- Email: [email protected]
Fibroblast growth factor 21 ameliorates pancreatic fibrogenesis via regulating polarization of macrophages
Experimental Cell Research xxx (xxxx) xxx–xxx
Contents lists available at ScienceDirect
Experimental Cell Research journal homepage: www.elsevier.com/locate/yexcr
Fibroblast growth factor 21 ameliorates pancreatic fibrogenesis via regulating polarization of macrophages Nan Wanga, Ting-ting Zhaoc,f, Si-ming Lid, Yan-hua Lie, Yu-jia Wanga, De-shan Lia,**, Wen-fei Wanga,b,* a
Northeast Agricultural University, School of Life Science, Harbin, China Harbin Veterinary Research Institute, Harbin, China c Central South University, Aier School of Ophthalmology, Changsha, China d Harbin University of Commerce, Harbin, China e Northeast Agricultural University, School of Veterinary Medicine, Harbin, China f Aier Eye Hospital Group, Harbin,China b
ARTICLE INFO
ABSTRACT
Keywords: FGF-21 Chronic pancreatitis Pancreatic fibrogenesis Macrophage differentiation
Chronic pancreatitis (CP) is a progressive, irreversible inflammatory and fibrotic disease. The characteristics of this disease are progressive inflammation, acinar atrophy and fibrosis. Numerous factors are involved in CP such as inflammation, and oxidative stress. Recently, it has been noted that fibroblast growth factor 21 (FGF-21) reduced the severity of acute pancreatitis in mice. However, whether FGF-21 has effects on CP remains unclear. Thus, the present study was undertaken to detect the effects of FGF-21 on L-arginine induced chronic pancreatitis/islet fibrosis in mice. We used L-arginine to create a CP model in C57BL/6 mice and treated these mice with FGF-21. Compared to normal mice, blood glucose and intra-peritoneal glucose tolerance test (IPGTT) revealed significant impairment in CP animal model. CP mice also had acinar atrophy, loss of pancreas morphology, inflammatory cells infiltration, extensive deposition of collagen, elevated < alpha > -SMA expression, collagen I expression, serum amylase activity, MPO activity and MDA level. All these pathological changes were significantly improved by FGF-21 treatment. Moreover, FGF-21 ameliorated inflammatory state in the serum, pancreas and peritoneal macrophages of CP mice. Furthermore, we also found that FGF-21 could regulate differentiation of macrophages so as to improve pancreatic fibrogenesis in CP mice. Taken together, our study identifies the beneficial role of FGF-21 in CP and suggests that FGF-21 improves pancreatic fibrogenesis in CP via the mTOR pathway.
1. Introduction Chronic pancreatitis (CP) is characterized by progressive and irreversible damage to the pancreas, finally leading to both exocrine and endocrine insufficiency [1]. Pancreatic damage, pancreatic fibrosis, acinar atrophy, chronic inflammation, and distorted ducts are the fundamental histopathologic features of CP [2,3]. There are many associated participants during initiation and progression of CP, including necro-inflammation, oxidant stress and nitric oxide [4]. The major symptom of CP is often pain, patients have severe abdominal pain and increased blood amylase, lipase, and trypsinogen [5]. A growing epidemic of CP is threatening the health of millions of people around the world, which is also increasing the economic and mental burden of patients. Therefore, developing novel, effective drugs that ameliorate *
development of CP has an essential role in improving the prognosis of patients with CP. Fibrosis is a major character in CP and caused by many factors such as necrosis/apoptosis and inflammation. The excessive formation of extracellular matrix (ECM) eventually results in a loss of architecture of the pancreas and dysfunction of the islets [6]. Recent studies emphasized macrophages as primary regulators of fibrosis [7]. Furthermore, Jing et al. concluded that alternatively activated macrophages could promote pancreatic fibrogenesis in chronic pancreatitis [8]. Fibroblast growth factor 21 (FGF-21) is a metabolic regulator, which is dominantly expressed in the liver [9] and also expressed in other organs such as pancreas [10]. FGF-21 has a potent effect on regulating glucose and lipid metabolism [11,12]. Apart from that, recently it has been found that FGF-21 also has anti-inflammation effects
Corresponding author. School of Life Science, Northeast Agricultural University, Harbin, Heilongjiang Province, 150030, China. Corresponding author. School of Life Science, Northeast Agricultural University, Harbin, Heilongjiang Province, 150030, China. E-mail addresses: [email protected] (D.-s. Li), [email protected] (W.-f. Wang).
**
https://doi.org/10.1016/j.yexcr.2019.06.002 Received 17 November 2018; Received in revised form 3 June 2019; Accepted 4 June 2019 0014-4827/ © 2019 Published by Elsevier Inc.
Please cite this article as: Nan Wang, et al., Experimental Cell Research, https://doi.org/10.1016/j.yexcr.2019.06.002
Experimental Cell Research xxx (xxxx) xxx–xxx
N. Wang, et al.
Fig. 1. Preparation of FGF21. A. SDS-PAGE gel analysis of purified FGF-21.1 protein molecular mass marker; 2 supernatant of FGF21 cell lysates; 3 purified SUMOFGF-21 fusion protein; 4 other proteins; 5 cleavage products of SUMO-FGF-21 with SUMO protease 6 SUMO-tag. B. SDS-PAGE gel analysis of purified FGF-21.1–2 FGF-21; 3 protein molecular mass marker. C and D. Glucose uptake of 3T3-L1 adipocytes after treatment with different concentrations of FGF-21. The measurements were performed at least three times with similar results. *p < 0.05, **p < 0.01 vs control.
in various diseases such as obesity, diabetes and atherosclerosis [13–15]. In addition, FGF-21 can improve inflammatory states in macrophages [16]. More importantly, Xu et al. found that FGF-21 could attenuate hepatic fibrogenesis [17]. Besides, a previous study has demonstrated that FGF-21 can reduce the severity of acute pancreatitis [10]. However, to our knowledge, whether FGF-21 has beneficial effects on CP that remains largely unknown. Intrigued by findings from these, we asked whether FGF-21 also has favorable effects on CP. In this study, we are intended to investigate the effects of FGF-21 on CP. Moreover, we also aim to examine effects of FGF-21 on biological activity of macrophages and its associated mechanisms in CP. This will provide a novel therapeutic target for CP and FGF-21 may become a potential candidate in the clinical treatment of CP.
E. coli Rosetta (containing a recombinant plasmid of pSUMO-FGF21) were grown in LB media containing ampicillin (100 μg/mL). When the OD 600 reached 0.4 to 0.6, IPTG was added into the medium at the final concentration of 0.25 mmol/L. The culture was then grown at 30 °C for 4 h to induce expression of the FGF-21 protein. SUMO-FGF21 fusion protein was purified by a Ni Sepharose 6 Fast Flow column in an AKTA Purifer (GE Healthcare, USA). Then cleavage of SUMO-FGF21 fusion protein was by SUMO protease overnight. Finally FGF-21 was again purified by a Ni Sepharose 6 Fast Flow column in an AKTA Purifer. The purified protein was stored at −80°C until use. 2.3. Chronic pancreatitis model Male C57BL/6 mice (8 weeks old) were used in this study. Experimental CP (eCP) was induced as previously described [19]. Mice were randomly divided into 5 groups (Control; FGF-21 (2mg/kg); Larginine; L-arginine + low-dose FGF-21; L-arginine + high-dose FGF21; each group contains 25 mice). FGF-21 was intraperitoneally administrated to mice daily from the 3rd week to the 7th week. The doses of FGF-21 in low-dose and high-dose groups were 1mg/kg and 2mg/kg, respectively.
2. Materials and methods 2.1. Reagents Cell cultural reagents including fetal bovine serum and RMPI-1640 were obtained from Invitrogen Corporation (Carlsbad, CA, USA). L-arginine was obtained from Sigma-Aldrich (Shanghai, China). FITC conjugated anti-mouse CD45 antibody, PE conjugated anti-mouse F4/80 antibody, PerCP/Cy5.5 conjugated anti-mouse CD206 antibody, FITC conjugated anti-human CD14 antibody, PE conjugated anti-human CD68 antibody and PerCP/Cy5.5 conjugated anti-human CD206 antibody were purchased from BioLegend (CA, USA). APC conjugated antiiNOS antibody was purchased from Bioss (Beijing, China).
2.4. Glucose tolerance test At the 0th, 3rd and 7th week, intraperitoneal glucose tolerance test (IPGTT) was examined in all group mice. Mice were fasted for 12h and administrated with D-glucose (2g/kg body weight). Blood concentrations were measured at 0, 30, 60 and 120 min.
2.2. Preparation of FGF-21
2.5. Serum amylase activity, MPO activity and MDA
The purification of FGF-21 was preformed as previously described [18]. The recombinant pSUMO vector containing the murine FGF-21 was transformed into host bacterium, Rosetta (DE3). Single colonies of
Serum amylase activity was quantified using 4,6-ethylidene-(G7)1,4-nitrophenyl-(G1)-α-D-maltoheptaoside as substrate, as previously
2
Experimental Cell Research xxx (xxxx) xxx–xxx
N. Wang, et al.
Fig. 2. FGF-21 improves L-arginine induced CP in mice. A. Injection scheme used to induce chronic pancreatitis (CP). B. Percent survival of all group mice. C. Body weight of all group mice. D. Concentrations of blood glucose were measured in all group mice. E-G. Glucose tolerance test was measured in all group mice at 0, 3rd and 7th week. H-J. AUC value for OGTT. K. Serum amylase activity was measured in all group mice. L. Pancreas MPO activity was measured in all group mice. M. MDA level was measured in all group mice. All data represent mean ± SEM, n= 25 per group, *p < 0.05; **p < 0.01.
3
Experimental Cell Research xxx (xxxx) xxx–xxx
N. Wang, et al.
Fig. 3. FGF-21 ameliorates inflammatory state of CP mice. A. The expressions of CRP, IL-1β, IL-6 and TNF-α were measured in the serum of all groups. B. The expression of IL-1β, IL-6 and TNF-α were measured in the pancreas C. The expression of IL-1β, TNF-α and MCP-1 were measured in the peritoneal macrophages of all groups. All data represent mean ± SEM, n= 25 per group, *p < 0.05; **p < 0.01.
described [20]. Pancreatic MPO activity was measured by previously described [21]. MDA content was detected according to the procedure of MDA kit (Beyotime Institute of Biotechnology, China).
then washed twice with buffer A (Hank’s balanced salt solution +10% fetal calf serum). The tissue was resuspended in buffer A containing 2 mg/mL collagenase type IV (Sigma-Aldrich) and incubated in a shaker at 37°C for 15 min. The suspension was then vortexed at low speed for 20 s and centrifuged, and the cell pellet was resuspended in red blood cell lysing buffer (Sigma-Aldrich) for 5 min. The cells were spun down, washed 3 times with Hank’s balanced salt solution +2% bovine calf serum, and used for surface and intracellular staining.
2.6. Histology Pancreas was fixed in 4% paraformaldehyde, embedded in paraffin, sectioned. Sections were used for hematoxylin and eosin (H&E) and Masson's trichrome collagen staining. Masson's staining was quantified for collagen by analyzing stained area as a percentage of total area with Image J.
2.10. Cell cultures and drug treatments THP-1 cells were cultured in RMPI-1640 (Carlsbad, USA) containing 10% FBS (Carlsbad, USA). We used 50ng/mL Phorbol-12-Myristate13acetate (PMA, Sigma, China) to treat cells for 3days to differentiate into macrophages. Then THP-1 macrophages were cultured in FBS-free medium for 12 h and treated with L-arginine (400μM) or FGF-21 (1μM) for 24h.
2.7. ELISA Serum levels of CRP, IL-1β, TNF-α and IL-6 were measured by ELISA kits (R&D, USA) according to the manufacturer’s instructions. 2.8. Isolation and purification of peritoneal macrophages
2.11. 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2 deoxyglucose (2NBDG) uptake assay
Peritoneal macrophages were obtained according to the methods reported previously [22]. Briefly, the mice were sacrificed and 5 mL of heat-inactivated PBS was injected into the abdominal. Then, the abdomen was massaged gently for 3 min. Drawn back the peritoneal fluid. After centrifugation at 1500 rpm for 10 min, the cell pellets were suspended in DMEM (Life Technologies, USA) (supplemented with 10% (v/v) FBS, 100 U/mL penicillin and 100 U/mL streptomycin), and then allowed to adhere for 3 h at 37 °C in a humidified incubator containing 5% CO2. After 4 h incubation, non-adherent cells were removed by washing twice with PBS and freshly prepared medium was added.
THP-1 macrophages were incubated with 10mM 2-NBDG for 30min. Glucose uptake was detected by flow cytometer (ARIAII, BD, USA). 2.12. Real-time PCR Total RNA from the tissues and cells were isolated with TRIzol (Invitrogen, USA) and converted to cDNA. cDNA templates were amplified using iTaqSYBR Green Supermix (Bio-Rad, USA). Primers were showed as follows: (sequence5′-3′, Forward-Reverse)
2.9. Isolation of pancreatic leukocytes
2.12.1. Mouse IL-1β: GAAATGCCACCTTTTGACAGTG, TGGATGCTCTCATCAGGA CAG.
Pancreatic leukocytes were prepared as previously described [23]. At least five pancreas were pooled together and minced with scissors
4
Experimental Cell Research xxx (xxxx) xxx–xxx
N. Wang, et al.
Fig. 4. The effects of FGF-21 on morphological and histopathological changes of CP mice. A. Representative HE staining of pancreas sections from all group mice. B. Representative Masson's trichrome staining of pancreas sections from all group mice. Scale bar: 100μm. C. Semi-quantitative measurement of pancreas fibrosis in all groups. D and E. The expression of α-SMA and collagen I were measured in all groups. The area density of Masson staining was analyzed by Image pro plus. All data represent mean ± SEM, n= 25 per group, *p < 0.05; **p < 0.01.
IL-6: CTGCAAGAGACTTCCATCCAG, AGTGGTATAGACAGGTCTGT TGG. TNF-α: CAGGCGGTGCCTATGTCTC, CGATCACCCCGAAGTTCAG TAG. MCP-1: CCCACTCACCTGCTGCTACT, TCTGGACCCATTCCTTCTTG. iNOS: ACCTTGTTCAGCTACGCCTT, TCTTCAGAGTCTGCCCATTG. CD206: TGATTACGAGCAGTGGAAGC, GTTCACCGTAAGCCCAA TTT. α-SMA: CTCCCTGGAGAAGAGCTACG, TGACTCCATCCCAATGA AAG. Collagen I: AGAAGGCCAGTCTGGAGAAA, GAGCCCTTGAGACCTC TGAC. β-actin: GAGACCTTCAACACCCC, GTGGTGGTGAAGCTGTAGCC.
β-actin: CTTCTACAATGAGCTGCGTGTG, AGTCATAGTCCGCCTAG AAGC.
2.12.2. Human iNOS: CCTTACGAGGCGAAGAAGGACAG, CAGTTTGAGAGAGGAG GCTCCG. CD206: AAGGCGGTGACCTCACAAG, AAAGTCCAATTCCTCGATG GTG.
2.14. Statistical analysis
2.13. Western blotting Nuclear and cytoplasmic cells proteins were extracted by using the Nuclear and Cytoplasmic Protein Extraction Kit (Beyothme Institute of Biotechnology, China) according to the manufacturer’s instructions. Antibodies including NF-κB p65 (Affinity, USA), Lamin b1 (Affinity, USA), mTOR (Cell Signaling Technology, USA), p-mTOR (Cell Signaling Technology, USA) and β-actin (Cell Signaling Technology, USA) were used in this study.
Data are presented as mean ± SEM and analyzed by one-way ANOVA by using GraphPad Prism 6 software. P value below 0.05 is thought to be statistically significant.
5
Experimental Cell Research xxx (xxxx) xxx–xxx
N. Wang, et al.
(caption on next page)
6
Experimental Cell Research xxx (xxxx) xxx–xxx
N. Wang, et al.
Fig. 5. The effect of FGF-21 on macrophages differentiation. A. The expression of iNOS and CD206 expression in mouse pancreatic macrophages of all group mice. B and C. Percentage of CD206+ and iNOS + cells were measured by flow cytometry in mouse pancreatic macrophages of all group mice. All data represent mean ± SEM, n= 25 per group, *p < 0.05; **p < 0.01. D. The expression of iNOS and CD206 expression in THP-1 macrophages with FGF-21 treatment at 2h, 4h, 8h and 16h. E and F. Percentage of CD206+ and iNOS + cells were measured by flow cytometry in THP-1 macrophages. G. The expression of iNOS and CD206 expression in THP-1 macrophages of all groups. H and I. Percentage of CD206+ and iNOS + cells were measured by flow cytometry in THP-1 macrophages of all groups. The measurements were performed at least three times with similar results. *p < 0.05, **p < 0.01.
3. Results
IL-6 and TNF-α were measured in the serum of all groups, the expression of IL-1β, IL-6 and TNF-α were measured in the pancreas and the expression of IL-1β, TNF-α and MCP-1 were measured in the peritoneal macrophages of all groups. The expressions of these inflammatory factors were not different between control group and single FGF-21 treatment group in the serum, pancreas and peritoneal macrophages. Compared with control group, the results showed that these inflammatory factors were significantly elevated in CP group, but reduced in FGF-21-treated CP group in the serum, pancreas and peritoneal macrophages (Fig. 3A–C). These results demonstrated that FGF-21 improved inflammatory state of CP mice.
3.1. Preparation of FGF-21 15% SDS-PAGE analyzed all eluted fractions (Fig. 1A). Moreover, after 15% SDS-PAGE analysis purified FGF-21 protein, we chose purified FGF-21 protein with the presence of a single band (Fig. 1B) to perform experiments. To determine the activity of purified FGF-21 protein, we performed 2-NBDG uptake assay in 3T3-L1 adipocytes. Our results demonstrated that FGF-21 significantly enhanced glucose uptake of 3T3-L1 adipocytes in a dose-dependent manner (Fig. 1C and D), which confirmed the activity of purified FGF-21 protein.
3.4. FGF-21 ameliorates pancreatic fibrogenesis in CP mice
3.2. FGF-21 improves L-arginine induced CP in mice
To identify morphological and histopathological changes in all group, pancreases of all group mice were stained with H&E and Masson's staining. The results showed that single FGF-21 treatment group showed no difference compared with control group. Compare with control group, CP group mice showed acinar atrophy, loss of the architecture of the pancreas and inflammatory cells infiltration, but these changes were significantly attenuated in FGF-21-treated CP groups (Fig. 4A). Moreover, Masson's staining showed an extensive deposition of collagen in CP mice and treatment of FGF-21 significantly reduced the changes (Fig. 4B and C). Furthermore, α-SMA and collagen I expression were increased significantly in CP group. FGF-21 ameliorated the up-regulation of α-SMA and collagen I (Fig. 4D and E). These results demonstrated that FGF-21 ameliorated pancreatic fibrogenesis in CP mice.
First, we used L-arginine to induce CP in C57BL/6 (Fig. 2A). Our results showed that four mice died at 1st day, one mouse died at 3rd day and two mice died at 8th after administration of L-arginine; one mouse died at 1st day and one mouse died at 10th day after administration of L-arginine and low-dose FGF-21; one mouse died at 3rd day after administration of L-arginine and high-dose FGF-21; no mouse died in both control and single FGF-21 treatment group (Fig. 2B). The results indicate that FGF-21 improves L-arginine treated mice survival number. We also observed body weight of mice in all groups once a week. Our results demonstrated that body weight of mice was increased but had no difference among all groups (Fig. 2C). Blood glucose concentration was monitored in all groups once a week. Compared with control group, the average blood glucose levels of single FGF-21 treatment group was no change, the average blood glucose levels of CP mice were significantly increased, but significantly decreased in FGF-21-treated CP group (Fig. 2D). Furthermore, OGTT was also performed at the 0 week, 3rd week and 7th week during the experimental period. There was not different among all groups at the 0 week (Fig. 2E and H). There was not different between control and single FGF-21 treatment group, compared with CP groups, only high-dose FGF-21 treatment evidently improved glucose tolerance in CP mice at the 3rd week (Fig. 2F and I). There was not different between control and single FGF-21 treatment group, compared with CP groups, FGF-21 treatment significantly improved glucose tolerance in CP mice at the 7th week (Fig. 2G and J). To quantify the severity of chronic pancreatitis, serum amylase activity was measured in all groups. There was not different between control group and single FGF-21 treatment group. Compared with control group, serum amylase activity was markedly increased in CP group but significantly decreased in FGF-21-treated CP group (Fig. 2K). MPO activity and MDA level were also detected in all groups. Compared with control group, the MPO activity and MDA level were no change in single FGF-21 treatment group. But the MPO activity and MDA level were significantly increased in CP group compared with control group and markedly reduced in FGF-21-treated CP group (Fig. 2L and M). These results showed that FGF-21 ameliorated the severity of CP mice.
3.5. FGF-21 regulates macrophages differentiation in mouse pancreatic macrophages of CP mice To explore the effect of FGF-21 on macrophage differentiation, realtime PCR was performed to detect the change of macrophage markers. iNOS as the marker of M1 and CD206 as the marker of M2. In mouse pancreatic macrophages, the expression of the two markers was not different between control group and single FGF-21 treatment group. Both iNOS and CD206 expression were significantly increased in CP group, but markedly decreased in FGF-21-treated CP group (Fig. 5A). Flow cytometry showed the same results (Fig. 5B and C). Our results suggest that FGF-21 ameliorates CP partially via regulating differentiation of macrophages. 3.6. FGF-21 regulates macrophages differentiation in THP-1 macrophages To confirm the effects of FGF-21 on macrophages differentiation, we treated THP-1 macrophages with L-arginine or FGF-21. After FGF-21 treated THP-1 macrophages for 2h, 4h, 8h and 16h, the expression of iNOS and CD206 were no difference compared with control group (Fig. 5D). Flow cytometry showed the same results (Fig. 5E and F). Larginine treatment significantly increased both iNOS and CD206 expression, but only CD206 expression not iNOS expression was markedly decreased in FGF-21-treated L-arginine group (Fig. 5G). Flow cytometry showed the same results (Fig. 5H and I). These results indicate that FGF-
3.3. FGF-21 ameliorates inflammatory state of CP mice To examine inflammatory state in CP mice, the levels of CRP, IL-1β,
7
Experimental Cell Research xxx (xxxx) xxx–xxx
N. Wang, et al.
21 can regulate differentiation of macrophages. 3.7. The effect of FGF-21 on NF-κB signaling pathway in THP-1 macrophages We also investigated the effect of FGF-21 on NF-κB signaling pathway in THP-1 macrophages. Our results showed that FGF-21 significantly inhibited transportation of NF-κB p65 into the nucleus (Fig. 6A and B). Our result showed that FGF-21 improved inflammatory state in L-arginine treated THP-1 macrophages. 3.8. The effect of FGF-21 on m-TOR signaling pathway in THP-1 macrophages To determine the mechanism that FGF-21 regulates macrophages differentiation, we detected m-TOR signaling pathway in THP-1 macrophages. Our results showed that L-arginine significantly inhibited mTOR signaling pathway, but FGF-21 markedly activated this effect in THP-1 macrophages (Fig. 7A). To further explore the effect of m-TOR signaling pathway on THP-1 macrophages, we treated cells with m-TOR inhibitor. iNOS expression was unchanged but the effect of FGF-21 on reducing CD206 expression in L-arginine treated THP-1 macrophages was abolished by m-TOR inhibitor (Fig. 7B). Our results showed that FGF-21 regulated macrophages differentiation via m-TOR signaling pathway. 4. Discussion Due to the significant life quality changing processes that affect patients with CP, it is imperative that more effective treatments are needed to be developed. In the present study, our data indicates an improvement in the metabolic disorders, inflammatory and oxidative stress in the FGF-21 treated L-arginine induced CP mice as evidenced by improvement in glucose homeostasis and the lowered levels of blood glucose, MDA and MPO. Although this animal model we chose may not fully resemble clinical human CP, these results suggest that FGF-21 may be a therapeutic candidate in CP patients. It is accepted that fibrosis is a prominent feature of CP and the pancreatic fibrogenesis is irreversible [24,25]. Thus, this study focused on the inhibitory effect of FGF-21 on development of pancreatic fibrogenesis. Our results showed that, repetitive administration of FGF21 significantly reduced the extensive deposition of collagen in CP animal model. Moreover, compared to the CP animal model, FGF-21 reduced the up-regulation of α-SMA and collagen I, which means that FGF-21 has an obvious effect on ameliorating pancreatic fibrogenesis. Past studies demonstrate that pancreatic stellate cells (PSCs) act as a key role in CP related pancreatic fibrogenesis [26], however, the role of activated innate immune cells, especially macrophages, are indispensable in the progression of pancreatic fibrogenesis [27]. Macrophages act an important role in regulating homeostasis in all organs of the whole body. Once these cells become abnormal activity that will cause serious diseases. Shi et al. [27] show that fibrogenesis occurs simultaneously with macrophage infiltration and that macrophages can regulate key features of fibrogenesis. Our previous studies demonstrate FGF-21 has potent anti-inflammation effect [28,29], and macrophages are important target cells for its bioactivity. In accordance with past results, FGF-21 significantly reduces the expression of inflammatory factors in the serum, pancreas and peritoneal macrophages of CP mice via inhibiting NF-κB signaling pathway. This phenomenon can be also replicated in vivo experiments. Macrophages are special innate immune cells which display high degrees of plasticity and heterogeneity. Based on Siamon Gordon’s scheme, Macrophages are divided into two major types: classically
Fig. 5. (continued)
8
Experimental Cell Research xxx (xxxx) xxx–xxx
N. Wang, et al.
Fig. 6. The effect of FGF-21 on NF-κB signaling pathway in THP-1 macrophages. A. Western blot analysis for NF-κB p65 in the nuclear and cytoplasmic extracts of THP-1 macrophages in all groups. B. The relative optical density value was analyzed by Image pro plus in all groups. The measurements were performed at least three times with similar results. *p < 0.05, **p < 0.01.
activated macrophages (M1) and alternatively activated macrophages (M2). Alternatively activated macrophages play key roles in fibrosis [30]. Jing et al. found that alternatively activated macrophages exacerbate pancreatic fibrosis in chronic pancreatitis [8]. To date, it is not clear whether FGF-21 is crucial for M1/M2 polarization. Thus, we analyzed genetic markers of macrophage activation. In the present study, M1 type macrophages were identified with CD45, F4/80, iNOS (mouse) and CD14, CD68, iNOS (human); M2 type macrophages identified with CD45, F4/80, CD206 (mouse) and CD14, CD68, CD206 (human) [31]. In animal CP model, the iNOS and CD206 expression in macrophages of the pancreas were significantly increased in CP group, but markedly decreased with FGF-21 treatment, which means that FGF21 may regulate macrophages differentiation in L-arginine induced CP mice. To further confirm this result, THP-1 cells were used as a human macrophages model, similar to animal experiment results, only L-arginine induced CD206 expression were decreased with FGF-21 treatment. Interestingly, FGF-21 did not show any effects on both iNOS and CD206 expression without L-arginine treatment, which means that FGF-21 has different biological effects on activated macrophages and rested macrophages. Further researches are needed to explore the mechanism of this phenomenon. Otherwise, it is currently accepted that M1 and M2 phenotypes describe only extreme states towards which macrophages can be well activated. Whether FGF-21 treatment can lead to some additional states which are distinct from both M1 and M2 or that simultaneously exhibit characteristics of M1 and M2 polarization are worth to be further studied. mTOR is a serine/threonine kinase and belongs to the phosphatidylinositol 3-kinase-related kinase protein family [32]. Evidence indicates that mTOR signaling pathway plays an important role in cell differentiation [33]. Furthermore, Byles et al. demonstrated that mTOR can attenuate macrophage M2 polarization [34]. In addition, many studies have identified the synergistic action between FGF-21 and mTOR [35–38]. Therefore, we investigate the effect of FGF-21 on mTOR signaling pathway in L-arginine treated THP-1 macrophages. Our results showed that m-TOR signaling pathway was significantly inhibited by L-arginine, but FGF-21 markedly activated this effect in THP1 macrophages. We further treated cells with m-TOR inhibitor. iNOS
expression was unchanged but the effect of FGF-21 on reducing CD206 expression in L-arginine treated THP-1 macrophages was abolished by m-TOR inhibitor. Our results suggest that FGF-21 regulates macrophages differentiation via m-TOR signaling pathway. Although the present study clearly demonstrates that FGF-21 can alleviate chronic pancreatitis, it is surprising that the researchers found that serum levels of FGF-21 were significantly higher in patients with acute pancreatitis than in healthy people [39]. Similarly, Karim et al. also found that circulating levels of FGF21 were increased in patients presenting with sepsis and SIRS [40]. However, these results do not indicate that these inflammatory diseases are caused by “FGF21 resistance”. Conversely, Feingold et al. found that increased serum FGF21 levels act an important role in protecting animals from toxicity [41]. Based on these results, we speculate that the increase in serum FGF21 during inflammatory diseases may be a protective response. In conclusion, we have identified a novel protective function for FGF-21 in CP. FGF-21 shows pleiotropic beneficial effects during the pathophysiological process of CP (Fig. 7C). FGF-21 ameliorates CP through improving pancreatic architecture, inflammatory stress, oxidative stress and pancreatic fibrogenesis due to regulating macrophages differentiation via mTOR signaling pathway. Our study provides evidence that FGF-21 may be a novel drug for the treatment of CP. Compliance with ethical standards Disclosure of potential conflicts of interest The authors declare no conflicts of interest. Research involving human participants and/or animals All procedures performed in studies involving mice were carried out in strict accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health and were approved by Harbin Veterinary Research Institute Animal Care and Use Committee.
9
Experimental Cell Research xxx (xxxx) xxx–xxx
N. Wang, et al.
Fig. 7. The effect of FGF-21 on m-TOR signaling pathway in THP-1 macrophages. A. Western blot and relative optical density value for m-TOR were measured in THP-1 macrophages of all groups. B. The expression of iNOS and CD206 expression in THP-1 macrophages with m-TOR inhibitor treatment were measured in all groups. C. Summary of the effects of FGF-21 on CP. The measurements were performed at least three times with similar results. *p < 0.05, **p < 0.01.
Informed consent Informed consent was obtained from all individual participants included in the study.
[5]
Acknowledgment
[7]
[6]
[8]
This study was funded by The Natural Science Foundation of Heilongjiang Province of China (C2017023).
[9] [10]
References
[11]
[1] Kl, G. ppel, B. Maillet, Development of chronic pancreatitis from acute pancreatitis: a pathogenetic concept, Zentralblatt fur Chirurgie 120 (4) (1995) 274–277. [2] G. Klöppel, Chronic pancreatitis, pseudotumors and other tumor-like lesions [J], Modern Pathology An Official Journal of the United States & Canadian Academy of Pathology Inc 20 (Suppl 1) (2007) S113–S131 1, supplement. [3] H. Sarles, Etiopathogenesis and definition of chronic pancreatitis [J], Dig. Dis. Sci. 31 (9) (1986) 91S–107S. [4] P. Mews, P. Phillips, R. Fahmy, et al., Pancreatic stellate cells respond to
[12] [13] [14]
10
inflammatory cytokines: potential role in chronic pancreatitis [J], Gut 50 (4) (2002) 535–541. J.M. Braganza, S.H. Lee, R.F. Mccloy, et al., Chronic Pancreatitis [M], World Scientific, 1999. G. Klöppel, S. Detlefsen, B. Feyerabend, Fibrosis of the pancreas: the initial tissue damage and the resulting pattern [J], Virchows Arch. 445 (1) (2004) 1–8. T.A. Wynn, L. Barron, Macrophages: master regulators of inflammation and fibrosis [J], Semin. Liver Dis. 30 (3) (2010) 245–257. J. Xue, Alternatively activated macrophages promote pancreatic fibrosis in chronic pancreatitis [J], Nat. Commun. 6 (2015) 7158. T. Nishimura, Y. Nakatake, M. Konishi, et al., BBA - Gene Structure and Expression 1492 (1) (2000) 203–206. C.L. Johnson, J.Y. Weston, S.A. Chadi, et al., Fibroblast growth factor 21 reduces the severity of cerulein-induced pancreatitis in mice [J], Gastroenterology 137 (5) (2009) 1795–1804. R. Goetz, A. Beenken, O.A. Ibrahimi, et al., Molecular insights into the klotho-dependent, endocrine mode of action of fibroblast growth factor 19 subfamily members [J], Mol. Cell. Biol. 27 (9) (2007) 3417–3428. N. Itoh, D.M. Ornitz, Functional evolutionary history of the mouse Fgf gene family [J], Dev. Dynam. 237 (1) (2008) 18–27. W.F. Wang, S.M. Li, G.P. Ren, et al., Recombinant murine fibroblast growth factor 21 ameliorates obesity-related inflammation in monosodium glutamate-induced obesity rats [J], Endocrine 49 (1) (2015) 119–129. N. Wang, T.Y. Xu, X. Zhang, et al., Improving hyperglycemic effect of FGF-21 is
Experimental Cell Research xxx (xxxx) xxx–xxx
N. Wang, et al.
[15] [16] [17] [18] [19] [20]
[21] [22] [23] [24] [25] [26] [27]
associated with alleviating inflammatory state in diabetes [J], Int. Immunopharmacol. 56 (2018) 301–309. Z. Lin, X. Pan, W. Fan, et al., Fibroblast growth factor 21 prevents atherosclerosis by suppression of hepatic sterol regulatory element-binding protein-2 and induction of adiponectin in mice [J], Circulation 131 (21) (2015) 1861. Y. Yu, J. He, S. Li, et al., Fibroblast growth factor 21 (FGF21) inhibits macrophagemediated inflammation by activating Nrf2 and suppressing the NF-κB signaling pathway [J], Int. Immunopharmacol. 38 (2016) 144–152. P. Xu, Y. Zhang, Y. Liu, et al., Fibroblast growth factor 21 attenuates hepatic fibrogenesis through TGF-β/smad2/3 and NF-κB signaling pathways [J], Toxicol. Appl. Pharmacol. 290 (2016) 43. P. Xu, Y. Zhang, L. Song, et al., Efficacy of a combination of high and low dosage of PEGylated FGF-21 in treatment of diabetes in db/db mice [J], Biomed. Pharmacother. 84 (2016) 97–105. Y. Sun, G. Xing, J. Bai, et al., A new mouse model of chronic pancreatitis in C57BL/ 6J strain that mimics the human pathology [J], Pancreas 43 (1) (2014) 148–150. D.K.- Jarres J, C. Kaiser, J.C. M Hafkenscheid, et al., Evaluation of a new α-amylase assay using 4,6-ethylidene-(G 7 )-1,4-nitrophenyl-(G 1 )-α-D-maltoheptaoside as substrate [J], Journal of Clinical Chemistry & Clinical Biochemistry 27 (2) (1989) 103–113. R. Dawra, Y.S. Ku, R. Sharif, et al., An improved method for extracting myeloperoxidase and determining its activity in the pancreas and lungs during pancreatitis [J], Pancreas 37 (1) (2008) 62. Z. Liu, J. Xing, Y. Huang, et al., Activation effect of Ganoderma lucidum polysaccharides liposomes on murine peritoneal macrophages [J], International Journal of Biological Macromolecules 82 (2015) 973. X. Jing, D.T.C. Nguyen, H. Aida, Aryl hydrocarbon receptor regulates pancreatic IL22 production and protects mice from acute pancreatitis [J], Gastroenterology 143 (6) (2012) 1670–1680. J. Xue, V. Sharma, M.H. Hsieh, et al., Alternatively activated macrophages promote pancreatic fibrosis in chronic pancreatitis[J], Nature Communications 6 (2015) 7158. G. Klöppel, S. Detlefsen, B. Feyerabend, Fibrosis of the pancreas: the initial tissue damage and the resulting pattern [J], Archiv Für Pathologische Anatomie Und Physiologie Und Für Klinische Medicin 445 (1) (2004) 1–8. J. Tahara, K. Shimizu, K. Shiratori, Engulfment of necrotic acinar cells by pancreatic stellate cells inhibits pancreatic fibrogenesis.[J], Pancreas 37 (1) (2008) 69–74. C. Shi, M.K. Washington, R. Chaturvedi, et al., Fibrogenesis in pancreatic cancer is a dynamic process regulated by macrophage–stellate cell interaction[J], Laboratory
Investigation 94 (4) (2014) 409–421. [28] W.F. Wang, S.M. Li, G.P. Ren, et al., Recombinant murine fibroblast growth factor 21 ameliorates obesity-related inflammation in monosodium glutamate-induced obesity rats [J], Endocrine 49 (1) (2015) 119–129. [29] Y. Yu, J. He, S. Li, et al., Fibroblast growth factor 21 (FGF21) inhibits macrophagemediated inflammation by activating Nrf2 and suppressing the NF-κB signaling pathway [J], International Immunopharmacology 38 (2016) 144–152. [30] S. Gordon, Alternative activation of macrophages [J], Nature Reviews Immunology 3 (1) (2003) 23–35. [31] T. Veremeyko, S. Siddiqui, I. Sotnikov, et al., miR-124 Inhibitor Decreased Expression of M2 Markers CD206 and Ym-1 and Increased Expression of M1 Markers CD86, iNOS, TNF, and miR-155 in the In-Vitro Polarized M2 Macrophages [J], (2013). [32] E.J. Brown, M.W. Albers, T. Bum Shin, et al., A mammalian protein targeted by G1arresting rapamycin–receptor complex [J], Nature (London) 369 (6483) (1994) 756–758. [33] J. Huang, B.D. Manning, The TSC1–TSC2 complex: a molecular switchboard controlling cell growth [J], Biochemical Journal 412 (2) (2008) 179–190. [34] V. Byles, A.J. Covarrubias, I. Ben-Sahra, et al., The TSC-mTOR pathway regulates macrophage polarization [J], Nature communications 4 (4) (2013) 2834. [35] M. Cornu, W. Oppliger, V. Albert, et al., Hepatic mTORC1 controls locomotor activity, body temperature, and lipid metabolism through FGF21 [J], Proceedings of the National Academy of Sciences of the United States of America 111 (32) (2014) 11592. [36] Q. Gong, F. Zhang, J. Gao, et al., mTOR mediates metabolic effects of FGF21 on insulin sensitivity in mice [J], Diabetes (2014) 63. A25-A. [37] A.Y. Minard, S.X. Tan, P. Yang, et al., mTORC1 is a major regulatory node in the FGF21 signaling network in adipocytes [J], Cell Reports 17 (1) (2016) 29–36. [38] M. Guridi, L.A. Tintignac, S. Lin, et al., Activation of mTORC1 in skeletal muscle regulates whole-body metabolism through FGF21 [J], Science Signaling 8 (402) (2015) ra113. [39] V.K. Shenoy, K.M. Beaver, F.M. Fisher, et al., Elevated serum fibroblast growth factor 21 in humans with acute pancreatitis[J], PLoS ONE 11 (11) (2016) e0164351. [40] G. Karim, D. Geneviève, D.S. Irène, et al., Increased FGF21 plasma levels in humans with sepsis and SIRS[J], Endocrine Connections 2 (3) (2013) 146–153. [41] K.R. Feingold, C. Grunfeld, J.G. Heuer, et al., FGF21 is increased by inflammatory stimuli and protects leptin-deficient ob/ob mice from the toxicity of sepsis[J], Endocrinology 153 (6) (2012) 2689–2700.
11
Contents lists available at ScienceDirect
Experimental Cell Research journal homepage: www.elsevier.com/locate/yexcr
Fibroblast growth factor 21 ameliorates pancreatic fibrogenesis via regulating polarization of macrophages Nan Wanga, Ting-ting Zhaoc,f, Si-ming Lid, Yan-hua Lie, Yu-jia Wanga, De-shan Lia,**, Wen-fei Wanga,b,* a
Northeast Agricultural University, School of Life Science, Harbin, China Harbin Veterinary Research Institute, Harbin, China c Central South University, Aier School of Ophthalmology, Changsha, China d Harbin University of Commerce, Harbin, China e Northeast Agricultural University, School of Veterinary Medicine, Harbin, China f Aier Eye Hospital Group, Harbin,China b
ARTICLE INFO
ABSTRACT
Keywords: FGF-21 Chronic pancreatitis Pancreatic fibrogenesis Macrophage differentiation
Chronic pancreatitis (CP) is a progressive, irreversible inflammatory and fibrotic disease. The characteristics of this disease are progressive inflammation, acinar atrophy and fibrosis. Numerous factors are involved in CP such as inflammation, and oxidative stress. Recently, it has been noted that fibroblast growth factor 21 (FGF-21) reduced the severity of acute pancreatitis in mice. However, whether FGF-21 has effects on CP remains unclear. Thus, the present study was undertaken to detect the effects of FGF-21 on L-arginine induced chronic pancreatitis/islet fibrosis in mice. We used L-arginine to create a CP model in C57BL/6 mice and treated these mice with FGF-21. Compared to normal mice, blood glucose and intra-peritoneal glucose tolerance test (IPGTT) revealed significant impairment in CP animal model. CP mice also had acinar atrophy, loss of pancreas morphology, inflammatory cells infiltration, extensive deposition of collagen, elevated < alpha > -SMA expression, collagen I expression, serum amylase activity, MPO activity and MDA level. All these pathological changes were significantly improved by FGF-21 treatment. Moreover, FGF-21 ameliorated inflammatory state in the serum, pancreas and peritoneal macrophages of CP mice. Furthermore, we also found that FGF-21 could regulate differentiation of macrophages so as to improve pancreatic fibrogenesis in CP mice. Taken together, our study identifies the beneficial role of FGF-21 in CP and suggests that FGF-21 improves pancreatic fibrogenesis in CP via the mTOR pathway.
1. Introduction Chronic pancreatitis (CP) is characterized by progressive and irreversible damage to the pancreas, finally leading to both exocrine and endocrine insufficiency [1]. Pancreatic damage, pancreatic fibrosis, acinar atrophy, chronic inflammation, and distorted ducts are the fundamental histopathologic features of CP [2,3]. There are many associated participants during initiation and progression of CP, including necro-inflammation, oxidant stress and nitric oxide [4]. The major symptom of CP is often pain, patients have severe abdominal pain and increased blood amylase, lipase, and trypsinogen [5]. A growing epidemic of CP is threatening the health of millions of people around the world, which is also increasing the economic and mental burden of patients. Therefore, developing novel, effective drugs that ameliorate *
development of CP has an essential role in improving the prognosis of patients with CP. Fibrosis is a major character in CP and caused by many factors such as necrosis/apoptosis and inflammation. The excessive formation of extracellular matrix (ECM) eventually results in a loss of architecture of the pancreas and dysfunction of the islets [6]. Recent studies emphasized macrophages as primary regulators of fibrosis [7]. Furthermore, Jing et al. concluded that alternatively activated macrophages could promote pancreatic fibrogenesis in chronic pancreatitis [8]. Fibroblast growth factor 21 (FGF-21) is a metabolic regulator, which is dominantly expressed in the liver [9] and also expressed in other organs such as pancreas [10]. FGF-21 has a potent effect on regulating glucose and lipid metabolism [11,12]. Apart from that, recently it has been found that FGF-21 also has anti-inflammation effects
Corresponding author. School of Life Science, Northeast Agricultural University, Harbin, Heilongjiang Province, 150030, China. Corresponding author. School of Life Science, Northeast Agricultural University, Harbin, Heilongjiang Province, 150030, China. E-mail addresses: [email protected] (D.-s. Li), [email protected] (W.-f. Wang).
**
https://doi.org/10.1016/j.yexcr.2019.06.002 Received 17 November 2018; Received in revised form 3 June 2019; Accepted 4 June 2019 0014-4827/ © 2019 Published by Elsevier Inc.
Please cite this article as: Nan Wang, et al., Experimental Cell Research, https://doi.org/10.1016/j.yexcr.2019.06.002
Experimental Cell Research xxx (xxxx) xxx–xxx
N. Wang, et al.
Fig. 1. Preparation of FGF21. A. SDS-PAGE gel analysis of purified FGF-21.1 protein molecular mass marker; 2 supernatant of FGF21 cell lysates; 3 purified SUMOFGF-21 fusion protein; 4 other proteins; 5 cleavage products of SUMO-FGF-21 with SUMO protease 6 SUMO-tag. B. SDS-PAGE gel analysis of purified FGF-21.1–2 FGF-21; 3 protein molecular mass marker. C and D. Glucose uptake of 3T3-L1 adipocytes after treatment with different concentrations of FGF-21. The measurements were performed at least three times with similar results. *p < 0.05, **p < 0.01 vs control.
in various diseases such as obesity, diabetes and atherosclerosis [13–15]. In addition, FGF-21 can improve inflammatory states in macrophages [16]. More importantly, Xu et al. found that FGF-21 could attenuate hepatic fibrogenesis [17]. Besides, a previous study has demonstrated that FGF-21 can reduce the severity of acute pancreatitis [10]. However, to our knowledge, whether FGF-21 has beneficial effects on CP that remains largely unknown. Intrigued by findings from these, we asked whether FGF-21 also has favorable effects on CP. In this study, we are intended to investigate the effects of FGF-21 on CP. Moreover, we also aim to examine effects of FGF-21 on biological activity of macrophages and its associated mechanisms in CP. This will provide a novel therapeutic target for CP and FGF-21 may become a potential candidate in the clinical treatment of CP.
E. coli Rosetta (containing a recombinant plasmid of pSUMO-FGF21) were grown in LB media containing ampicillin (100 μg/mL). When the OD 600 reached 0.4 to 0.6, IPTG was added into the medium at the final concentration of 0.25 mmol/L. The culture was then grown at 30 °C for 4 h to induce expression of the FGF-21 protein. SUMO-FGF21 fusion protein was purified by a Ni Sepharose 6 Fast Flow column in an AKTA Purifer (GE Healthcare, USA). Then cleavage of SUMO-FGF21 fusion protein was by SUMO protease overnight. Finally FGF-21 was again purified by a Ni Sepharose 6 Fast Flow column in an AKTA Purifer. The purified protein was stored at −80°C until use. 2.3. Chronic pancreatitis model Male C57BL/6 mice (8 weeks old) were used in this study. Experimental CP (eCP) was induced as previously described [19]. Mice were randomly divided into 5 groups (Control; FGF-21 (2mg/kg); Larginine; L-arginine + low-dose FGF-21; L-arginine + high-dose FGF21; each group contains 25 mice). FGF-21 was intraperitoneally administrated to mice daily from the 3rd week to the 7th week. The doses of FGF-21 in low-dose and high-dose groups were 1mg/kg and 2mg/kg, respectively.
2. Materials and methods 2.1. Reagents Cell cultural reagents including fetal bovine serum and RMPI-1640 were obtained from Invitrogen Corporation (Carlsbad, CA, USA). L-arginine was obtained from Sigma-Aldrich (Shanghai, China). FITC conjugated anti-mouse CD45 antibody, PE conjugated anti-mouse F4/80 antibody, PerCP/Cy5.5 conjugated anti-mouse CD206 antibody, FITC conjugated anti-human CD14 antibody, PE conjugated anti-human CD68 antibody and PerCP/Cy5.5 conjugated anti-human CD206 antibody were purchased from BioLegend (CA, USA). APC conjugated antiiNOS antibody was purchased from Bioss (Beijing, China).
2.4. Glucose tolerance test At the 0th, 3rd and 7th week, intraperitoneal glucose tolerance test (IPGTT) was examined in all group mice. Mice were fasted for 12h and administrated with D-glucose (2g/kg body weight). Blood concentrations were measured at 0, 30, 60 and 120 min.
2.2. Preparation of FGF-21
2.5. Serum amylase activity, MPO activity and MDA
The purification of FGF-21 was preformed as previously described [18]. The recombinant pSUMO vector containing the murine FGF-21 was transformed into host bacterium, Rosetta (DE3). Single colonies of
Serum amylase activity was quantified using 4,6-ethylidene-(G7)1,4-nitrophenyl-(G1)-α-D-maltoheptaoside as substrate, as previously
2
Experimental Cell Research xxx (xxxx) xxx–xxx
N. Wang, et al.
Fig. 2. FGF-21 improves L-arginine induced CP in mice. A. Injection scheme used to induce chronic pancreatitis (CP). B. Percent survival of all group mice. C. Body weight of all group mice. D. Concentrations of blood glucose were measured in all group mice. E-G. Glucose tolerance test was measured in all group mice at 0, 3rd and 7th week. H-J. AUC value for OGTT. K. Serum amylase activity was measured in all group mice. L. Pancreas MPO activity was measured in all group mice. M. MDA level was measured in all group mice. All data represent mean ± SEM, n= 25 per group, *p < 0.05; **p < 0.01.
3
Experimental Cell Research xxx (xxxx) xxx–xxx
N. Wang, et al.
Fig. 3. FGF-21 ameliorates inflammatory state of CP mice. A. The expressions of CRP, IL-1β, IL-6 and TNF-α were measured in the serum of all groups. B. The expression of IL-1β, IL-6 and TNF-α were measured in the pancreas C. The expression of IL-1β, TNF-α and MCP-1 were measured in the peritoneal macrophages of all groups. All data represent mean ± SEM, n= 25 per group, *p < 0.05; **p < 0.01.
described [20]. Pancreatic MPO activity was measured by previously described [21]. MDA content was detected according to the procedure of MDA kit (Beyotime Institute of Biotechnology, China).
then washed twice with buffer A (Hank’s balanced salt solution +10% fetal calf serum). The tissue was resuspended in buffer A containing 2 mg/mL collagenase type IV (Sigma-Aldrich) and incubated in a shaker at 37°C for 15 min. The suspension was then vortexed at low speed for 20 s and centrifuged, and the cell pellet was resuspended in red blood cell lysing buffer (Sigma-Aldrich) for 5 min. The cells were spun down, washed 3 times with Hank’s balanced salt solution +2% bovine calf serum, and used for surface and intracellular staining.
2.6. Histology Pancreas was fixed in 4% paraformaldehyde, embedded in paraffin, sectioned. Sections were used for hematoxylin and eosin (H&E) and Masson's trichrome collagen staining. Masson's staining was quantified for collagen by analyzing stained area as a percentage of total area with Image J.
2.10. Cell cultures and drug treatments THP-1 cells were cultured in RMPI-1640 (Carlsbad, USA) containing 10% FBS (Carlsbad, USA). We used 50ng/mL Phorbol-12-Myristate13acetate (PMA, Sigma, China) to treat cells for 3days to differentiate into macrophages. Then THP-1 macrophages were cultured in FBS-free medium for 12 h and treated with L-arginine (400μM) or FGF-21 (1μM) for 24h.
2.7. ELISA Serum levels of CRP, IL-1β, TNF-α and IL-6 were measured by ELISA kits (R&D, USA) according to the manufacturer’s instructions. 2.8. Isolation and purification of peritoneal macrophages
2.11. 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2 deoxyglucose (2NBDG) uptake assay
Peritoneal macrophages were obtained according to the methods reported previously [22]. Briefly, the mice were sacrificed and 5 mL of heat-inactivated PBS was injected into the abdominal. Then, the abdomen was massaged gently for 3 min. Drawn back the peritoneal fluid. After centrifugation at 1500 rpm for 10 min, the cell pellets were suspended in DMEM (Life Technologies, USA) (supplemented with 10% (v/v) FBS, 100 U/mL penicillin and 100 U/mL streptomycin), and then allowed to adhere for 3 h at 37 °C in a humidified incubator containing 5% CO2. After 4 h incubation, non-adherent cells were removed by washing twice with PBS and freshly prepared medium was added.
THP-1 macrophages were incubated with 10mM 2-NBDG for 30min. Glucose uptake was detected by flow cytometer (ARIAII, BD, USA). 2.12. Real-time PCR Total RNA from the tissues and cells were isolated with TRIzol (Invitrogen, USA) and converted to cDNA. cDNA templates were amplified using iTaqSYBR Green Supermix (Bio-Rad, USA). Primers were showed as follows: (sequence5′-3′, Forward-Reverse)
2.9. Isolation of pancreatic leukocytes
2.12.1. Mouse IL-1β: GAAATGCCACCTTTTGACAGTG, TGGATGCTCTCATCAGGA CAG.
Pancreatic leukocytes were prepared as previously described [23]. At least five pancreas were pooled together and minced with scissors
4
Experimental Cell Research xxx (xxxx) xxx–xxx
N. Wang, et al.
Fig. 4. The effects of FGF-21 on morphological and histopathological changes of CP mice. A. Representative HE staining of pancreas sections from all group mice. B. Representative Masson's trichrome staining of pancreas sections from all group mice. Scale bar: 100μm. C. Semi-quantitative measurement of pancreas fibrosis in all groups. D and E. The expression of α-SMA and collagen I were measured in all groups. The area density of Masson staining was analyzed by Image pro plus. All data represent mean ± SEM, n= 25 per group, *p < 0.05; **p < 0.01.
IL-6: CTGCAAGAGACTTCCATCCAG, AGTGGTATAGACAGGTCTGT TGG. TNF-α: CAGGCGGTGCCTATGTCTC, CGATCACCCCGAAGTTCAG TAG. MCP-1: CCCACTCACCTGCTGCTACT, TCTGGACCCATTCCTTCTTG. iNOS: ACCTTGTTCAGCTACGCCTT, TCTTCAGAGTCTGCCCATTG. CD206: TGATTACGAGCAGTGGAAGC, GTTCACCGTAAGCCCAA TTT. α-SMA: CTCCCTGGAGAAGAGCTACG, TGACTCCATCCCAATGA AAG. Collagen I: AGAAGGCCAGTCTGGAGAAA, GAGCCCTTGAGACCTC TGAC. β-actin: GAGACCTTCAACACCCC, GTGGTGGTGAAGCTGTAGCC.
β-actin: CTTCTACAATGAGCTGCGTGTG, AGTCATAGTCCGCCTAG AAGC.
2.12.2. Human iNOS: CCTTACGAGGCGAAGAAGGACAG, CAGTTTGAGAGAGGAG GCTCCG. CD206: AAGGCGGTGACCTCACAAG, AAAGTCCAATTCCTCGATG GTG.
2.14. Statistical analysis
2.13. Western blotting Nuclear and cytoplasmic cells proteins were extracted by using the Nuclear and Cytoplasmic Protein Extraction Kit (Beyothme Institute of Biotechnology, China) according to the manufacturer’s instructions. Antibodies including NF-κB p65 (Affinity, USA), Lamin b1 (Affinity, USA), mTOR (Cell Signaling Technology, USA), p-mTOR (Cell Signaling Technology, USA) and β-actin (Cell Signaling Technology, USA) were used in this study.
Data are presented as mean ± SEM and analyzed by one-way ANOVA by using GraphPad Prism 6 software. P value below 0.05 is thought to be statistically significant.
5
Experimental Cell Research xxx (xxxx) xxx–xxx
N. Wang, et al.
(caption on next page)
6
Experimental Cell Research xxx (xxxx) xxx–xxx
N. Wang, et al.
Fig. 5. The effect of FGF-21 on macrophages differentiation. A. The expression of iNOS and CD206 expression in mouse pancreatic macrophages of all group mice. B and C. Percentage of CD206+ and iNOS + cells were measured by flow cytometry in mouse pancreatic macrophages of all group mice. All data represent mean ± SEM, n= 25 per group, *p < 0.05; **p < 0.01. D. The expression of iNOS and CD206 expression in THP-1 macrophages with FGF-21 treatment at 2h, 4h, 8h and 16h. E and F. Percentage of CD206+ and iNOS + cells were measured by flow cytometry in THP-1 macrophages. G. The expression of iNOS and CD206 expression in THP-1 macrophages of all groups. H and I. Percentage of CD206+ and iNOS + cells were measured by flow cytometry in THP-1 macrophages of all groups. The measurements were performed at least three times with similar results. *p < 0.05, **p < 0.01.
3. Results
IL-6 and TNF-α were measured in the serum of all groups, the expression of IL-1β, IL-6 and TNF-α were measured in the pancreas and the expression of IL-1β, TNF-α and MCP-1 were measured in the peritoneal macrophages of all groups. The expressions of these inflammatory factors were not different between control group and single FGF-21 treatment group in the serum, pancreas and peritoneal macrophages. Compared with control group, the results showed that these inflammatory factors were significantly elevated in CP group, but reduced in FGF-21-treated CP group in the serum, pancreas and peritoneal macrophages (Fig. 3A–C). These results demonstrated that FGF-21 improved inflammatory state of CP mice.
3.1. Preparation of FGF-21 15% SDS-PAGE analyzed all eluted fractions (Fig. 1A). Moreover, after 15% SDS-PAGE analysis purified FGF-21 protein, we chose purified FGF-21 protein with the presence of a single band (Fig. 1B) to perform experiments. To determine the activity of purified FGF-21 protein, we performed 2-NBDG uptake assay in 3T3-L1 adipocytes. Our results demonstrated that FGF-21 significantly enhanced glucose uptake of 3T3-L1 adipocytes in a dose-dependent manner (Fig. 1C and D), which confirmed the activity of purified FGF-21 protein.
3.4. FGF-21 ameliorates pancreatic fibrogenesis in CP mice
3.2. FGF-21 improves L-arginine induced CP in mice
To identify morphological and histopathological changes in all group, pancreases of all group mice were stained with H&E and Masson's staining. The results showed that single FGF-21 treatment group showed no difference compared with control group. Compare with control group, CP group mice showed acinar atrophy, loss of the architecture of the pancreas and inflammatory cells infiltration, but these changes were significantly attenuated in FGF-21-treated CP groups (Fig. 4A). Moreover, Masson's staining showed an extensive deposition of collagen in CP mice and treatment of FGF-21 significantly reduced the changes (Fig. 4B and C). Furthermore, α-SMA and collagen I expression were increased significantly in CP group. FGF-21 ameliorated the up-regulation of α-SMA and collagen I (Fig. 4D and E). These results demonstrated that FGF-21 ameliorated pancreatic fibrogenesis in CP mice.
First, we used L-arginine to induce CP in C57BL/6 (Fig. 2A). Our results showed that four mice died at 1st day, one mouse died at 3rd day and two mice died at 8th after administration of L-arginine; one mouse died at 1st day and one mouse died at 10th day after administration of L-arginine and low-dose FGF-21; one mouse died at 3rd day after administration of L-arginine and high-dose FGF-21; no mouse died in both control and single FGF-21 treatment group (Fig. 2B). The results indicate that FGF-21 improves L-arginine treated mice survival number. We also observed body weight of mice in all groups once a week. Our results demonstrated that body weight of mice was increased but had no difference among all groups (Fig. 2C). Blood glucose concentration was monitored in all groups once a week. Compared with control group, the average blood glucose levels of single FGF-21 treatment group was no change, the average blood glucose levels of CP mice were significantly increased, but significantly decreased in FGF-21-treated CP group (Fig. 2D). Furthermore, OGTT was also performed at the 0 week, 3rd week and 7th week during the experimental period. There was not different among all groups at the 0 week (Fig. 2E and H). There was not different between control and single FGF-21 treatment group, compared with CP groups, only high-dose FGF-21 treatment evidently improved glucose tolerance in CP mice at the 3rd week (Fig. 2F and I). There was not different between control and single FGF-21 treatment group, compared with CP groups, FGF-21 treatment significantly improved glucose tolerance in CP mice at the 7th week (Fig. 2G and J). To quantify the severity of chronic pancreatitis, serum amylase activity was measured in all groups. There was not different between control group and single FGF-21 treatment group. Compared with control group, serum amylase activity was markedly increased in CP group but significantly decreased in FGF-21-treated CP group (Fig. 2K). MPO activity and MDA level were also detected in all groups. Compared with control group, the MPO activity and MDA level were no change in single FGF-21 treatment group. But the MPO activity and MDA level were significantly increased in CP group compared with control group and markedly reduced in FGF-21-treated CP group (Fig. 2L and M). These results showed that FGF-21 ameliorated the severity of CP mice.
3.5. FGF-21 regulates macrophages differentiation in mouse pancreatic macrophages of CP mice To explore the effect of FGF-21 on macrophage differentiation, realtime PCR was performed to detect the change of macrophage markers. iNOS as the marker of M1 and CD206 as the marker of M2. In mouse pancreatic macrophages, the expression of the two markers was not different between control group and single FGF-21 treatment group. Both iNOS and CD206 expression were significantly increased in CP group, but markedly decreased in FGF-21-treated CP group (Fig. 5A). Flow cytometry showed the same results (Fig. 5B and C). Our results suggest that FGF-21 ameliorates CP partially via regulating differentiation of macrophages. 3.6. FGF-21 regulates macrophages differentiation in THP-1 macrophages To confirm the effects of FGF-21 on macrophages differentiation, we treated THP-1 macrophages with L-arginine or FGF-21. After FGF-21 treated THP-1 macrophages for 2h, 4h, 8h and 16h, the expression of iNOS and CD206 were no difference compared with control group (Fig. 5D). Flow cytometry showed the same results (Fig. 5E and F). Larginine treatment significantly increased both iNOS and CD206 expression, but only CD206 expression not iNOS expression was markedly decreased in FGF-21-treated L-arginine group (Fig. 5G). Flow cytometry showed the same results (Fig. 5H and I). These results indicate that FGF-
3.3. FGF-21 ameliorates inflammatory state of CP mice To examine inflammatory state in CP mice, the levels of CRP, IL-1β,
7
Experimental Cell Research xxx (xxxx) xxx–xxx
N. Wang, et al.
21 can regulate differentiation of macrophages. 3.7. The effect of FGF-21 on NF-κB signaling pathway in THP-1 macrophages We also investigated the effect of FGF-21 on NF-κB signaling pathway in THP-1 macrophages. Our results showed that FGF-21 significantly inhibited transportation of NF-κB p65 into the nucleus (Fig. 6A and B). Our result showed that FGF-21 improved inflammatory state in L-arginine treated THP-1 macrophages. 3.8. The effect of FGF-21 on m-TOR signaling pathway in THP-1 macrophages To determine the mechanism that FGF-21 regulates macrophages differentiation, we detected m-TOR signaling pathway in THP-1 macrophages. Our results showed that L-arginine significantly inhibited mTOR signaling pathway, but FGF-21 markedly activated this effect in THP-1 macrophages (Fig. 7A). To further explore the effect of m-TOR signaling pathway on THP-1 macrophages, we treated cells with m-TOR inhibitor. iNOS expression was unchanged but the effect of FGF-21 on reducing CD206 expression in L-arginine treated THP-1 macrophages was abolished by m-TOR inhibitor (Fig. 7B). Our results showed that FGF-21 regulated macrophages differentiation via m-TOR signaling pathway. 4. Discussion Due to the significant life quality changing processes that affect patients with CP, it is imperative that more effective treatments are needed to be developed. In the present study, our data indicates an improvement in the metabolic disorders, inflammatory and oxidative stress in the FGF-21 treated L-arginine induced CP mice as evidenced by improvement in glucose homeostasis and the lowered levels of blood glucose, MDA and MPO. Although this animal model we chose may not fully resemble clinical human CP, these results suggest that FGF-21 may be a therapeutic candidate in CP patients. It is accepted that fibrosis is a prominent feature of CP and the pancreatic fibrogenesis is irreversible [24,25]. Thus, this study focused on the inhibitory effect of FGF-21 on development of pancreatic fibrogenesis. Our results showed that, repetitive administration of FGF21 significantly reduced the extensive deposition of collagen in CP animal model. Moreover, compared to the CP animal model, FGF-21 reduced the up-regulation of α-SMA and collagen I, which means that FGF-21 has an obvious effect on ameliorating pancreatic fibrogenesis. Past studies demonstrate that pancreatic stellate cells (PSCs) act as a key role in CP related pancreatic fibrogenesis [26], however, the role of activated innate immune cells, especially macrophages, are indispensable in the progression of pancreatic fibrogenesis [27]. Macrophages act an important role in regulating homeostasis in all organs of the whole body. Once these cells become abnormal activity that will cause serious diseases. Shi et al. [27] show that fibrogenesis occurs simultaneously with macrophage infiltration and that macrophages can regulate key features of fibrogenesis. Our previous studies demonstrate FGF-21 has potent anti-inflammation effect [28,29], and macrophages are important target cells for its bioactivity. In accordance with past results, FGF-21 significantly reduces the expression of inflammatory factors in the serum, pancreas and peritoneal macrophages of CP mice via inhibiting NF-κB signaling pathway. This phenomenon can be also replicated in vivo experiments. Macrophages are special innate immune cells which display high degrees of plasticity and heterogeneity. Based on Siamon Gordon’s scheme, Macrophages are divided into two major types: classically
Fig. 5. (continued)
8
Experimental Cell Research xxx (xxxx) xxx–xxx
N. Wang, et al.
Fig. 6. The effect of FGF-21 on NF-κB signaling pathway in THP-1 macrophages. A. Western blot analysis for NF-κB p65 in the nuclear and cytoplasmic extracts of THP-1 macrophages in all groups. B. The relative optical density value was analyzed by Image pro plus in all groups. The measurements were performed at least three times with similar results. *p < 0.05, **p < 0.01.
activated macrophages (M1) and alternatively activated macrophages (M2). Alternatively activated macrophages play key roles in fibrosis [30]. Jing et al. found that alternatively activated macrophages exacerbate pancreatic fibrosis in chronic pancreatitis [8]. To date, it is not clear whether FGF-21 is crucial for M1/M2 polarization. Thus, we analyzed genetic markers of macrophage activation. In the present study, M1 type macrophages were identified with CD45, F4/80, iNOS (mouse) and CD14, CD68, iNOS (human); M2 type macrophages identified with CD45, F4/80, CD206 (mouse) and CD14, CD68, CD206 (human) [31]. In animal CP model, the iNOS and CD206 expression in macrophages of the pancreas were significantly increased in CP group, but markedly decreased with FGF-21 treatment, which means that FGF21 may regulate macrophages differentiation in L-arginine induced CP mice. To further confirm this result, THP-1 cells were used as a human macrophages model, similar to animal experiment results, only L-arginine induced CD206 expression were decreased with FGF-21 treatment. Interestingly, FGF-21 did not show any effects on both iNOS and CD206 expression without L-arginine treatment, which means that FGF-21 has different biological effects on activated macrophages and rested macrophages. Further researches are needed to explore the mechanism of this phenomenon. Otherwise, it is currently accepted that M1 and M2 phenotypes describe only extreme states towards which macrophages can be well activated. Whether FGF-21 treatment can lead to some additional states which are distinct from both M1 and M2 or that simultaneously exhibit characteristics of M1 and M2 polarization are worth to be further studied. mTOR is a serine/threonine kinase and belongs to the phosphatidylinositol 3-kinase-related kinase protein family [32]. Evidence indicates that mTOR signaling pathway plays an important role in cell differentiation [33]. Furthermore, Byles et al. demonstrated that mTOR can attenuate macrophage M2 polarization [34]. In addition, many studies have identified the synergistic action between FGF-21 and mTOR [35–38]. Therefore, we investigate the effect of FGF-21 on mTOR signaling pathway in L-arginine treated THP-1 macrophages. Our results showed that m-TOR signaling pathway was significantly inhibited by L-arginine, but FGF-21 markedly activated this effect in THP1 macrophages. We further treated cells with m-TOR inhibitor. iNOS
expression was unchanged but the effect of FGF-21 on reducing CD206 expression in L-arginine treated THP-1 macrophages was abolished by m-TOR inhibitor. Our results suggest that FGF-21 regulates macrophages differentiation via m-TOR signaling pathway. Although the present study clearly demonstrates that FGF-21 can alleviate chronic pancreatitis, it is surprising that the researchers found that serum levels of FGF-21 were significantly higher in patients with acute pancreatitis than in healthy people [39]. Similarly, Karim et al. also found that circulating levels of FGF21 were increased in patients presenting with sepsis and SIRS [40]. However, these results do not indicate that these inflammatory diseases are caused by “FGF21 resistance”. Conversely, Feingold et al. found that increased serum FGF21 levels act an important role in protecting animals from toxicity [41]. Based on these results, we speculate that the increase in serum FGF21 during inflammatory diseases may be a protective response. In conclusion, we have identified a novel protective function for FGF-21 in CP. FGF-21 shows pleiotropic beneficial effects during the pathophysiological process of CP (Fig. 7C). FGF-21 ameliorates CP through improving pancreatic architecture, inflammatory stress, oxidative stress and pancreatic fibrogenesis due to regulating macrophages differentiation via mTOR signaling pathway. Our study provides evidence that FGF-21 may be a novel drug for the treatment of CP. Compliance with ethical standards Disclosure of potential conflicts of interest The authors declare no conflicts of interest. Research involving human participants and/or animals All procedures performed in studies involving mice were carried out in strict accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health and were approved by Harbin Veterinary Research Institute Animal Care and Use Committee.
9
Experimental Cell Research xxx (xxxx) xxx–xxx
N. Wang, et al.
Fig. 7. The effect of FGF-21 on m-TOR signaling pathway in THP-1 macrophages. A. Western blot and relative optical density value for m-TOR were measured in THP-1 macrophages of all groups. B. The expression of iNOS and CD206 expression in THP-1 macrophages with m-TOR inhibitor treatment were measured in all groups. C. Summary of the effects of FGF-21 on CP. The measurements were performed at least three times with similar results. *p < 0.05, **p < 0.01.
Informed consent Informed consent was obtained from all individual participants included in the study.
[5]
Acknowledgment
[7]
[6]
[8]
This study was funded by The Natural Science Foundation of Heilongjiang Province of China (C2017023).
[9] [10]
References
[11]
[1] Kl, G. ppel, B. Maillet, Development of chronic pancreatitis from acute pancreatitis: a pathogenetic concept, Zentralblatt fur Chirurgie 120 (4) (1995) 274–277. [2] G. Klöppel, Chronic pancreatitis, pseudotumors and other tumor-like lesions [J], Modern Pathology An Official Journal of the United States & Canadian Academy of Pathology Inc 20 (Suppl 1) (2007) S113–S131 1, supplement. [3] H. Sarles, Etiopathogenesis and definition of chronic pancreatitis [J], Dig. Dis. Sci. 31 (9) (1986) 91S–107S. [4] P. Mews, P. Phillips, R. Fahmy, et al., Pancreatic stellate cells respond to
[12] [13] [14]
10
inflammatory cytokines: potential role in chronic pancreatitis [J], Gut 50 (4) (2002) 535–541. J.M. Braganza, S.H. Lee, R.F. Mccloy, et al., Chronic Pancreatitis [M], World Scientific, 1999. G. Klöppel, S. Detlefsen, B. Feyerabend, Fibrosis of the pancreas: the initial tissue damage and the resulting pattern [J], Virchows Arch. 445 (1) (2004) 1–8. T.A. Wynn, L. Barron, Macrophages: master regulators of inflammation and fibrosis [J], Semin. Liver Dis. 30 (3) (2010) 245–257. J. Xue, Alternatively activated macrophages promote pancreatic fibrosis in chronic pancreatitis [J], Nat. Commun. 6 (2015) 7158. T. Nishimura, Y. Nakatake, M. Konishi, et al., BBA - Gene Structure and Expression 1492 (1) (2000) 203–206. C.L. Johnson, J.Y. Weston, S.A. Chadi, et al., Fibroblast growth factor 21 reduces the severity of cerulein-induced pancreatitis in mice [J], Gastroenterology 137 (5) (2009) 1795–1804. R. Goetz, A. Beenken, O.A. Ibrahimi, et al., Molecular insights into the klotho-dependent, endocrine mode of action of fibroblast growth factor 19 subfamily members [J], Mol. Cell. Biol. 27 (9) (2007) 3417–3428. N. Itoh, D.M. Ornitz, Functional evolutionary history of the mouse Fgf gene family [J], Dev. Dynam. 237 (1) (2008) 18–27. W.F. Wang, S.M. Li, G.P. Ren, et al., Recombinant murine fibroblast growth factor 21 ameliorates obesity-related inflammation in monosodium glutamate-induced obesity rats [J], Endocrine 49 (1) (2015) 119–129. N. Wang, T.Y. Xu, X. Zhang, et al., Improving hyperglycemic effect of FGF-21 is
Experimental Cell Research xxx (xxxx) xxx–xxx
N. Wang, et al.
[15] [16] [17] [18] [19] [20]
[21] [22] [23] [24] [25] [26] [27]
associated with alleviating inflammatory state in diabetes [J], Int. Immunopharmacol. 56 (2018) 301–309. Z. Lin, X. Pan, W. Fan, et al., Fibroblast growth factor 21 prevents atherosclerosis by suppression of hepatic sterol regulatory element-binding protein-2 and induction of adiponectin in mice [J], Circulation 131 (21) (2015) 1861. Y. Yu, J. He, S. Li, et al., Fibroblast growth factor 21 (FGF21) inhibits macrophagemediated inflammation by activating Nrf2 and suppressing the NF-κB signaling pathway [J], Int. Immunopharmacol. 38 (2016) 144–152. P. Xu, Y. Zhang, Y. Liu, et al., Fibroblast growth factor 21 attenuates hepatic fibrogenesis through TGF-β/smad2/3 and NF-κB signaling pathways [J], Toxicol. Appl. Pharmacol. 290 (2016) 43. P. Xu, Y. Zhang, L. Song, et al., Efficacy of a combination of high and low dosage of PEGylated FGF-21 in treatment of diabetes in db/db mice [J], Biomed. Pharmacother. 84 (2016) 97–105. Y. Sun, G. Xing, J. Bai, et al., A new mouse model of chronic pancreatitis in C57BL/ 6J strain that mimics the human pathology [J], Pancreas 43 (1) (2014) 148–150. D.K.- Jarres J, C. Kaiser, J.C. M Hafkenscheid, et al., Evaluation of a new α-amylase assay using 4,6-ethylidene-(G 7 )-1,4-nitrophenyl-(G 1 )-α-D-maltoheptaoside as substrate [J], Journal of Clinical Chemistry & Clinical Biochemistry 27 (2) (1989) 103–113. R. Dawra, Y.S. Ku, R. Sharif, et al., An improved method for extracting myeloperoxidase and determining its activity in the pancreas and lungs during pancreatitis [J], Pancreas 37 (1) (2008) 62. Z. Liu, J. Xing, Y. Huang, et al., Activation effect of Ganoderma lucidum polysaccharides liposomes on murine peritoneal macrophages [J], International Journal of Biological Macromolecules 82 (2015) 973. X. Jing, D.T.C. Nguyen, H. Aida, Aryl hydrocarbon receptor regulates pancreatic IL22 production and protects mice from acute pancreatitis [J], Gastroenterology 143 (6) (2012) 1670–1680. J. Xue, V. Sharma, M.H. Hsieh, et al., Alternatively activated macrophages promote pancreatic fibrosis in chronic pancreatitis[J], Nature Communications 6 (2015) 7158. G. Klöppel, S. Detlefsen, B. Feyerabend, Fibrosis of the pancreas: the initial tissue damage and the resulting pattern [J], Archiv Für Pathologische Anatomie Und Physiologie Und Für Klinische Medicin 445 (1) (2004) 1–8. J. Tahara, K. Shimizu, K. Shiratori, Engulfment of necrotic acinar cells by pancreatic stellate cells inhibits pancreatic fibrogenesis.[J], Pancreas 37 (1) (2008) 69–74. C. Shi, M.K. Washington, R. Chaturvedi, et al., Fibrogenesis in pancreatic cancer is a dynamic process regulated by macrophage–stellate cell interaction[J], Laboratory
Investigation 94 (4) (2014) 409–421. [28] W.F. Wang, S.M. Li, G.P. Ren, et al., Recombinant murine fibroblast growth factor 21 ameliorates obesity-related inflammation in monosodium glutamate-induced obesity rats [J], Endocrine 49 (1) (2015) 119–129. [29] Y. Yu, J. He, S. Li, et al., Fibroblast growth factor 21 (FGF21) inhibits macrophagemediated inflammation by activating Nrf2 and suppressing the NF-κB signaling pathway [J], International Immunopharmacology 38 (2016) 144–152. [30] S. Gordon, Alternative activation of macrophages [J], Nature Reviews Immunology 3 (1) (2003) 23–35. [31] T. Veremeyko, S. Siddiqui, I. Sotnikov, et al., miR-124 Inhibitor Decreased Expression of M2 Markers CD206 and Ym-1 and Increased Expression of M1 Markers CD86, iNOS, TNF, and miR-155 in the In-Vitro Polarized M2 Macrophages [J], (2013). [32] E.J. Brown, M.W. Albers, T. Bum Shin, et al., A mammalian protein targeted by G1arresting rapamycin–receptor complex [J], Nature (London) 369 (6483) (1994) 756–758. [33] J. Huang, B.D. Manning, The TSC1–TSC2 complex: a molecular switchboard controlling cell growth [J], Biochemical Journal 412 (2) (2008) 179–190. [34] V. Byles, A.J. Covarrubias, I. Ben-Sahra, et al., The TSC-mTOR pathway regulates macrophage polarization [J], Nature communications 4 (4) (2013) 2834. [35] M. Cornu, W. Oppliger, V. Albert, et al., Hepatic mTORC1 controls locomotor activity, body temperature, and lipid metabolism through FGF21 [J], Proceedings of the National Academy of Sciences of the United States of America 111 (32) (2014) 11592. [36] Q. Gong, F. Zhang, J. Gao, et al., mTOR mediates metabolic effects of FGF21 on insulin sensitivity in mice [J], Diabetes (2014) 63. A25-A. [37] A.Y. Minard, S.X. Tan, P. Yang, et al., mTORC1 is a major regulatory node in the FGF21 signaling network in adipocytes [J], Cell Reports 17 (1) (2016) 29–36. [38] M. Guridi, L.A. Tintignac, S. Lin, et al., Activation of mTORC1 in skeletal muscle regulates whole-body metabolism through FGF21 [J], Science Signaling 8 (402) (2015) ra113. [39] V.K. Shenoy, K.M. Beaver, F.M. Fisher, et al., Elevated serum fibroblast growth factor 21 in humans with acute pancreatitis[J], PLoS ONE 11 (11) (2016) e0164351. [40] G. Karim, D. Geneviève, D.S. Irène, et al., Increased FGF21 plasma levels in humans with sepsis and SIRS[J], Endocrine Connections 2 (3) (2013) 146–153. [41] K.R. Feingold, C. Grunfeld, J.G. Heuer, et al., FGF21 is increased by inflammatory stimuli and protects leptin-deficient ob/ob mice from the toxicity of sepsis[J], Endocrinology 153 (6) (2012) 2689–2700.
11