples (D, E, F) during the oestrous cycle (days 2e5, 6e10, 11e16, and 17e20; n ¼ 6 uteri per stage) and first trimester of pregnancy (weeks 3e5, 6e8, and 9e12; n ¼ 5 uteri per stage). Values with different superscripts are significantly different as determined by at least P < 0.05. mPRa, membrane progestin receptor alpha; mPRb, membrane progestin receptor beta; mPRg, membrane progestin receptor gamma.
bovine endometrium and myometrium during the oestrous cycle and the first trimester of pregnancy. The mRNA and protein expression of mPRa, mPRb and mPRg were observed to depend on the stage of the oestrous cycle and/or pregnancy and on the type of uterine tissues. The localization of mPRs was observed in all compartments of the uterus during all stages of the oestrous cycle and early pregnancy. Immunostaining was particularly noticeable in the luminal and glandular epithelium, whereas this reaction was less evident in the stromal cells and in myocytes. Moreover, all mPRs were also localized in the endothelial cells of blood vessels in the uterus. Therefore, the obtained results confirm that mPRs may be involved in P4 activity in the bovine uterus independent of nuclear P4 and PGRMC receptors. It should be noted that the gene expression results obtained in this study did not coincide with the protein level profiles. This discrepancy may have been caused by various post-transcriptional or post-translational regulatory mechanisms [45] such as: gene silencing by siRNA and miRNA [46]; a negative feedback loop between mRNA synthesis and protein production [47]; or the time interval between mRNA formation and protein synthesis [45]. In detail, the highest mPRa and mPRb mRNA expression was
observed in the bovine endometrium on days 11e16 of the oestrous cycle and corresponded with the P4 concentration in CL tissues [40] during the mid-luteal phase of the oestrous cycle and the first trimester of pregnancy. It is possible that the P4 secreted from the CL may regulate mPR expression in the bovine endometrium and affect the function of endometrial tissue. It should be noted that in the bovine endometrium, the highest PGR mRNA and PGRA and PGRB protein expression was observed on days 1e5 and 17e20 of the oestrous cycle [7]. Moreover, the P4 concentration in the endometrium was the highest during days 2e5 of the oestrous cycle and then decreased to a low level on days 11e20, suggesting that P4 may act on endometrial function through the mPRa and mPRb receptors on these days. Our previous study showed that the expression of PGRMC1 and PGRMC2 mRNA in endometrial tissues remained relatively constant during the oestrous cycle [7]. Therefore, these results indicate that mPR receptors may intermediate in P4 action on endometrial function during the oestrous cycle. In the myometrium, we observed the lowest levels of mPRa and mPRb mRNA on days 6e16 and 11e16 of the oestrous cycle, respectively. It should be noted that the expression of PGR mRNA in the bovine myometrium is also downregulated on days 11e16 of
176
M.K. Kowalik et al. / Theriogenology 140 (2019) 171e179
Fig. 3. Mean (±SEM) protein expression of mPRa (A, D), mPRb (B, E), and mPRg (C, F) in bovine endometrium (A, B, C) and myometrium samples (D, E, F) during the oestrous cycle (days 2e5, 6e10, 11e16, and 17e20; n ¼ 6 uteri per stage) and first trimester of pregnancy (weeks 3e5, 6e8, and 9e12; n ¼ 5 uteri per stage). Upper panel: representative immunoblots; lower panel: densitometric analyses of mPRa, mPRb, and mPRg protein relative to GAPDH protein. Values with different superscripts are significantly different as determined by at least P < 0.05.
M.K. Kowalik et al. / Theriogenology 140 (2019) 171e179
177
Fig. 4. Representative photomicrographs of immunohistochemical localization of mPRa (AeC), mPRb (DeF) and mPRg (GeI) protein at 11e16 days of the oestrous cycle in the bovine uterus. Positive immunoreactions for all mPRs receptors were observed in the luminal epithelial cells (LE), glandular epithelial cells (GE) and stromal cells (S) of endometrium samples as well as in myometrial cells (M) and epithelial cells of blood vessels (black arrows). Upper corners: negative control. Bar ¼ 50 mm.
the oestrous cycle [6]. Furthermore, myometrial levels of PGRA and PGRB protein and the concentration of P4 decreased after day 6 of the oestrous cycle [6]. Consequently, it may be assumed that P4 directly acts on the myometrial tissues by binding to the mPR protein, as previously suggested [9,11], but the intensity of this process may depend on the stage of the oestrous cycle. During pregnancy, the levels of mPRa and mPRb mRNA in the endometrium remained stable and similar to those observed on days 11e16 of the oestrous cycle. However, in the myometrium, we observed decreased expression of mPRa and mPRb mRNA at weeks 6e8 of pregnancy compared to that at other stages of gestation. Moreover, in both uterine tissues, the expression of mPRg mRNA increased during the first trimester of pregnancy compared to that in the oestrous cycle. These results suggest that each mPR receptor may have a different role in regulating the uterus during pregnancy. The variable expression of mPRa and mPRb receptors in the bovine endometrium and myometrium during the oestrous cycle and gestation suggests an association between mPR expression in the bovine uterus and the stage of the oestrous cycle or pregnancy that may be a result of changes in ovarian steroid concentrations. This suggestion was confirmed by data obtained in human endometrium [12] and myometrium samples [24], where mPRa and mPRb expression were shown to be induced by P4 and oestradiol, respectively. However, the effect of steroids on the expression of the membrane P4 receptor seems to depend on the receptor isoforms and type of tissues [21,24,25,30], thus these data require further detailed studies. In this study, mPR proteins were observed to be highly expressed in luminal and glandular epithelial cells, whereas weaker staining was observed in the stroma and myometrial cells. The presence of mPRs, particularly in the uterine luminal and glandular epithelial cells, indicates the possible participation of these receptors in secretion (e.g., prostaglandins) and proliferation processes in endometrial tissues. Thus, these receptors can participate in the preparation of a suitable environment for embryo
implantation and embryo and foetus development. Moreover, we also demonstrated the expression of mPRa, mPRb and mPRg protein in the endothelial cells of blood vessels in endometrial tissue, similar to that observed for the oviduct [19] and CL [18] in cows. Expression of these receptors in myometrial tissue was less evident. It should be noted that the expression of PGRMC1 and PGRMC2 receptors was also observed in the endothelial cells of blood vessels in the bovine uterus, CL and oviduct [7,19,40]. Thus, it can be assumed that P4, through its membrane receptors in endothelial cells, may rapidly affect blood flow in the vessels of the reproductive tract in a transcription-independent manner. Similarly, it was previously suggested that PGR receptors are involved regulating vascular permeability, which may be important for successful implantation [48] and in the modulation of uterine blood flow [49]. However, it is difficult to clearly define which of the mechanisms of P4 action (genomic or nongenomic) is dominant and whether the dominant mechanism changes under different physiological states. It is possible that these alternative signalling pathways function in parallel. However, it is also possible that each of these pathways has a different role in cell homeostasis. Therefore, the collection of additional data to elucidate the role of membrane P4 receptors and their participation in activities within the endometrium and myometrium is crucial.
5. Conclusions In summary, our results indicate that mPRa, mPRb and mPRg are expressed in the bovine uterus at the gene and protein levels in both endometrium and myometrium tissues and that their level is dependent on the hormonal status of the animals. The presence of membrane progestin receptors in the uterus suggests their involvement in the regulation of uterine functions. However, additional studies are needed to determine the physiological role of these receptors in the bovine uterus.
178
M.K. Kowalik et al. / Theriogenology 140 (2019) 171e179
Acknowledgements We thank Professor S. Okrasa (University of Warmia and Mazury, Olsztyn, Poland) for providing the progesterone antiserum. This study was supported by the National Science Centre, Poland (project OPUS no. 2012/05/B/NZ4/01810 and no. 2017/27/B/NZ4/ 02973). References [1] Niswender GD, Juengel JL, Silvia PJ, Rollyson MK, McIntush EW. Mechanism controlling the function and life span of the corpus luteum. Physiol Rev 2000;80:1e29. [2] Mulac-Jericevic B, Conneely OM. Reproductive tissue selective actions of progesterone receptors. Reproduction 2004;128:139e46. [3] Kastner P, Krust A, Turcotte B, Strupp U, Tora L, Gronemeyer H, Chambon P. Two distinct estrogen-regulated promoters generate transcripts encoding the two functionally different human progesterone receptor forms A and B. EMBO J 1990;9:1603e14. [4] Kimmins S, MacLaren LA. Oestrous cycle and pregnancy effects on the distribution of oestrogen and progesterone receptors in bovine endometrium. Placenta 2001;22:742e8. [5] Robinson RS1, Mann GE, Lamming GE, Wathes DC. Expression of oxytocin, oestrogen and progesterone receptors in uterine biopsy samples throughout the oestrous cycle and early pregnancy in cows. Reproduction 2001;122: 965e79. [6] Slonina D, Kowalik MK, Kotwica J. Expression of progesterone receptor membrane component 1, serpine mRNA binding protein 1 and nuclear progesterone receptor A and B in the bovine myometrium during the estrous cycle and early pregnancy. J Reprod Dev 2012;58:288e94. [7] Kowalik MK, Slonina D, Rekawiecki R, Kotwica J. Expression of progesterone receptor membrane component (PGRMC) 1 and 2, serpine binding protein 1 (SERBP1) and nuclear progesterone receptor (PGR) in the bovine endometrium during the estrous cycle and the first trimester of pregnancy. Reprod Biol 2013;13:15e23. [8] Peluso JJ. Multiplicity of progesterone's actions and receptors in the mammalian ovary. Biol Reprod 2006;75:2e8. [9] Gellersen B, Fernandes MS, Brosens JJ. Non-genomic progesterone actions in female reproduction. Hum Reprod Update 2009;15:119e38. [10] Cahill MA. Progesterone receptor membrane component 1: an integrative review. J Steroid Biochem Mol Biol 2007;105:16e36. [11] Zhu Y, Bond J, Thomas P. Identification, classification, and partial characterization of genes in humans and other vertebrates homologous to a fish membrane progestin receptor. Proc Natl Acad Sci USA 2003;100:2237e42. [12] Fernandes MS, Pierron V, Michalovich D, Astle S, Thornton S, Peltoketo H, Lam EW, Gellersen B, Huhtaniemi I, Allen J, Brosens JJ. Regulated expression of putative membrane progestin receptor homologues in human endometrium and gestational tissues. J Endocrinol 2005;187:89e101. [13] Bogacki M, Silvia WJ, Rekawiecki R, Kotwica J. Direct inhibitory effect of progesterone on oxytocin-induced secretion of prostaglandin F2a from bovine endometrial tissue. Biol Reprod 2002;67:184e8. [14] Duras M, Mlynarczuk J, Kotwica J. Non-genomic effect of steroids on oxytocinstimulated intracellular mobilization of calcium and on prostaglandin F2 and E2 secretion from bovine endometrial cells. Prostaglandins Other Lipid Mediat 2005;76:105e16. [15] Kowalik MK, Slonina D, Kotwica J. Genomic and non-genomic effect of progesterone (P4) and pregnenolone (P5) on the function of bovine endometrial cells. Vet Med 2009;54:205e14. [16] Kowalik MK, Rekawiecki R, Kotwica J. The putative roles of nuclear and membrane-bound progesterone receptors in the female reproductive tract. Reprod Biol 2013;13:279e89. [17] Peluso JJ, Yuan A, Liu X, Lodde V. Plasminogen activator inhibitor 1 RNAbinding protein interacts with progesterone receptor membrane component 1 to regulate progesterone's ability to maintain the viability of spontaneously immortalized granulosa cells and rat granulosa cells. Biol Reprod 2013;88: 1e10. [18] Kowalik MK, Rekawiecki R, Kotwica J. Expression of membrane progestin receptors (mPRs) in the bovine corpus luteum during the estrous cycle and first trimester of pregnancy. Domest Anim Endocrinol 2018;63:69e79. [19] Kowalik MK, Martyniak M, Rekawiecki R, Kotwica J. Expression and immunolocalization of membrane progesterone receptors in the bovine oviduct. Domest Anim Endocrinol 2016;55:83e96. [20] Zhu Y, Rice CD, Pang Y, Pace M, Thomas P. Cloning, expression, and characterization of a membrane progestin receptor and evidence it is an intermediary in meiotic maturation of fish oocytes. Proc Natl Acad Sci USA 2003;100: 2231e6. n-Castela na L, Gonz [21] Valadez-Cosmesa P, Germa alez-Arenasb A, VelascoVel azquezc MA, Hansberg-Pastord V, Camacho-Arroyoa I. Expression and hormonal regulation of membrane progesterone receptors in human astrocytoma cells. J Steroid Biochem Mol Biol 2015;154:176e85.
[22] Ashley RL, Clay CM, Farmerie TA, Niswender GD, Nett TM. Cloning and characterization of an ovine intracellular seven transmembrane receptor for progesterone that mediates calcium mobilization. Endocrinology 2006;147: 4151e9. [23] Ashley RL, Arreguin-Arevalo JA, Nett TM. Binding characteristics of the ovine membrane progesterone receptor alpha and expression of the receptor during the estrous cycle. Reprod Biol Endocrinol 2009;7:42. [24] Karteris E, Zervou S, Pang Y, Dong J, Hillhouse EW, Randeva HS, Thomas P. Progesterone signaling in human myometrium through two novel membrane G protein-coupled receptors: potential role in functional progesterone withdrawal at term. Mol Endocrinol 2006;20:1519e34. [25] Intlekofer KA, Petersen SL. 17b-estradiol and progesterone regulate multiple progestin signalling molecules in the anteroventral periventricular nucleus, ventromedial nucleus and sexually dimorphic nucleus of the preoptic area in female rats. Neuroscience 2011;176:86e92. [26] Pang Y, Dong J, Thomas P. Characterization, neurosteroid binding and brain distribution of human membrane progesterone receptors delta and {epsilon} (mPRdelta and mPR{epsilon}) and mPRdelta involvement in neurosteroid inhibition of apoptosis. Endocrinology 2013;154:283e95. [27] Thomas P, Pang Y, Dong J, Groenen P, Kelder J, de Vlieg J, Zhu Y, Tubbs C. Steroid and G protein binding characteristics of the seatrout and human progestin membrane receptor alpha subtypes and their evolutionary origins. Endocrinology 2007;148:705e18. [28] Bishop CV, Stormshak F. Non-genomic actions of progesterone and estrogens in regulating reproductive events in domestic animals. Vet J 2008;176: 270e80. [29] Thomas P, Pang Y. Protective actions of progesterone in the cardiovascular system: potential role of membrane progesterone receptors (mPRs) in mediating rapid effects. Steroids 2013;78:583e8. [30] Dressing GE, Goldberg JE, Charles NJ, Schwertfeger KL, Lange CA. Membrane progesterone receptor expression in mammalian tissues: a review of regulation and physiological implications. Steroids 2011;76:11e7. [31] Vares G, Sai S, Wang B, Fujimori A, Nenoi M, Nakajima T. Progesterone generates cancer stem cells through membrane progesterone receptor-triggered signaling in basal-like human mammary cells. Cancer Lett 2015;362(2): 167e73. [32] Cai Z, Stocco C. Expression and regulation of progestin membrane receptors in the rat corpus luteum. Endocrinology 2005;146:5522e32. [33] Qiu HB, Lu SS, Ji KL, Song XM, Lu YQ, Zhang M, Lu KH. Membrane progestin receptor beta (mPR-b): a protein related to cumulus expansion that is involved in in vitro maturation of pig cumuluseoocyte complexes. Steroids 2008;73:1416e23. [34] Nutu M, Weijdegard B, Thomas P, Thurin-Kjellberg A, Billig H, Larsson DGJ. Distribution and hormonal regulation of membrane progesterone receptors b and g in ciliated epithelial cells of mouse and human fallopian tubes. Reprod Biol Endocrinol 2009;7:89. [35] Reynolds LP, Haring JS, Johnson ML, Ashley RL, Redmer DA, Borowicz PP, Grazul-Bilska AT. Placental development during early pregnancy in sheep: estrogen and progesterone receptor messenger RNA expression in pregnancies derived from in vivo-produced and in vitro-produced embryos. Domest Anim Endocrinol 2015;53:60e9. [36] Ireland JJ, Murphee RL, Coulson PB. Accuracy of predicting stages of bovine estrous cycle by gross appearance of the corpus luteum. J Dairy Sci 1980;63: 155e60. [37] Fields MJ, Fields PA. Morphological characteristics of the bovine corpus luteum during the estrous cycle and pregnancy. Theriogenology 1996;45: 1295e325. [38] Jainudeen MR, Hafez ESE. Gestation, prenatal physiology and parturition. In: Hafez ESE, editor. Reproduction in farm animals. Philadelphia: Lea & Febiger; 1980. p. 247e83. [39] Miszkiel G, Skarzynski D, Bogacki M, Kotwica J. Concentrations of catecholamines, ascorbic acid, progesterone and oxytocin in the corpora lutea of cyclic and pregnant cattle. Reprod Nutr Dev 1999;39:509e16. [40] Kowalik MK, Rekawiecki R, Kotwica J. Expression and localization of progesterone receptor membrane component 1 and 2 and serpine mRNA binding protein 1 in the bovine corpus luteum during the estrous cycle and the first trimester of pregnancy. Theriogenology 2014;82:1086e93. [41] Prakash BS, Meyer HD, Schallenberger E, Van de Weil DF. Development of sensitive enzymeimmunoassay (EIA) for progesterone determination in unextracted bovine plasma using the second antibody technique. J Steroid Biochem 1987;28:623e7. [42] Kotwica J, Skarzynski DJ, Jaroszewski JJ, Bogacki M. Noradrenaline affects secretory function of corpus luteum independently on prostaglandins in conscious cattle. Prostaglandins 1994;48:1e9. [43] Zhao S, Fernald RD. Comprehensive algorithm for quantitative real-time polymerase chain reaction. J Comput Biol 2005;12:1047e64. [44] Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of proteinedye binding. Anal Biochem 1976;72:248e54. [45] Greenbaum D, Colangelo C, Williams K, Gerstein M. Comparing protein abundance and mRNA expression levels on a genomic scale. Genome Biol 2003;4:117. [46] Scherr M, Eder M. Gene silencing by small regulatory RNAs in mammalian
M.K. Kowalik et al. / Theriogenology 140 (2019) 171e179 cells. Cell Cycle 2007;6:444e9. [47] Stormshak F, Orwig KE, Bertrand JE. Dynamics of molecular mechanisms underlying ovarian oxytocin secretion. J Reprod Fertil 1995;49:379e90. [48] Goddard LM, Murphy TJ, Org T, Enciso JM, Hashimoto-Partyka MK, Warren CM, et al. Progesterone receptor in the vascular endothelium triggers
179
physiological uterine permeability pre-implantation. Cell 2014;156:549e62. [49] Perrot-Applanat M, Deng M, Fernandez H, Lelaidier C, Meduri G, Bouchard P. Immunohistochemical localization of estradiol and progesterone receptors in human uterus throughout pregnancy: expression in endometrial blood vessels. J Clin Endocrinol Metab 1994;78:216e24.