- Email: [email protected]
Freemartinism and FecXR allele determination in replacement ewes of the Rasa Aragonesa sheep breed by duplex PCR
Available online at www.sciencedirect.com
Theriogenology 72 (2009) 1148–1152 www.theriojournal.com
Technical note R
Freemartinism and FecX allele determination in replacement ewes of the Rasa Aragonesa sheep breed by duplex PCR A. Martinez-Royo a, E. Dervishi a, J.L. Alabart a, J.J. Jurado b, J. Folch a, J.H. Calvo a,c,* a
Unidad de Tecnologı´a en Produccio´n Animal, CITA, Av. de Montan˜ana 930, 50059 Zaragoza, Spain b Departamento Mejora Gene´tica Animal, INIA, Ctra. La Corun˜a Km 7.5, 28040 Madrid, Spain c ARAID Received 21 April 2009; received in revised form 10 June 2009; accepted 27 June 2009
Abstract A new naturally occurring mutation in the fecundity gene BMP15 in the Rasa Aragonesa sheep breed (Ovis aries) has been found to affect prolificacy. This mutation (FecXR allele) is a deletion of 17 base pairs that leads to an altered amino acid sequence, and this alteration increases prolificacy in heterozygous ewes but causes sterility in homozygous ewes. Selection of repository lambs with the FecXR allele increases rates of twins and multiple lambing and thereby also increases the probability of lambing freemartins that will become sterile. In this sense, an accurate, reliable, and quick method was developed by duplex polymerase chain reaction (PCR) for sex, amplifying an ovine-specific Y chromosome repetitive fragment, and BMP15 genotype determination in replacement ewe lambs. The BMP15 fragment served as an internal control of the amplification and detected the FecXR allele, avoiding a false negative and then a mistake in freemartin detection. This assay uncovered 6 freemartin females among 195 replacement ewes from 7 different commercial flocks and 1 experimental flock. Furthermore, 1554 rams from 64 commercial flocks were also analyzed to identify FecXR rams. This analysis identified 103 rams hemizygous for the FecXR allele and 1 heterozygous ram. Because this gene is located on the X chromosome, this heterozygous animal is a freemartin ram that is co-amplifying the DNA from XX and XY lymphocytes. These results confirm the usefulness of this multiplex PCR assay for detecting phenotypically sexed females, freemartins, and the BMP15 genotype to detect highly prolific ewes in commercial flocks and to assist breeders in selection of repository lambs. # 2009 Elsevier Inc. All rights reserved. Keywords: FecXR determination; Freemartinism; PCR; Sheep
1. Introduction The Rasa Aragonesa sheep breed (Ovis aries) is the second most important Spanish breed after the Merino sheep, which, at about 2 million animals, accounts for 16.2% of all Spanish sheep. During the early 1990 s, the cooperative Carnes Oviarago´n S.C.L. implemented a selection scheme designed to improve prolificacy on
* Corresponding author. Tel.: +34 976716471; fax: +34 976713553. E-mail address: [email protected] (J.H. Calvo). 0093-691X/$ – see front matter # 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.theriogenology.2009.06.029
associated farms. This breeding program was conducted in a collection of 130,000 Rasa Aragonesa adult ewes (196 flocks), produced primarily during 3 lambings in 2 yr, with low prolificacy (1.3). In this context, a new naturally occurring mutation related to prolificacy in the BMP15 gene was described in the Rasa Aragonesa sheep breed [1]. This mutation (the FecXR allele) is a deletion of 17 base pairs that leads to an altered amino acid sequence, and this alteration increases prolificacy in heterozygous ewes but causes sterility in homozygous ewes. The estimated effect on prolificacy of the BMP15/FecxR allele, which increases prolificacy by
A. Martinez-Royo et al. / Theriogenology 72 (2009) 1148–1152
twin and triplet lambing, was 0.32 lambs per sheep and lamb [2]. Freemartinism is a condition occurring in twins of different sexes in which an imperfect masculinized sterile female twin is born with a male. Placental anastomoses occur between these twins in early embryonic life, allowing hormones from the male to masculinize the indifferent gonad of the female twin [3]. The clinical symptoms of this syndrome are accompanied by XX/XY chimerism of lymphocytes, which is used to diagnose it [4–6]. Freemartinism in sheep is much less frequent than in cows, and it is a relatively unimportant abnormality [7], although more recent studies suggest that it is more common than previously reported and that it may be increasing in prevalence. The discovery of high fecundity genes (GDF9, BMP15, and BMPR1B) in sheep has led to the introduction of promoting multiple ovulation, and the risk of freemartinism in sheep has been shown to be greater in litters of two or more [8,9]. Increasing prolificacy by means of multiple births increases sterility rates in females because of the freemartin phenomenon during pregnancy. A summary of the various diagnostic methods used for the freemartin syndrome is described by Padula [10]. Because reliability is the most important concern in sex determination, polymerase chain reaction (PCR) meets this criterion and is also quick and inexpensive. In ruminants, males are identified by amplifying a specific sex-determining region in the Y chromosome [11–17]. Amplification of the ZFX/ZFY region and Restriction Fragment Length Polymorphisms (RFLPs) analyses have been used in sex determination in cows and sheep [18]. However, RFLP analysis requires an additional reaction step, and the possibility of incomplete digestion is another disadvantage of RFLP studies [19]. There is only one described PCR-based assay for diagnosing freemartinism in sheep, which amplifies the SRY gene [20]. However, absence of amplification does not necessarily mean that the sample is from a ewe, because false negatives can lead to a mistake in sex determination. To circumvent this problem, internal controls that amplify sequences present in both males and females should be run to ensure that the PCR reaction has occurred correctly [21]. Accordingly, duplex PCR assays that co-amplify a Y chromosome sequence that is widely conserved in mammals, together with an autosomal sequence that acts as a control both for the presence of DNA and the appropriateness of the PCR conditions, have been described [22]. The amelogenin (AMEL) gene, which exists on both the X and Y chromosomes, has also been used to determine sex in sheep [23] as well as in other species of the Bovidae family [24,25].
1149
The introduction of the FecXR allele into the selection scheme is designed to improve prolificacy in the Rasa Aragonesa breed by twin and triplet lambing, but it could lead to increased sterility cases among females because of freemartinism and homozygous FecXR ewes. In this study, we report a duplex PCR protocol for the detection of freemartinism and the FecXR genotype in replacement ewes of the Rasa Aragonesa sheep breed. 2. Materials and methods 2.1. Genomic DNA samples and DNA extraction DNA was obtained from blood using the Bloodclean DNA Purification kit (Biotools, Madrid, Spain) according to the manufacturer’s instructions. The accuracy of the duplex PCR was assessed in 500 adult animals (250 females and 250 males). All ewes had had at least one lambing. Furthermore, 195 replacement ewes were genotyped to determine the genotypic sex and the presence of the FecXR allele. In total, 113 of the ewes were from 7 different commercial flocks, and 82 were from a heterozygous FecX+/FecXR experimental flock. Finally, 1554 rams from 64 commercial flocks were also analyzed to identify FecXR rams. 2.2. Duplex PCR amplification Duplex PCR was performed to amplify a specific repetitive fragment of the ovine Y chromosome (GenBank Accession No. U65982 and U30307) [26] and a fragment of the BMP15 gene containing the deletion found in the Rasa Aragonesa breed (GenBank Accession No. AAF81688) [1]. This fragment was used as an internal control and to determine the FecXR allele. Duplex PCR was carried out in a final volume of 25 mL containing 100 to 150 ng genomic DNA, 0.25 mM of each primer, 0.5 mM dNTP mix, 2.5 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl, 0.1% Triton X-100, and 0.5 U Taq DNA polymerase (Biotools). In total, 35 cycles were performed with the following step-cycle profile: denaturation at 94 8C for 45 sec, followed by primer annealing at 59 8C for 45 sec, and primer extension at 72 8C for 45 sec. The set of primers used for genetic sex determination were 50 CTGGCTTCCTTGAGATGTCC30 (forward) and 50 -GTGCCTCTTGGGCTGATCTA-30 (reverse). BMP15 primers were as follows: 50 -CCACCTCTCCTGCCATGTG-30 (forward) and 50 -ATCCATCTCTGTCCAAGTTTTGG-30 (reverse). Primers specific for the repetitive fragment were designed after aligning sequences U65982 and U30307 with ClustalW
1150
A. Martinez-Royo et al. / Theriogenology 72 (2009) 1148–1152
Table 1 BMP15 genotyping and freemartinism determination. Freemartin ewes amplify the specific Y chromosome repetitive fragment. Numbers of freemartin animals are given in parentheses. Ewes
Number of FecX+/FecX+
Number of FecX+/FecXR
Number of FecXR/FecXR
Control animals (N = 250) Prolific flock (N = 82) Commercial flocks (N = 113)
156 (0) 0 68 (1)
83 (0) 82 (2) 35 (2)
11 (0) 0 5 (2)
Rams
Number of FecX+
Number of FecXR
Control animals (N = 250) Commercial flocks (N = 1554)*
237 1450
13 103
*
One ram displayed a heterozygous genotype for the BMP15 gene, indicating the freemartin syndrome in this animal.
(http://ebi.ac.uk/clustalw/). Primers for both DNA fragments were designed with Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi). Polymerase chain reaction products were separated by standard electrophoresis in a 3.5% TBE (0.045M Tris-borate, 0.001M EDTA)-agarose gel. Freemartinism was also confirmed by amelogenin gene amplification [25]. Polymerase chain reaction was carried out in a final volume of 25 mL containing 100 to 150 pg genomic DNA, 5 pmol of each primer 50 -CCGCCCAGCAGCCCTTCC-30 and 50 -CCCGCTTGGTCTTGTCTGTTGC-30 , 200 mM for each dNTP, 2 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl, 0.1% Triton X100, and 0.7 U Taq DNA polymerase (Biotools). Thirtyfive cycles were performed with the following stepcycle profile: denaturation at 94 8C for 45 sec, followed by primer annealing at 63 8C for 45 sec, and primer extension at 72 8C for 45 sec. The last extension step was 10 min longer. An initial denaturation step at 94 8C for 3 min was performed to improve the final result. These primers amplified a region of 182 bp at the Y chromosome and 242 bp at the X chromosome.
amplified the Y-specific DNA fragment, due to the chimerism of their XX/XY lymphocytes. Results of the BMP15 genotyping and sex determination are shown in Table 1. A total of 180 ewe lambs from 7 different commercial flocks and 1 experimental flock were tested for putative sterility due to freemartinism and for homozygosity of the FecXR allele. In the commercial flocks, 5 phenotypic ewes produced the 171-bp fragment indicative of male genotypic sex (Fig. 1). One of these ewes was homozygous for the FecX+ allele (Fig. 1, Lane 4). Two of these ewes were FecX+/FecXR heterozygotes and were thus potential prolific replacement ewes that had been rendered sterile due to the freemartin syndrome (Fig. 1, Lanes 2 and 5). The other two were sterile FecXR/FecXR homozygotes and freemartins (Fig. 1, Lane 6). Two of the ewes in the prolific heterozygous FecX+/FecXR experimental flock were also sterile because of freemartinism (Fig. 1, Lanes 7 and 8). In Figure 1, varying band intensities of the
3. Results and Discussion The objective of this study was to test the utility of a duplex PCR assay for the routine detection of freemartinism and FecXR in replacement ewes of Rasa Aragonesa sheep. To confirm the effectiveness and the specificity of this duplex PCR, it was tested on sheep blood DNA samples from 250 males and 250 females. The genotypic sex of all of these animals, as determined by the assay, was in accord with their phenotypic sex, and there were no failures of amplification. The primers used for genetic sex determination amplified a region of 171 bp in males, whereas no amplification was obtained in females. Polymerase chain reaction amplification of the FecXR and FecX+ alleles produced fragments of 101 and 118 bp, respectively. Also, sterile freemartin ewes
Fig. 1. Freemartinism and FecXR genotype determination by duplex PCR. The primers used for genetic sex determination amplified a region of 171 bp in males, whereas no amplification was obtained in females. Polymerase chain reaction amplification of the FecXR and FecX+ alleles produced fragments of 101 and 118 bp, respectively. Lane 1, a FecX+ normal male; Lane 2, a FecX+/FecXR freemartin female; Lane 3, a FecX+/FecXR freemartin male; Lane 4, a FecX+/ FecX+ freemartin female; Lane 5, a FecX+/FecXR freemartin female; Lane 6, a FecXR/FecXR freemartin female; Lanes 7 and 8, FecX+/ FecXR freemartin females; Lane 9, a FecX+/FecX+ normal female; Lane 10, a FecX+/FecXR normal female; Lane 11, a FecXR/FecXR normal (female); Lane 12, negative control; Lane 13, 1-kb marker (Biotools, Madrid, Spain). Indicated sex refers to phenotypic sex.
A. Martinez-Royo et al. / Theriogenology 72 (2009) 1148–1152
specific Y chromosome repetitive fragment are shown, which are due to varying XX/XY ratios in the chimeric lymphocyte population. In total, our assay found 5 freemartins in a commercial flock of 113 ewe lambs and 2 freemartins in a flock of 82 prolific heterozygous FecX+/FecXR ewe lambs. The genotypic sex of the freemartin animals was also confirmed using amelogenin gene amplification. These phenotypic females amplified two DNA fragments of 182 bp at the Y chromosome and 242 bp at the X chromosome, confirming the freemartin syndrome. Other studies have reported the incidence of ovine freemartins to be approximately 1% [7,9,27], but our assay detected freemartinism in 3.58% of 195 replacement ewes. With the objective of finding FecXR rams to avoid inbreeding, 1554 rams from 64 commercial flocks were also analyzed. In total, 103 rams were hemizygous for the FecXR allele. No amplification failures occurred, and the agreement between genotypic and phenotypic sex was 100%. Only one animal displayed a heterozygous genotype for the BMP15 gene (Fig. 1; Lane 3). Because this gene is located on the X chromosome, sires should be hemizygous for the FecX+ or FecXR alleles, but not heterozygous. Therefore, this animal is a freemartin ram that amplifies the BMP15 locus from both XX and XY lymphocytes. The reproductive effects of chimerism in males are continually debated, with no clear conclusions [28,29]. The BMP15 primer pair was used both to detect FecXR and as an internal control for amplification, thereby avoiding false negatives and mistakes in freemartin detection. The particular Y chromosome repetitive fragment was advantageous because it is in the nonrecombining region of the Y chromosome and also because it is present in high copy numbers that give a better amplification signal. Our results confirm the utility of this duplex PCR assay for detecting freemartin animals and the genotype of the BMP15 gene. Because the introduction of the FecXR allele into the selection scheme could lead to increased female sterility both from freemartinism and from FecXR homozygosity, this duplex PCR assay, which simultaneously and reliably detects both of these conditions, should be of great value to commercial replacement breeding programs using FecXR to increase prolificacy. Selection of repository lambs with the FecXR allele to increase the frequency of multiple lambing also increases the probability of lambing freemartins that will be sterile. These ewes are not desired in the repository and must be detected and eliminated from the flock as soon as possible. This duplex PCR technique using genomic DNA extracted from blood solves this
1151
problem before the onset of the reproductive cycle, thereby reducing costs due to feeding and general stock maintenance. Acknowledgments This work was supported by projects CEDETI 2004-611 and INIA RTA 2006-140. A. MartinezRoyo and E. Dervishi are supported by INIA and IAMZ-CHIEAM grants, respectively. The authors thank Carnes Oviarago´n S.C.L. for kindly providing animal samples. References [1] Martı´nez-Royo A, Jurado JJ, Smulder JP, Martı´ JI, Alabart JL, Roche A, et al. A deletion in the bone morphogenetic protein 15 gene causes sterility and increased prolificacy in Rasa Aragonesa sheep. Anim Genet 2008;39(3):294–7. [2] Jurado JJ, Martinez-Royo A, Calvo JH. Phenotypic effect of the BMP15/Fecx(R) allele in prolificacy of the CarnesOviaragon SCL population. ITEA 2008;104(2):149–54. [3] Mellor DJ. Vascular anastomosis and fusion of foetal membranes in multiple pregnancy in sheep. Res Vet Sci 1969;10:361–7. [4] Zhang TO, Buoen LC, Seguin BE, Ruth GR, Weber AF. Diagnosis of freemartinism in cattle. The need for clinical and cytogenetic evaluation. J Am Vet Med Assoc 1994;204(10): 1672–5. [5] Justi A, Hecht W, Herzog A, Speck J. Comparison of different methods for the diagnosis of freemartins—polymerase chain reaction, blood group serology and karyotyping. Deut Tierarztl Woch 1995;102(12):471–4. [6] Ennis S, Vaughan L, Gallagher TF. The diagnosis of freemartinism in cattle using sex-specific DNA sequences. Res Vet Sci 1999;67(1):111–2. [7] Marcum JB. The freemartin syndrome. Anim Breed 1974;42: 227–42. [8] Smith KC, Parkinson TJ, Pearson GR, Sylvester L, Long SE. Morphological, histological and histochemical studies of the gonads of ovine freemartins. Vet Rec 2003;152(6): 164–9. [9] Parkinson TJ, Smith KC, Long SE, Douthwaite JA, Mann GE, Knight PG. Inter-relationships among gonadotrophins, reproductive steroids and inhibin in freemartin ewes. Reproduction 2001;122(3):397–409. [10] Padula AM. The freemartin syndrome: an update. Anim Reprod Sci 2005;87(1-2):93–109. [11] Peura T, Hyttinen JM, Turunen M, Janne J. A reliable sex determination assay for bovine preimplantational embryos using polymerase chain reaction. Theriogenology 1991;35: 547–55. [12] Griffitts R, Tiwari B. Primers for the differential amplification of the sex-determining region Y-gene in a range of mammals species. Mol Ecol 1993;2(6):405–6. [13] Pomp D, Good BA, Geisert RD, Corbin CJ, Conley AJ. Sex identification in mammals with polymerase chain reaction and its use to examine sex effects on diameter of day-10 or -11 pig embryos. J Anim Sci 1995;73:1408–15. [14] Bredbacha P, Kankaanpaa A, Peippo J. PCR-sexing of bovine embryos. A simplified protocol Theriogenology 1995;44:167–76.
1152
A. Martinez-Royo et al. / Theriogenology 72 (2009) 1148–1152
[15] Ng A, Sathasivam K, Laurie S, Notarianni E. Determination of sex and chimaerism in the domestic sheep by DNA amplification using HMG-box and microsatellite sequences. Anim Reprod Sci 1996;41(2):131–9. [16] Weikard R, Kuhn C, Brunner RM, Roschlau D, Pitra C, Laurent P, Schwerin M. Sex determination in cattle based on simultaneous amplification of a new male-specific DNA sequence and an autosomal locus using the same primers. Mol Reprod Dev 2001;60(1):13–9. [17] Kageyama S, Yoshida I, Kawakura K, Chikuni K. A novel repeated sequence located on the bovine Y chromosome: its application to rapid and precise embryo sexing by PCR. J Vet Med Sci 2004;66(5):509–14. [18] Kochhar HS, Buckrell BC, Pollard JW, King WA. Production of sexed lambs after biopsy of ovine blastocyts produced in vitro Can Vet J 2000;41(5):398–400. [19] Bredbacka P, Peippo J. Sex diagnosis of ovine and bovine embryos by enzymatic amplification and digestion of DNA from ZFX/ZFY locus. Agr Sci Finland 1992;1(2):233–8. [20] Ponz R, Ferrer LM, Monteagudo LV, Arruga MV., PCR diagnosis of sheep infertility due to chromosome aberrations: first cases in Rasa aragonesa sheep. In: Proocedings XXXI Jornadas cientı´ficas y X Internacionales SEOC, Junta de Castilla y Leo´n (Ed.), Gra´ficas Germinal S.C.L., 2006, pp. 170-3. [21] Aasen E, Medrano JF. Amplification of the ZFY and ZFX genes for sex identification in humans, cattle, sheep and goats. Biotechnology 1990;8:1279–81.
[22] Mara L, Pilichi S, Sanna A, Accardo C, Chessa B, Chessa F, et al. Sexing of in vitro produced ovine embryos by duplex PCR. Mol Reprod Dev 2004;69:35–42. [23] Pfeiffer I, Brenig B. X- and Y- chromosome specific variants of amelogenin gene allow sex determination in sheep (Ovis aries) and European red deer (Cervus elaphus). BMC Genet 2005;6:ARTN 16. [24] Weikard R, Pitra Ch, Ku¨hn Ch. Amelogenin cross-amplification in the family Bovidae and its application for sex determination. Mol Reprod Dev 2006;73:1333–7. [25] Dervishi E, Martı´nez-Royo A, Sa´nchez P, Alabart JL, Cocero MJ, Folch J, Calvo JH. Reliability of sex determination in ovine embryos using amelogenin gene (AMEL). Theriogenology 2008;70:241–7. [26] Gutierrez-Adan A, Cushwa WT, Anderson GB, Medrano JF. Ovine-specific Y-chromosome RAPD SCAR marker for embryo sexing. Anim Genet 1997;28:135–8. [27] Long SE. Some pathological conditions of the reproductive tract of the ewe. Vet Rec 1980;106:175–7. [28] Rejduch B, Slota E, Gustavsson I. 60,XY/60,XX chimerism in the germ cell line of mature bulls born in heterosexual twinning. Theriogenology 2000;54:621–7. [29] Seguin BE, Zhang TQ, Buoen LC, Weber AF, Ruth GR. Cytogenetic survey of Holstein bulls at a commercial artificial insemination company to determine prevalence of bulls with centric fusion and chimeric anomalies. J Am Vet Med Assoc 2000;216:65–7.
Theriogenology 72 (2009) 1148–1152 www.theriojournal.com
Technical note R
Freemartinism and FecX allele determination in replacement ewes of the Rasa Aragonesa sheep breed by duplex PCR A. Martinez-Royo a, E. Dervishi a, J.L. Alabart a, J.J. Jurado b, J. Folch a, J.H. Calvo a,c,* a
Unidad de Tecnologı´a en Produccio´n Animal, CITA, Av. de Montan˜ana 930, 50059 Zaragoza, Spain b Departamento Mejora Gene´tica Animal, INIA, Ctra. La Corun˜a Km 7.5, 28040 Madrid, Spain c ARAID Received 21 April 2009; received in revised form 10 June 2009; accepted 27 June 2009
Abstract A new naturally occurring mutation in the fecundity gene BMP15 in the Rasa Aragonesa sheep breed (Ovis aries) has been found to affect prolificacy. This mutation (FecXR allele) is a deletion of 17 base pairs that leads to an altered amino acid sequence, and this alteration increases prolificacy in heterozygous ewes but causes sterility in homozygous ewes. Selection of repository lambs with the FecXR allele increases rates of twins and multiple lambing and thereby also increases the probability of lambing freemartins that will become sterile. In this sense, an accurate, reliable, and quick method was developed by duplex polymerase chain reaction (PCR) for sex, amplifying an ovine-specific Y chromosome repetitive fragment, and BMP15 genotype determination in replacement ewe lambs. The BMP15 fragment served as an internal control of the amplification and detected the FecXR allele, avoiding a false negative and then a mistake in freemartin detection. This assay uncovered 6 freemartin females among 195 replacement ewes from 7 different commercial flocks and 1 experimental flock. Furthermore, 1554 rams from 64 commercial flocks were also analyzed to identify FecXR rams. This analysis identified 103 rams hemizygous for the FecXR allele and 1 heterozygous ram. Because this gene is located on the X chromosome, this heterozygous animal is a freemartin ram that is co-amplifying the DNA from XX and XY lymphocytes. These results confirm the usefulness of this multiplex PCR assay for detecting phenotypically sexed females, freemartins, and the BMP15 genotype to detect highly prolific ewes in commercial flocks and to assist breeders in selection of repository lambs. # 2009 Elsevier Inc. All rights reserved. Keywords: FecXR determination; Freemartinism; PCR; Sheep
1. Introduction The Rasa Aragonesa sheep breed (Ovis aries) is the second most important Spanish breed after the Merino sheep, which, at about 2 million animals, accounts for 16.2% of all Spanish sheep. During the early 1990 s, the cooperative Carnes Oviarago´n S.C.L. implemented a selection scheme designed to improve prolificacy on
* Corresponding author. Tel.: +34 976716471; fax: +34 976713553. E-mail address: [email protected] (J.H. Calvo). 0093-691X/$ – see front matter # 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.theriogenology.2009.06.029
associated farms. This breeding program was conducted in a collection of 130,000 Rasa Aragonesa adult ewes (196 flocks), produced primarily during 3 lambings in 2 yr, with low prolificacy (1.3). In this context, a new naturally occurring mutation related to prolificacy in the BMP15 gene was described in the Rasa Aragonesa sheep breed [1]. This mutation (the FecXR allele) is a deletion of 17 base pairs that leads to an altered amino acid sequence, and this alteration increases prolificacy in heterozygous ewes but causes sterility in homozygous ewes. The estimated effect on prolificacy of the BMP15/FecxR allele, which increases prolificacy by
A. Martinez-Royo et al. / Theriogenology 72 (2009) 1148–1152
twin and triplet lambing, was 0.32 lambs per sheep and lamb [2]. Freemartinism is a condition occurring in twins of different sexes in which an imperfect masculinized sterile female twin is born with a male. Placental anastomoses occur between these twins in early embryonic life, allowing hormones from the male to masculinize the indifferent gonad of the female twin [3]. The clinical symptoms of this syndrome are accompanied by XX/XY chimerism of lymphocytes, which is used to diagnose it [4–6]. Freemartinism in sheep is much less frequent than in cows, and it is a relatively unimportant abnormality [7], although more recent studies suggest that it is more common than previously reported and that it may be increasing in prevalence. The discovery of high fecundity genes (GDF9, BMP15, and BMPR1B) in sheep has led to the introduction of promoting multiple ovulation, and the risk of freemartinism in sheep has been shown to be greater in litters of two or more [8,9]. Increasing prolificacy by means of multiple births increases sterility rates in females because of the freemartin phenomenon during pregnancy. A summary of the various diagnostic methods used for the freemartin syndrome is described by Padula [10]. Because reliability is the most important concern in sex determination, polymerase chain reaction (PCR) meets this criterion and is also quick and inexpensive. In ruminants, males are identified by amplifying a specific sex-determining region in the Y chromosome [11–17]. Amplification of the ZFX/ZFY region and Restriction Fragment Length Polymorphisms (RFLPs) analyses have been used in sex determination in cows and sheep [18]. However, RFLP analysis requires an additional reaction step, and the possibility of incomplete digestion is another disadvantage of RFLP studies [19]. There is only one described PCR-based assay for diagnosing freemartinism in sheep, which amplifies the SRY gene [20]. However, absence of amplification does not necessarily mean that the sample is from a ewe, because false negatives can lead to a mistake in sex determination. To circumvent this problem, internal controls that amplify sequences present in both males and females should be run to ensure that the PCR reaction has occurred correctly [21]. Accordingly, duplex PCR assays that co-amplify a Y chromosome sequence that is widely conserved in mammals, together with an autosomal sequence that acts as a control both for the presence of DNA and the appropriateness of the PCR conditions, have been described [22]. The amelogenin (AMEL) gene, which exists on both the X and Y chromosomes, has also been used to determine sex in sheep [23] as well as in other species of the Bovidae family [24,25].
1149
The introduction of the FecXR allele into the selection scheme is designed to improve prolificacy in the Rasa Aragonesa breed by twin and triplet lambing, but it could lead to increased sterility cases among females because of freemartinism and homozygous FecXR ewes. In this study, we report a duplex PCR protocol for the detection of freemartinism and the FecXR genotype in replacement ewes of the Rasa Aragonesa sheep breed. 2. Materials and methods 2.1. Genomic DNA samples and DNA extraction DNA was obtained from blood using the Bloodclean DNA Purification kit (Biotools, Madrid, Spain) according to the manufacturer’s instructions. The accuracy of the duplex PCR was assessed in 500 adult animals (250 females and 250 males). All ewes had had at least one lambing. Furthermore, 195 replacement ewes were genotyped to determine the genotypic sex and the presence of the FecXR allele. In total, 113 of the ewes were from 7 different commercial flocks, and 82 were from a heterozygous FecX+/FecXR experimental flock. Finally, 1554 rams from 64 commercial flocks were also analyzed to identify FecXR rams. 2.2. Duplex PCR amplification Duplex PCR was performed to amplify a specific repetitive fragment of the ovine Y chromosome (GenBank Accession No. U65982 and U30307) [26] and a fragment of the BMP15 gene containing the deletion found in the Rasa Aragonesa breed (GenBank Accession No. AAF81688) [1]. This fragment was used as an internal control and to determine the FecXR allele. Duplex PCR was carried out in a final volume of 25 mL containing 100 to 150 ng genomic DNA, 0.25 mM of each primer, 0.5 mM dNTP mix, 2.5 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl, 0.1% Triton X-100, and 0.5 U Taq DNA polymerase (Biotools). In total, 35 cycles were performed with the following step-cycle profile: denaturation at 94 8C for 45 sec, followed by primer annealing at 59 8C for 45 sec, and primer extension at 72 8C for 45 sec. The set of primers used for genetic sex determination were 50 CTGGCTTCCTTGAGATGTCC30 (forward) and 50 -GTGCCTCTTGGGCTGATCTA-30 (reverse). BMP15 primers were as follows: 50 -CCACCTCTCCTGCCATGTG-30 (forward) and 50 -ATCCATCTCTGTCCAAGTTTTGG-30 (reverse). Primers specific for the repetitive fragment were designed after aligning sequences U65982 and U30307 with ClustalW
1150
A. Martinez-Royo et al. / Theriogenology 72 (2009) 1148–1152
Table 1 BMP15 genotyping and freemartinism determination. Freemartin ewes amplify the specific Y chromosome repetitive fragment. Numbers of freemartin animals are given in parentheses. Ewes
Number of FecX+/FecX+
Number of FecX+/FecXR
Number of FecXR/FecXR
Control animals (N = 250) Prolific flock (N = 82) Commercial flocks (N = 113)
156 (0) 0 68 (1)
83 (0) 82 (2) 35 (2)
11 (0) 0 5 (2)
Rams
Number of FecX+
Number of FecXR
Control animals (N = 250) Commercial flocks (N = 1554)*
237 1450
13 103
*
One ram displayed a heterozygous genotype for the BMP15 gene, indicating the freemartin syndrome in this animal.
(http://ebi.ac.uk/clustalw/). Primers for both DNA fragments were designed with Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi). Polymerase chain reaction products were separated by standard electrophoresis in a 3.5% TBE (0.045M Tris-borate, 0.001M EDTA)-agarose gel. Freemartinism was also confirmed by amelogenin gene amplification [25]. Polymerase chain reaction was carried out in a final volume of 25 mL containing 100 to 150 pg genomic DNA, 5 pmol of each primer 50 -CCGCCCAGCAGCCCTTCC-30 and 50 -CCCGCTTGGTCTTGTCTGTTGC-30 , 200 mM for each dNTP, 2 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl, 0.1% Triton X100, and 0.7 U Taq DNA polymerase (Biotools). Thirtyfive cycles were performed with the following stepcycle profile: denaturation at 94 8C for 45 sec, followed by primer annealing at 63 8C for 45 sec, and primer extension at 72 8C for 45 sec. The last extension step was 10 min longer. An initial denaturation step at 94 8C for 3 min was performed to improve the final result. These primers amplified a region of 182 bp at the Y chromosome and 242 bp at the X chromosome.
amplified the Y-specific DNA fragment, due to the chimerism of their XX/XY lymphocytes. Results of the BMP15 genotyping and sex determination are shown in Table 1. A total of 180 ewe lambs from 7 different commercial flocks and 1 experimental flock were tested for putative sterility due to freemartinism and for homozygosity of the FecXR allele. In the commercial flocks, 5 phenotypic ewes produced the 171-bp fragment indicative of male genotypic sex (Fig. 1). One of these ewes was homozygous for the FecX+ allele (Fig. 1, Lane 4). Two of these ewes were FecX+/FecXR heterozygotes and were thus potential prolific replacement ewes that had been rendered sterile due to the freemartin syndrome (Fig. 1, Lanes 2 and 5). The other two were sterile FecXR/FecXR homozygotes and freemartins (Fig. 1, Lane 6). Two of the ewes in the prolific heterozygous FecX+/FecXR experimental flock were also sterile because of freemartinism (Fig. 1, Lanes 7 and 8). In Figure 1, varying band intensities of the
3. Results and Discussion The objective of this study was to test the utility of a duplex PCR assay for the routine detection of freemartinism and FecXR in replacement ewes of Rasa Aragonesa sheep. To confirm the effectiveness and the specificity of this duplex PCR, it was tested on sheep blood DNA samples from 250 males and 250 females. The genotypic sex of all of these animals, as determined by the assay, was in accord with their phenotypic sex, and there were no failures of amplification. The primers used for genetic sex determination amplified a region of 171 bp in males, whereas no amplification was obtained in females. Polymerase chain reaction amplification of the FecXR and FecX+ alleles produced fragments of 101 and 118 bp, respectively. Also, sterile freemartin ewes
Fig. 1. Freemartinism and FecXR genotype determination by duplex PCR. The primers used for genetic sex determination amplified a region of 171 bp in males, whereas no amplification was obtained in females. Polymerase chain reaction amplification of the FecXR and FecX+ alleles produced fragments of 101 and 118 bp, respectively. Lane 1, a FecX+ normal male; Lane 2, a FecX+/FecXR freemartin female; Lane 3, a FecX+/FecXR freemartin male; Lane 4, a FecX+/ FecX+ freemartin female; Lane 5, a FecX+/FecXR freemartin female; Lane 6, a FecXR/FecXR freemartin female; Lanes 7 and 8, FecX+/ FecXR freemartin females; Lane 9, a FecX+/FecX+ normal female; Lane 10, a FecX+/FecXR normal female; Lane 11, a FecXR/FecXR normal (female); Lane 12, negative control; Lane 13, 1-kb marker (Biotools, Madrid, Spain). Indicated sex refers to phenotypic sex.
A. Martinez-Royo et al. / Theriogenology 72 (2009) 1148–1152
specific Y chromosome repetitive fragment are shown, which are due to varying XX/XY ratios in the chimeric lymphocyte population. In total, our assay found 5 freemartins in a commercial flock of 113 ewe lambs and 2 freemartins in a flock of 82 prolific heterozygous FecX+/FecXR ewe lambs. The genotypic sex of the freemartin animals was also confirmed using amelogenin gene amplification. These phenotypic females amplified two DNA fragments of 182 bp at the Y chromosome and 242 bp at the X chromosome, confirming the freemartin syndrome. Other studies have reported the incidence of ovine freemartins to be approximately 1% [7,9,27], but our assay detected freemartinism in 3.58% of 195 replacement ewes. With the objective of finding FecXR rams to avoid inbreeding, 1554 rams from 64 commercial flocks were also analyzed. In total, 103 rams were hemizygous for the FecXR allele. No amplification failures occurred, and the agreement between genotypic and phenotypic sex was 100%. Only one animal displayed a heterozygous genotype for the BMP15 gene (Fig. 1; Lane 3). Because this gene is located on the X chromosome, sires should be hemizygous for the FecX+ or FecXR alleles, but not heterozygous. Therefore, this animal is a freemartin ram that amplifies the BMP15 locus from both XX and XY lymphocytes. The reproductive effects of chimerism in males are continually debated, with no clear conclusions [28,29]. The BMP15 primer pair was used both to detect FecXR and as an internal control for amplification, thereby avoiding false negatives and mistakes in freemartin detection. The particular Y chromosome repetitive fragment was advantageous because it is in the nonrecombining region of the Y chromosome and also because it is present in high copy numbers that give a better amplification signal. Our results confirm the utility of this duplex PCR assay for detecting freemartin animals and the genotype of the BMP15 gene. Because the introduction of the FecXR allele into the selection scheme could lead to increased female sterility both from freemartinism and from FecXR homozygosity, this duplex PCR assay, which simultaneously and reliably detects both of these conditions, should be of great value to commercial replacement breeding programs using FecXR to increase prolificacy. Selection of repository lambs with the FecXR allele to increase the frequency of multiple lambing also increases the probability of lambing freemartins that will be sterile. These ewes are not desired in the repository and must be detected and eliminated from the flock as soon as possible. This duplex PCR technique using genomic DNA extracted from blood solves this
1151
problem before the onset of the reproductive cycle, thereby reducing costs due to feeding and general stock maintenance. Acknowledgments This work was supported by projects CEDETI 2004-611 and INIA RTA 2006-140. A. MartinezRoyo and E. Dervishi are supported by INIA and IAMZ-CHIEAM grants, respectively. The authors thank Carnes Oviarago´n S.C.L. for kindly providing animal samples. References [1] Martı´nez-Royo A, Jurado JJ, Smulder JP, Martı´ JI, Alabart JL, Roche A, et al. A deletion in the bone morphogenetic protein 15 gene causes sterility and increased prolificacy in Rasa Aragonesa sheep. Anim Genet 2008;39(3):294–7. [2] Jurado JJ, Martinez-Royo A, Calvo JH. Phenotypic effect of the BMP15/Fecx(R) allele in prolificacy of the CarnesOviaragon SCL population. ITEA 2008;104(2):149–54. [3] Mellor DJ. Vascular anastomosis and fusion of foetal membranes in multiple pregnancy in sheep. Res Vet Sci 1969;10:361–7. [4] Zhang TO, Buoen LC, Seguin BE, Ruth GR, Weber AF. Diagnosis of freemartinism in cattle. The need for clinical and cytogenetic evaluation. J Am Vet Med Assoc 1994;204(10): 1672–5. [5] Justi A, Hecht W, Herzog A, Speck J. Comparison of different methods for the diagnosis of freemartins—polymerase chain reaction, blood group serology and karyotyping. Deut Tierarztl Woch 1995;102(12):471–4. [6] Ennis S, Vaughan L, Gallagher TF. The diagnosis of freemartinism in cattle using sex-specific DNA sequences. Res Vet Sci 1999;67(1):111–2. [7] Marcum JB. The freemartin syndrome. Anim Breed 1974;42: 227–42. [8] Smith KC, Parkinson TJ, Pearson GR, Sylvester L, Long SE. Morphological, histological and histochemical studies of the gonads of ovine freemartins. Vet Rec 2003;152(6): 164–9. [9] Parkinson TJ, Smith KC, Long SE, Douthwaite JA, Mann GE, Knight PG. Inter-relationships among gonadotrophins, reproductive steroids and inhibin in freemartin ewes. Reproduction 2001;122(3):397–409. [10] Padula AM. The freemartin syndrome: an update. Anim Reprod Sci 2005;87(1-2):93–109. [11] Peura T, Hyttinen JM, Turunen M, Janne J. A reliable sex determination assay for bovine preimplantational embryos using polymerase chain reaction. Theriogenology 1991;35: 547–55. [12] Griffitts R, Tiwari B. Primers for the differential amplification of the sex-determining region Y-gene in a range of mammals species. Mol Ecol 1993;2(6):405–6. [13] Pomp D, Good BA, Geisert RD, Corbin CJ, Conley AJ. Sex identification in mammals with polymerase chain reaction and its use to examine sex effects on diameter of day-10 or -11 pig embryos. J Anim Sci 1995;73:1408–15. [14] Bredbacha P, Kankaanpaa A, Peippo J. PCR-sexing of bovine embryos. A simplified protocol Theriogenology 1995;44:167–76.
1152
A. Martinez-Royo et al. / Theriogenology 72 (2009) 1148–1152
[15] Ng A, Sathasivam K, Laurie S, Notarianni E. Determination of sex and chimaerism in the domestic sheep by DNA amplification using HMG-box and microsatellite sequences. Anim Reprod Sci 1996;41(2):131–9. [16] Weikard R, Kuhn C, Brunner RM, Roschlau D, Pitra C, Laurent P, Schwerin M. Sex determination in cattle based on simultaneous amplification of a new male-specific DNA sequence and an autosomal locus using the same primers. Mol Reprod Dev 2001;60(1):13–9. [17] Kageyama S, Yoshida I, Kawakura K, Chikuni K. A novel repeated sequence located on the bovine Y chromosome: its application to rapid and precise embryo sexing by PCR. J Vet Med Sci 2004;66(5):509–14. [18] Kochhar HS, Buckrell BC, Pollard JW, King WA. Production of sexed lambs after biopsy of ovine blastocyts produced in vitro Can Vet J 2000;41(5):398–400. [19] Bredbacka P, Peippo J. Sex diagnosis of ovine and bovine embryos by enzymatic amplification and digestion of DNA from ZFX/ZFY locus. Agr Sci Finland 1992;1(2):233–8. [20] Ponz R, Ferrer LM, Monteagudo LV, Arruga MV., PCR diagnosis of sheep infertility due to chromosome aberrations: first cases in Rasa aragonesa sheep. In: Proocedings XXXI Jornadas cientı´ficas y X Internacionales SEOC, Junta de Castilla y Leo´n (Ed.), Gra´ficas Germinal S.C.L., 2006, pp. 170-3. [21] Aasen E, Medrano JF. Amplification of the ZFY and ZFX genes for sex identification in humans, cattle, sheep and goats. Biotechnology 1990;8:1279–81.
[22] Mara L, Pilichi S, Sanna A, Accardo C, Chessa B, Chessa F, et al. Sexing of in vitro produced ovine embryos by duplex PCR. Mol Reprod Dev 2004;69:35–42. [23] Pfeiffer I, Brenig B. X- and Y- chromosome specific variants of amelogenin gene allow sex determination in sheep (Ovis aries) and European red deer (Cervus elaphus). BMC Genet 2005;6:ARTN 16. [24] Weikard R, Pitra Ch, Ku¨hn Ch. Amelogenin cross-amplification in the family Bovidae and its application for sex determination. Mol Reprod Dev 2006;73:1333–7. [25] Dervishi E, Martı´nez-Royo A, Sa´nchez P, Alabart JL, Cocero MJ, Folch J, Calvo JH. Reliability of sex determination in ovine embryos using amelogenin gene (AMEL). Theriogenology 2008;70:241–7. [26] Gutierrez-Adan A, Cushwa WT, Anderson GB, Medrano JF. Ovine-specific Y-chromosome RAPD SCAR marker for embryo sexing. Anim Genet 1997;28:135–8. [27] Long SE. Some pathological conditions of the reproductive tract of the ewe. Vet Rec 1980;106:175–7. [28] Rejduch B, Slota E, Gustavsson I. 60,XY/60,XX chimerism in the germ cell line of mature bulls born in heterosexual twinning. Theriogenology 2000;54:621–7. [29] Seguin BE, Zhang TQ, Buoen LC, Weber AF, Ruth GR. Cytogenetic survey of Holstein bulls at a commercial artificial insemination company to determine prevalence of bulls with centric fusion and chimeric anomalies. J Am Vet Med Assoc 2000;216:65–7.