- Email: [email protected]
Functional analysis of the aroC gene encoding chorismate synthase from Xanthomonas oryzae pathovar oryzae
Microbiological Research 167 (2012) 326–331
Contents lists available at SciVerse ScienceDirect
Microbiological Research journal homepage: www.elsevier.de/micres
Functional analysis of the aroC gene encoding chorismate synthase from Xanthomonas oryzae pathovar oryzae Eun-Sung Song a,1 , Young-Jin Park c,1 , Tae-Hwan Noh b , Yeong-Tae Kim a , Jeong-Gu Kim a , Heejung Cho a , Byoung-Moo Lee a,∗ a
National Academy of Agricultural Science, Rural Development Administration, Suwon 441-707, Republic of Korea National Institute of Crop Science, Rural Development Administration, Iksan 570-880, Republic of Korea c Department of Applied Biochemistry, Konkuk University, Chung-ju 380-701, Republic of Korea b
a r t i c l e
i n f o
Article history: Received 15 September 2011 Received in revised form 26 October 2011 Accepted 4 November 2011 Keywords: aroC Mutant Pigment Xanthomonas oryzae pv. oryzae
a b s t r a c t Xanthomonas oryzae pv. oryzae causes bacterial blight in rice, and this bacterial blight has been widely found in the major rice-growing areas. We constructed a transposon mutagenesis library of X. oryzae pv. oryzae and identified a mutant strain (KXOM9) that is deficient for pigment production and virulence. Furthermore, the KXOM9 mutant was unable to grow in minimal medium lacking aromatic amino acids. Thermal asymmetric interlaced-PCR and sequence analysis of KXOM9 revealed that the transposon was inserted into the aroC gene, which encodes a chorismate synthase in various bacterial pathogens. In planta growth assays revealed that bacterial growth of the KXOM9 mutant in rice leaves was severely reduced. Genetic complementation of this mutant with a 7.9-kb fragment containing aroC restored virulence, pigmentation, and prototrophy. These results suggest that the aroC gene plays a crucial role in the growth, attenuation of virulence, and pigment production of X. oryzae pv. oryzae. © 2011 Elsevier GmbH. All rights reserved.
1. Introduction Xanthomonas oryzae pv. oryzae is a Gram-negative bacterium that causes bacterial blight in rice (Oryza sativa L). Bacterial blight disease has become a major rice disease in Asian countries, where high-yielding rice cultivars are often highly susceptible and yield losses can reach as high as 50% (Mew et al. 1993). The pathogen invades the rice plant through the water pores and wounds of the leaves. They multiply in the epitheme, move to the xylem vessels, and continue to grow until the xylem vessels are clogged with bacterial cells (Shen and Ronald 2002). In general, bacteria require the shikimate pathway for the synthesis of many crucial intermediates, including three aromatic amino acids (phenylalanine, tyrosine, and tryptophan). Also, the bacterial shikimate pathway serves almost exclusively to synthesize the aromatic amino acids, which are necessary for bacterial growth (Herrmann 1995). The biosynthesis of these aromatic amino acids proceeds via the common seven-step shikimate pathway to the branch point intermediate, chorismate. This precursor is subsequently converted to the three aromatic amino
∗ Corresponding author. Tel.: +82 31 299 1643. E-mail addresses: [email protected], [email protected] (B.-M. Lee). 1 These authors are joint first authors. 0944-5013/$ – see front matter © 2011 Elsevier GmbH. All rights reserved. doi:10.1016/j.micres.2011.11.002
acids via three specific terminal pathways (Herrmann and Weaver 1999). In pathogenic bacteria, mutations of genes involved in certain metabolic pathways, such as the purine biosynthethic pathway, result in the development of attenuated strains that are unable to grow in the host (Shen and Ronald 2002; Park et al. 2007). These mutations can lead to auxotrophy, and it is likely that the attenuation of virulence is due to an inability to grow within the host (Subramoni et al. 2006). Also, mutations in genes involved in the shikimate pathway in X. oryzae pv. oryzae can lead to deficiency in virulence – and pigment, as well as auxotrophy for aromatic amino acids (Goel et al. 2001; Park et al. 2009). Recently, the whole genome sequence of 3 X. oryzae pv. oryzae strains KACC10331, MAFF 311018, and PXO99A, were determined (GenBank accession numbers AE013598, AP008229, and CP000967), and genes associated with the shikimate pathway were predicted from the three genome sequences. However, the functions of the aroC gene associated with the shikimate pathway in X. oryzae pv. oyrzae have not been characterized. In the shikimate pathway, aroC encodes chorismate synthase, which is the final enzyme in the pathway and catalyzes the conversion of 5enolpyruvylshikmate-3-phosphate to chorismate (Herrmann and Weaver 1999). In this study, we verified that mutation of the aroC gene affects pigment production and attenuation of virulence in X. oyrzae pv. oryzae.
E.-S. Song et al. / Microbiological Research 167 (2012) 326–331
327
2. Materials and methods
2.4. Quantification of pigment production and auxotrophic assays
2.1. Bacterial strains, plasmids, and culture conditions
Pigment extraction from X. oryzae pv. oryzae strains was performed using a previously described method (Park et al. 2009). The amount of pigment extracted from 0.5 mg (dry weight) of each strain was expressed as the absorbance (OD445 nm ) of the crude pigment extract (Park et al. 2009). The assay was performed three times, and the averages and standard deviations were calculated for each experiment. Auxotrophic assays of each strain were performed using a previously described method (Park et al. 2007). Each culture was inoculated in 5 ml of modified Miller’s minimal medium (Kelemu and Leach 1990) supplemented with 0.001–1 mM each of phenylalanine, tyrosine, and tryptophan (Sigma). In addition, the bacterial cells were inoculated in 5 ml of modified Miller’s minimal medium supplemented with 1 mM of phenylalanine and tryptophan, phenylalanine and tyrosine, or tyrosine and tryptophan. After incubation for 5 days at 28 ◦ C in a shaking incubator, the optical density of each strain was measured using the Genesys-20 spectrophotometer (Thermo Spectronic).
Bacterial strains and plasmids used in this study are listed in Table 1. The X. oryzae pv. oryze KACC10859 strain was obtained from the Korean Agricultural Culture Collection (KACC) in Suwon, Korea. All X. oryzae pv. oryze strains were cultured at 28 ◦ C on YDC medium (2% d-glucose, 2% CaCO3 , 1% yeast extract, and 1.5% agar) or on nutrient agar (NA) medium (3% beef extract, 5% peptone, and 1.5% agar, Difco). The Escherichia coli strain was grown at 37 ◦ C in Luria-Bertani (LB) medium. Antibiotics were used at the following concentrations: ampicillin, 200 g/ml; kanamycin, 10 g/ml; and spectinomycin, 100 g/ml.
2.2. Transposon mutagenesis and molecular analysis of the aroC mutant Insertional mutagenesis was performed by using a transposomeTM (20 ng/ml; Epicentre Technologies), and the insertion site was analyzed by thermal asymmetric interlaced (TAIL)-PCR according to a previously described method (Park et al. 2007). The sequencing reaction and sequence data analysis were performed with an ABI Prism 3100 automatic DNA sequencer (Applied Biosystems) and was analyzed for similarities by using the BLASTN and BLSATX algorithms available at the National Center for Biotechnology Information (NCBI) GenBank database. The KXOM9 mutant was analyzed by PCR with the primers AROF (5 -ATGAGTGCCAATGCGTTCGG-3 ) and AROR (5 -TCAGACATCGACCTGACCGG-3 ), corresponding to the aroC open reading frame (ORF) sequence. The PCR reaction was carried out in a PTC-225 thermocycler (MJ Research) with the following profile: initial denaturation at 95 ◦ C for 5 min followed by 25 cycles at 95 ◦ C for 30 s, 60 ◦ C for 30 s, and 72 ◦ C for 1 min; and a final 5 min extension at 72 ◦ C. For Southern hybridization, genomic DNA was digested with EcoRI (Toyobo), electrophoresed, and transferred to a Hybond-N+ membrane (Amersham Bioscience). The kanamycin gene in the transposon was amplified by PCR with the primers KANF (5 -CAATCAGGTGCGACAATC-3 ) and KANR (5 TCACCGAGGCAGTTCCAT-3 ) and labeled as a probe with [␣-32 P] dCTP (Ladderman Labeling kit, Takara). The pre-hybridization and hybridization were conducted as described by Sambrook and Russell (2001).
2.3. Virulence and in planta growth assays Virulence assays of X. oyrzae pv. oryzae strains were performed with 40- to 50-day-old specimens of the susceptible rice cultivar IR24 by a previously described method (Park et al. 2007). The rice plants were than grown in a greenhouse at 25–30 ◦ C with a relative humidity of 60%. Leaves clipped with scissors and dipped in distilled water were used as the control. Lesion lengths were measured 21 days after inoculation. Plant growth assays of X. oyrzae pv. oryzae strains were performed with a previously described method (Hu et al. 2007), with some modifications. Leaves were harvested at 4-day intervals and ground in 10 mM MgCl2 . A serially diluted homogenate (in 10 mM MgCl2 ) was spread on NA media (containing 10 g/ml kanamycin for mutant). After incubation at 28 ◦ C for 4 days, colony-forming units (CFU) of each strain were calculated. The assay was performed three times, and averages and standard deviations were calculated for each experiment.
2.5. Complementation test A 7.9-kb DNA fragment containing the aroC gene was amplified form wild-type genomic DNA by PCR with the primers AROC3F (5 AAGCTTATGAGTGCCAATGCGTTCGG-3 ; HindIII restriction site is underlined) and AROC3R (5 -AAGCTTTCACGACATCTCGTGACAAT3 ; HindIII restriction site is underlined) and the PCR product was cloned into the pGEM-T easy vector (Promega). After confirming the DNA sequence, the plasmid was digested with HindIII and ligated into the corresponding sites of the broad host-range vector pHM1 to obtain the complementary plasmid pHMAROC3. The plasmid pHMAROC3 was introduced into the KXOM9 mutant strain by electroporation to obtain the complemented strain. 2.6. Reverse transcriptase (RT)-PCR assays As a template, total RNA from the wild-type and KXOM9 strains was isolated using the RNeasy Plus Mini Kit (Qiagen). Reverse transcription was performed using the Sensiscript RT kit as indicated by the manufacturer (Qiagen). Two microliters of the cDNA products and the gene-specific primers (Table 2) were added to the PCR reaction mixtures containing 10 pmol of the genespecific primer, 10 mM dNTPs, 1 U Taq DNA polymerase (Toyobo), and 10× Taq buffer supplied by the manufacturer. Each reaction included an initial 5 min of denaturation at 94 ◦ C, followed by 25 cycles of PCR (94 ◦ C for 15 s, 58 ◦ C for 15 s, and 72 ◦ C for 30 s), and a final extension for 5 min at 72 ◦ C. Subsequently, 5 l of each reaction mixture was separated on a 1% agarose gel. The sequence of the 16S rRNA gene was used for the control, using the pirmers 16SF (5 -ATCCGTAGCTGGTCTGAG-3 ) and 16SR (5 ATGGCTGGATCAGGCTTG-3 ). 3. Results 3.1. Molecular characterization of the mutant KXOM9 strain TAIL-PCR and sequencing analysis revealed that the transposon is inserted at the 719th nucleotide of the aroC gene in the reverse orientation (Fig. 1A). This gene harbors a 1104-bp ORF and encodes a 368-amino acid long chorismate synthase. Transposon insertion into the aroC gene of the KXOM9 mutant was further confirmed by PCR and Southern hybridization analysis. A 2325-bp fragment was amplified from this mutant by PCR using the AROF and AROR primers (Fig. 1B). In Southern hybridization analysis, a single positive signal was identified in the KXOM9 mutant by using the PCR
328
E.-S. Song et al. / Microbiological Research 167 (2012) 326–331
Table 1 Bacterial strains and plasmids used in this study. Strains or plasmid Escherichia coli DH5␣ Plasmids pGEM-T-Easy vector pHM1 pHMAROC pHMAROC1 pHMAROC2 pHMAROC3 X. oryzae pv. oryzae strains KACC10859 KXOM9 KXOM9c KXOM91c KXOM92c KXOM93c a b
Characteristicsa
References
F-(80d lacZ M15)(lacZYA-argF)U169 hsdR17(r- m+) recA1 endA1 relA1 deoR
RBC Real biotech
Cloning vector, Apr Spr cos parA IncW derivative of pRI40 pHM1 carrying the 1.1-kb HindIII fragment containing ORF of aroC pHM1 carrying the 3.2-kb HindIII fragment, including aroC to asd genes pHM1 carrying the 7.2-kb HindIII fragment, including aroC to truA genes pHM1 carrying the 7.9-kb HindIII fragment, including aroC to trpF genes
Promega Lab collection This study This study This study This study
Wild-type strain Transposon inserted in the aroC gene, mutant strain pHMAROC3 electroporated in KXOM9 pHMAROC electroporated in KXOM9 pHMAROC1 electroporated in KXOM9 pHMAROC2 electroporated in KXOM9
KACCb This study This study This study This study This study
Apr , ampicillin resistance; Spr , spectinomycin resistance. KACC, Korean Agricultural Culture Collection.
Table 2 Primers used for reverse transcription and PCR. ORF ID
Genea and description
Forward primer (5 –3 )
Reverse primer (5 –3 )
XOO3261 XOO3260 XOO3259 XOO3258 XOO3255 XOO3254
aroC 2-hydroxyacid dehydrogenase asd FimV truA trpF
TCGACTGGGATGCGGTGGAAGACA CGGGTCGGTGCGGCGGAAATC GCAGGCGGCAGCGTGTCT CGCACGCCGCAGGAAGACG GAGTACGACGGCAGCGAGTTCC ACCGCACCCGTATCAAGTT
TCGTGCCGGCCGGTGGTGATGAC CGCCAGCAAGGTATCGAACTCAAC CTTCCTTGGTGTAGCCGTTGTCCT CACGGCAGCGACGATCAACACCAG ACCAAAATCAGCGAGCCCACAATA CCGCCGGCCAGCAGAAA
a
All genes sequences were attained from the X. oryzae KACC10331 genome (GenBank accession no. AE013598).
product of the kanamycin-resistant gene as a probe (Fig. 1C). These results indicated that the single transposon was inserted into the aroC gene of the mutant KXOM9 genome. 3.2. Virulence assay and in planta growth of the mutant In the virulence assay, the KXOM9 mutant showed severely decreased virulence to the susceptible rice cultivar IR24. Twentyone days after inoculation, the average length of the lesion caused by the KXOM9 mutant was 1.6 cm, whereas the length of the lesion caused by the wild-type strain was 21.7 cm (Fig. 2). For in planta growth assays, the mutant and wild-type strains were inoculated on rice cultivar IR24 by leaf clipping. Maximal
Fig. 1. Molecular analysis of the KXOM9 mutant strain. (A) The aroC gene flanking region of the KXOM9 mutant strain. The solid triangle indicates the site of the Tn5 transposon insertion. E, EcoRI; S, SphI; P, PstI. PCR assay and Southern hybridization analysis for reaffirmation of transposon insertion in the aroC gene: M, 1-kb ladder; lane 1, wild-type; lane 2, KXOM9 (B, C).
bacterial numbers of the mutant were reached 12 days after inoculation (4.09 × 107 CFU/ml) and then remained constant for 20 days, whereas the wild-type strain continued to multiply and reached a maximal population 16 days after inoculation (5.19 × 109 CFU/ml). Maximal bacterial numbers of the KXOM9 strain were only 2.7% of those of the wild-type strain in rice plants (Fig. 3). For the complementation test, a DNA fragment containing the aroC gene was cloned into the broad-host-range plasmid pHM1. The resulting plasmid was introduced into the KXOM9 mutant by electroporation. To test virulence and in planta growth of this complemented strain (KXOM9c), rice cultivar IR24 was inoculated. The
Fig. 2. Virulence of X. oryzae pv. oyrzae strains on the susceptible rice cultivar IR24. Lesion lengths were measured 3 weeks after inoculation. The virulence assay was performed three times, and the averages and standard deviations of lesion length were calculated for each repetition of the experiment. DW was used as the control.
E.-S. Song et al. / Microbiological Research 167 (2012) 326–331
329
3.4. Growth of the mutant KXOM9 strain
Fig. 3. In planta growth of X. oryzea pv. oryzae strains on rice leaves after inoculation. Bacterial numbers were determined every 4 days after inoculation. Mean CFU per leaf was calculated from three independent experiments. Standard deviation for each value is shown.
average lesion length caused by the KXOM9c strain ranged from 17.6 to 18.4 cm, similar to that of the wild-type strain (Fig. 2). In addition, in planta growth of the KXOM9c strain was nearly identical to that of the wild-type strain (Fig. 3). These results indicated that mutation of the aroC gene contributes to attenuated virulence as well as reduction of bacterial growth of X. oryzae pv. oryzae in the host plant.
3.3. Pigment production in the mutant Pigment was extracted from wild-type and KXOM9 strains and quantified as described in Materials and methods section. Pigment production by the mutant was considerably reduced (Fig. 4). The average OD value of the pigment extracted from the mutant was 0.042, whereas that of the pigment extracted from the wild-type strain was 0.474. In the complementation test, pigment production by the KXOM9c strain was 0.418 OD445 nm , similar to that of the wild-type strain (Fig. 4). These results indicated that mutation of the aroC gene affects pigment production in X. oryzae pv. oryzae.
Fig. 4. Pigment production assay of the wild-type, mutant, and complemented strains. The assay was performed three times, and the average and standard deviations of pigment production were calculated for each repetition of the experiment.
To evaluate the minimum concentration of aromatic amino acids required for bacterial cell growth, the KXOM9 mutant was incubated in minimal media supplemented with 0.001–1 mM of phenylalanine, tyrosine, and tryptophan. The KXOM9 mutant was able to grow in minimal media supplemented with more than 0.01 mM of the three aromatic amino acids. In minimal media supplemented with 1 mM of the three aromatic amino acids, the average growth of the mutant was 1.625 OD600 nm , similar to that of the wild-type and complemented strain (Fig. 5). Interestingly, the mutant did not grow in the minimal media supplemented with tyrosine and phenylalanine or tryptophan (data not shown). However, the growth rate of the mutant was about 50% less than that of wild-type strain in minimal media supplemented with 1 mM each of phenylalanine and tryptophan (Fig. 6). Also, the complemented strain KXOM9c was able to grow in minimal media irrespective of the addition of aromatic amino acids (Figs. 5 and 6). These results indicate that aromatic amino acid auxotrophy caused by a mutation in the aroC gene is effectively overcome by the addition of all three aromatic amino acids, phenylalanine, tyrosine, and tryptophan. 3.5. RT-PCR assay RT-PCR was performed to confirm the effect of disruption of the aroC gene on the expression of the respective genes within the same orientation. RNA was extracted from the KXOM9 mutant and primers specific to each of the six genes were used (Table 2). The RTPCR results revealed that the expression of five genes downstream of the KXOM9, Xoo3260 (2-hydroxyacid dehydrogenase), Xoo3259 (asd), Xoo3258 (FimV), Xoo3255 (truA), and Xoo3254 (trpF), was downregulated by the mutation in the aroC gene (Fig. 7). Also, no RT-PCR product was obtained when aroC gene-specific primers were used. These data indicate that mutation of the aroC gene affects the expression of other genes (located downstream of aroC), including the trpF gene, within the same orientation. 4. Discussion We constructed a random insertion mutant library of X. oryzae pv. oyrzae and identified a mutant, KXOM9, that is deficient for pigment production and virulence against rice, as well as auxotrophic for aromatic amino acids. Sequence analysis of KXOM9 revealed that the transposon was inserted into the aroC gene, which encodes a chorismate synthase, an enzyme in the shikimate pathway. A striking feature of the genus Xanthomonas, including X. oyrzae pv. oryzae, is the production of yellow, membrane-bound, halogenated, aryl-ployene pigments called xanthomonadins (Andrewes et al. 1976; Starr 1981) that have been used as diagnostic and taxonomic markers (Starr et al. 1977). In one study, pigmentdeficient mutants that were isolated from Xanthomonas campestris pv. campestris were unaffected with regard to their pathogenicity and in planta growth in the host plant, suggesting that the pigments do not play an important role in pathogenesis (Poplawsky and Chun 1997). However, X. oryzae pv. oryzae mutants deficient in pigment production were isolated and identified to be deficient for virulence in rice plants. Genetic studies indicated that the deficiencies in pigment - and virulence of the X. oryzae pv. oyrzae mutant are due to mutations in genes involved in the shikimate pathway (Goel et al. 2001; Park et al. 2009). These results suggest that disruptions in genes involved in the shikimate pathway of X. oryzae pv. oyrzae, including aroC, are responsible for pigment production and attenuation of virulence. Previous studies have indicated that mutants of pathogenic bacteria that lack any of the enzymes of the shikimate pathway require
330
E.-S. Song et al. / Microbiological Research 167 (2012) 326–331
Fig. 5. Growth of the wild-type, mutant, and complemented strains in minimal media supplemented with phenylalanine, tyrosine and tryptophan. The concentrations of aromatic amino acids ranged from 0.001 to 1 mM. The values are represented as means and standard deviations based on three independent experiments.
aromatic amino acids for growth and are thus unable to grow in the host (Herrmann 1995; Bereswill et al. 1997). It has also been reported that aromatic amino acid auxotrophs show deficiency in their virulence for rice plants (Goel et al. 2001; Park et al. 2009). In planta growth analysis of the KXOM9 mutant showed that growth of this mutant in rice leaves was severely reduced compared to the wild-type strain (Fig. 3). These results suggest that the attenuation of virulence of KXOM9 may be due to an inability to use sufficient aromatic amino acids in the host. Interestingly, we were able to obtain the complemented strain (KXOM9c) with a clone (pHMAROC3) containing a 7.9-kb fragment, including the aroC to trpF genes (Fig. 1A). When the pHMAROC, pHMAROC1, and pHMAROC2 clones were introduced into the KXOM9 strain (Table 1), this strain could not recover its virulence and pigment production, and was unable to grow in minimal media (data not shown). We found that the trpF gene is located downstream of the aroC gene. The trpF gene encodes N(5-phosphoribosyl) anthranilate isomerase (PRAI), which catalyzes the conversion of N-(5-phosphoribosyl) anthranilate (PRA) to l(o-carboxyphenylamino)-1-deoxyribulose 5-phosphate (CDRP) in the third step of tryptophan biosynthesis (Ross et al. 1990). Transcriptional analysis of the KXOM9 strain revealed that mutation of aroC downregulated the expression of all five genes (Xoo3260,
Xoo3259, Xoo3258, Xoo3255, and Xoo3254) (Fig. 7). These results suggest that this co-regulation may be due to the polar effect the mutation of one gene effecting the expression of other genes in the same operon (Park et al. 2009). Moreover, the addition of phenylalanine and tryptophan to minimal media supported the growth of the KXOM9 mutant (Fig. 6). In contrast, the KXOM9 mutant did not grow on minimal media supplemented with phenylalanine and tyrosine or tyrosine and tryptophan (data not shown). Zhao et al. (1994) reported that the phhA gene encodes phenylalanine 4-monooxygenase, which catalyzes the conversion of phenylalanine to tyrosine in the first reaction of phenylalanine metabolism. Thus, these results suggest that this mutant might utilize the tyrosine through the salvage pathway. In addition, auxotrophic assays revealed that aromatic amino acid auxotrophy caused by disruption in genes involved in the shikimate pathway is effectively overcome by the addition of phenylalanine, tryptophan, and tyrosine. In conclusion, the aroC gene of X. oryzae pv. oryzae plays a crucial role in growth, attenuation of virulence, and pigment production. The shikimate pathway has been found in bacteria, fungi, and plants, whereas it is absent in mammals. These results suggest that the aroC gene can be used as an important target for development of antibacterial agents against X. oryzae pv. oyrzae.
Fig. 6. Growth of the wild-type, mutant, and complemented strains in minimal media supplemented with 1 mM phenylalanine and tryptophan. The values are represented as means and standard deviations based on three independent experiments.
Fig. 7. RT-PCR assay of seven genes of the wild-type (lane 1) and KXOM9 strains (lane 2). Xoo3261, aroC; Xoo3260, 2-hydroxyacid dehydrogenase; Xoo3259, asd; Xoo3258, FimV; Xoo3255, truA; Xoo3254, trpF; and 16S rRNA gene.
E.-S. Song et al. / Microbiological Research 167 (2012) 326–331
Acknowledgements This work was supported by a 2011 Postdoctoral Fellowship Program of the National Academy of Agricultural Science (No. PJ0066312011) and by the Next-Generation BioGreen 21 program (No. PJ008099032011), Rural Development Administration, Republic of Korea. References Andrewes AG, Jenkins CL, Starr MP, Shepherd J, Hope H. Structure of xanthomonadin I, a novel dibrominated aryl-ployene pigment produced by the bacterium Xanthomonas juglandis. Tetrahedron Lett 1976;45:4023–4. Bereswill S, Faßbinder F, Völzing C, Haas R, Reuter K, Ficner R, Kist M. Cloning and functional characterization of the genes encoding 3-dehydrogquinate synthase (aroB) and tRNA-quanine transglycosylase (tgt) from Helicobacter pylori. Med Microbiol Immunol 1997;186:125–34. Goel AK, Rajagopal L, Sonti RV. Pigment and virulence deficiencies associated with mutations in the aroE gene of Xanthomonas oryzae pv. oryzae. Appl Environ Microbiol 2001;67:245–50. Herrmann KM. The skihimate pathway: early steps in the biosynthesis of aromatic compounds. Plant Cell 1995;7:907–19. Herrmann KM, Weaver LM. The skihimate pathway. Annu Rev Plant Phys 1999;50:473–503. Hu J, Qian W, He C. The Xanthomonas oryzae pv. oryzae eglXoB endoglucanase gene is required for virulence to rice. FEMS Microbiol Lett 2007;269:273–9. Kelemu S, Leach JE. Cloning and characterization of an avirulence gene from Xanthomonas campestris pv. oryzae. Mol Plant Microbe Interact 1990;3:59–65.
331
Mew TW, Alvarez AM, Leach JE, Swing J. Focus on bacterial blight of rice. Plant Dis 1993;77:5–12. Park YJ, Song ES, Kim YT, Noh TH, Kang HY, Lee BM. Analysis of virulence and growth of a purine auxotrophic mutant of Xanthomonas oyrzae pathovar oryzae. FEMS Microbiol Lett 2007;276:55–9. Park YJ, Song ES, Noh TH, Kim H, Yang KS, Hahn JH, Kang HW, Lee BM. Virulence analysis and gene expression profiling of the pigment-deficient mutant of Xanthomonas oryzae pathovar oryzae. FEMS Microbiol Lett 2009;301: 149–55. Poplawsky AR, Chun W. pigB determines a diffusible factor needed for EPS and xanthomonadin production in Xanthomonas campestris pv. campestris. J Bacteriol 1997;179:439–44. Ross CM, Kaplan JB, Winkler ME, Nichols BP. An evolutionary comparison of Acinetobacter calcoaceticus trpF with trpF genes of several organisms. Mol Biol Evol 1990;7:74–81. Sambrook J, Russell DW. Molecular cloning: a laboratory manual. 3rd ed. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press; 2001. Shen Y, Ronald P. Molecular determinants of disease and resistance in interactions of Xanthomonas oyrzae pv. oyrzae and rice. Microbes Infect 2002;4:1361–7. Starr MP. The genus Xanthomonas. In: Starr MP, Stolp H, Truper GH, Balows A, Schlegel GH, editors. The Prokaryotes, vol. 1. Berlin: Springer Verlag; 1981. p. 742–63. Starr MP, Jenkins CL, Bussey LB, Andrewes AG. Chemotaxonomic significance of the xanthomonadins, novel brominated aryl polyene pigments produced by bacteria of the genus Xanthomonas. Arch Microbiol 1977;113:1–9. Subramoni S, Jha G, Sonti PV. Plant-associated bacteria: virulence functions of Xanthomonads. The Netherlands: Springer; 2006, 535–571. Zhao G, Xia T, Song J, Jensen RA. Pseudomonas aeruginosa possesses homologues of mammalian phenylalanine hydroxylase and 4␣-carbinolamine dehydratase/DCoH as part of a three-component gene cluster. Proc Natl Acad Sci USA 1994;91:1366–70.
Contents lists available at SciVerse ScienceDirect
Microbiological Research journal homepage: www.elsevier.de/micres
Functional analysis of the aroC gene encoding chorismate synthase from Xanthomonas oryzae pathovar oryzae Eun-Sung Song a,1 , Young-Jin Park c,1 , Tae-Hwan Noh b , Yeong-Tae Kim a , Jeong-Gu Kim a , Heejung Cho a , Byoung-Moo Lee a,∗ a
National Academy of Agricultural Science, Rural Development Administration, Suwon 441-707, Republic of Korea National Institute of Crop Science, Rural Development Administration, Iksan 570-880, Republic of Korea c Department of Applied Biochemistry, Konkuk University, Chung-ju 380-701, Republic of Korea b
a r t i c l e
i n f o
Article history: Received 15 September 2011 Received in revised form 26 October 2011 Accepted 4 November 2011 Keywords: aroC Mutant Pigment Xanthomonas oryzae pv. oryzae
a b s t r a c t Xanthomonas oryzae pv. oryzae causes bacterial blight in rice, and this bacterial blight has been widely found in the major rice-growing areas. We constructed a transposon mutagenesis library of X. oryzae pv. oryzae and identified a mutant strain (KXOM9) that is deficient for pigment production and virulence. Furthermore, the KXOM9 mutant was unable to grow in minimal medium lacking aromatic amino acids. Thermal asymmetric interlaced-PCR and sequence analysis of KXOM9 revealed that the transposon was inserted into the aroC gene, which encodes a chorismate synthase in various bacterial pathogens. In planta growth assays revealed that bacterial growth of the KXOM9 mutant in rice leaves was severely reduced. Genetic complementation of this mutant with a 7.9-kb fragment containing aroC restored virulence, pigmentation, and prototrophy. These results suggest that the aroC gene plays a crucial role in the growth, attenuation of virulence, and pigment production of X. oryzae pv. oryzae. © 2011 Elsevier GmbH. All rights reserved.
1. Introduction Xanthomonas oryzae pv. oryzae is a Gram-negative bacterium that causes bacterial blight in rice (Oryza sativa L). Bacterial blight disease has become a major rice disease in Asian countries, where high-yielding rice cultivars are often highly susceptible and yield losses can reach as high as 50% (Mew et al. 1993). The pathogen invades the rice plant through the water pores and wounds of the leaves. They multiply in the epitheme, move to the xylem vessels, and continue to grow until the xylem vessels are clogged with bacterial cells (Shen and Ronald 2002). In general, bacteria require the shikimate pathway for the synthesis of many crucial intermediates, including three aromatic amino acids (phenylalanine, tyrosine, and tryptophan). Also, the bacterial shikimate pathway serves almost exclusively to synthesize the aromatic amino acids, which are necessary for bacterial growth (Herrmann 1995). The biosynthesis of these aromatic amino acids proceeds via the common seven-step shikimate pathway to the branch point intermediate, chorismate. This precursor is subsequently converted to the three aromatic amino
∗ Corresponding author. Tel.: +82 31 299 1643. E-mail addresses: [email protected], [email protected] (B.-M. Lee). 1 These authors are joint first authors. 0944-5013/$ – see front matter © 2011 Elsevier GmbH. All rights reserved. doi:10.1016/j.micres.2011.11.002
acids via three specific terminal pathways (Herrmann and Weaver 1999). In pathogenic bacteria, mutations of genes involved in certain metabolic pathways, such as the purine biosynthethic pathway, result in the development of attenuated strains that are unable to grow in the host (Shen and Ronald 2002; Park et al. 2007). These mutations can lead to auxotrophy, and it is likely that the attenuation of virulence is due to an inability to grow within the host (Subramoni et al. 2006). Also, mutations in genes involved in the shikimate pathway in X. oryzae pv. oryzae can lead to deficiency in virulence – and pigment, as well as auxotrophy for aromatic amino acids (Goel et al. 2001; Park et al. 2009). Recently, the whole genome sequence of 3 X. oryzae pv. oryzae strains KACC10331, MAFF 311018, and PXO99A, were determined (GenBank accession numbers AE013598, AP008229, and CP000967), and genes associated with the shikimate pathway were predicted from the three genome sequences. However, the functions of the aroC gene associated with the shikimate pathway in X. oryzae pv. oyrzae have not been characterized. In the shikimate pathway, aroC encodes chorismate synthase, which is the final enzyme in the pathway and catalyzes the conversion of 5enolpyruvylshikmate-3-phosphate to chorismate (Herrmann and Weaver 1999). In this study, we verified that mutation of the aroC gene affects pigment production and attenuation of virulence in X. oyrzae pv. oryzae.
E.-S. Song et al. / Microbiological Research 167 (2012) 326–331
327
2. Materials and methods
2.4. Quantification of pigment production and auxotrophic assays
2.1. Bacterial strains, plasmids, and culture conditions
Pigment extraction from X. oryzae pv. oryzae strains was performed using a previously described method (Park et al. 2009). The amount of pigment extracted from 0.5 mg (dry weight) of each strain was expressed as the absorbance (OD445 nm ) of the crude pigment extract (Park et al. 2009). The assay was performed three times, and the averages and standard deviations were calculated for each experiment. Auxotrophic assays of each strain were performed using a previously described method (Park et al. 2007). Each culture was inoculated in 5 ml of modified Miller’s minimal medium (Kelemu and Leach 1990) supplemented with 0.001–1 mM each of phenylalanine, tyrosine, and tryptophan (Sigma). In addition, the bacterial cells were inoculated in 5 ml of modified Miller’s minimal medium supplemented with 1 mM of phenylalanine and tryptophan, phenylalanine and tyrosine, or tyrosine and tryptophan. After incubation for 5 days at 28 ◦ C in a shaking incubator, the optical density of each strain was measured using the Genesys-20 spectrophotometer (Thermo Spectronic).
Bacterial strains and plasmids used in this study are listed in Table 1. The X. oryzae pv. oryze KACC10859 strain was obtained from the Korean Agricultural Culture Collection (KACC) in Suwon, Korea. All X. oryzae pv. oryze strains were cultured at 28 ◦ C on YDC medium (2% d-glucose, 2% CaCO3 , 1% yeast extract, and 1.5% agar) or on nutrient agar (NA) medium (3% beef extract, 5% peptone, and 1.5% agar, Difco). The Escherichia coli strain was grown at 37 ◦ C in Luria-Bertani (LB) medium. Antibiotics were used at the following concentrations: ampicillin, 200 g/ml; kanamycin, 10 g/ml; and spectinomycin, 100 g/ml.
2.2. Transposon mutagenesis and molecular analysis of the aroC mutant Insertional mutagenesis was performed by using a transposomeTM (20 ng/ml; Epicentre Technologies), and the insertion site was analyzed by thermal asymmetric interlaced (TAIL)-PCR according to a previously described method (Park et al. 2007). The sequencing reaction and sequence data analysis were performed with an ABI Prism 3100 automatic DNA sequencer (Applied Biosystems) and was analyzed for similarities by using the BLASTN and BLSATX algorithms available at the National Center for Biotechnology Information (NCBI) GenBank database. The KXOM9 mutant was analyzed by PCR with the primers AROF (5 -ATGAGTGCCAATGCGTTCGG-3 ) and AROR (5 -TCAGACATCGACCTGACCGG-3 ), corresponding to the aroC open reading frame (ORF) sequence. The PCR reaction was carried out in a PTC-225 thermocycler (MJ Research) with the following profile: initial denaturation at 95 ◦ C for 5 min followed by 25 cycles at 95 ◦ C for 30 s, 60 ◦ C for 30 s, and 72 ◦ C for 1 min; and a final 5 min extension at 72 ◦ C. For Southern hybridization, genomic DNA was digested with EcoRI (Toyobo), electrophoresed, and transferred to a Hybond-N+ membrane (Amersham Bioscience). The kanamycin gene in the transposon was amplified by PCR with the primers KANF (5 -CAATCAGGTGCGACAATC-3 ) and KANR (5 TCACCGAGGCAGTTCCAT-3 ) and labeled as a probe with [␣-32 P] dCTP (Ladderman Labeling kit, Takara). The pre-hybridization and hybridization were conducted as described by Sambrook and Russell (2001).
2.3. Virulence and in planta growth assays Virulence assays of X. oyrzae pv. oryzae strains were performed with 40- to 50-day-old specimens of the susceptible rice cultivar IR24 by a previously described method (Park et al. 2007). The rice plants were than grown in a greenhouse at 25–30 ◦ C with a relative humidity of 60%. Leaves clipped with scissors and dipped in distilled water were used as the control. Lesion lengths were measured 21 days after inoculation. Plant growth assays of X. oyrzae pv. oryzae strains were performed with a previously described method (Hu et al. 2007), with some modifications. Leaves were harvested at 4-day intervals and ground in 10 mM MgCl2 . A serially diluted homogenate (in 10 mM MgCl2 ) was spread on NA media (containing 10 g/ml kanamycin for mutant). After incubation at 28 ◦ C for 4 days, colony-forming units (CFU) of each strain were calculated. The assay was performed three times, and averages and standard deviations were calculated for each experiment.
2.5. Complementation test A 7.9-kb DNA fragment containing the aroC gene was amplified form wild-type genomic DNA by PCR with the primers AROC3F (5 AAGCTTATGAGTGCCAATGCGTTCGG-3 ; HindIII restriction site is underlined) and AROC3R (5 -AAGCTTTCACGACATCTCGTGACAAT3 ; HindIII restriction site is underlined) and the PCR product was cloned into the pGEM-T easy vector (Promega). After confirming the DNA sequence, the plasmid was digested with HindIII and ligated into the corresponding sites of the broad host-range vector pHM1 to obtain the complementary plasmid pHMAROC3. The plasmid pHMAROC3 was introduced into the KXOM9 mutant strain by electroporation to obtain the complemented strain. 2.6. Reverse transcriptase (RT)-PCR assays As a template, total RNA from the wild-type and KXOM9 strains was isolated using the RNeasy Plus Mini Kit (Qiagen). Reverse transcription was performed using the Sensiscript RT kit as indicated by the manufacturer (Qiagen). Two microliters of the cDNA products and the gene-specific primers (Table 2) were added to the PCR reaction mixtures containing 10 pmol of the genespecific primer, 10 mM dNTPs, 1 U Taq DNA polymerase (Toyobo), and 10× Taq buffer supplied by the manufacturer. Each reaction included an initial 5 min of denaturation at 94 ◦ C, followed by 25 cycles of PCR (94 ◦ C for 15 s, 58 ◦ C for 15 s, and 72 ◦ C for 30 s), and a final extension for 5 min at 72 ◦ C. Subsequently, 5 l of each reaction mixture was separated on a 1% agarose gel. The sequence of the 16S rRNA gene was used for the control, using the pirmers 16SF (5 -ATCCGTAGCTGGTCTGAG-3 ) and 16SR (5 ATGGCTGGATCAGGCTTG-3 ). 3. Results 3.1. Molecular characterization of the mutant KXOM9 strain TAIL-PCR and sequencing analysis revealed that the transposon is inserted at the 719th nucleotide of the aroC gene in the reverse orientation (Fig. 1A). This gene harbors a 1104-bp ORF and encodes a 368-amino acid long chorismate synthase. Transposon insertion into the aroC gene of the KXOM9 mutant was further confirmed by PCR and Southern hybridization analysis. A 2325-bp fragment was amplified from this mutant by PCR using the AROF and AROR primers (Fig. 1B). In Southern hybridization analysis, a single positive signal was identified in the KXOM9 mutant by using the PCR
328
E.-S. Song et al. / Microbiological Research 167 (2012) 326–331
Table 1 Bacterial strains and plasmids used in this study. Strains or plasmid Escherichia coli DH5␣ Plasmids pGEM-T-Easy vector pHM1 pHMAROC pHMAROC1 pHMAROC2 pHMAROC3 X. oryzae pv. oryzae strains KACC10859 KXOM9 KXOM9c KXOM91c KXOM92c KXOM93c a b
Characteristicsa
References
F-(80d lacZ M15)(lacZYA-argF)U169 hsdR17(r- m+) recA1 endA1 relA1 deoR
RBC Real biotech
Cloning vector, Apr Spr cos parA IncW derivative of pRI40 pHM1 carrying the 1.1-kb HindIII fragment containing ORF of aroC pHM1 carrying the 3.2-kb HindIII fragment, including aroC to asd genes pHM1 carrying the 7.2-kb HindIII fragment, including aroC to truA genes pHM1 carrying the 7.9-kb HindIII fragment, including aroC to trpF genes
Promega Lab collection This study This study This study This study
Wild-type strain Transposon inserted in the aroC gene, mutant strain pHMAROC3 electroporated in KXOM9 pHMAROC electroporated in KXOM9 pHMAROC1 electroporated in KXOM9 pHMAROC2 electroporated in KXOM9
KACCb This study This study This study This study This study
Apr , ampicillin resistance; Spr , spectinomycin resistance. KACC, Korean Agricultural Culture Collection.
Table 2 Primers used for reverse transcription and PCR. ORF ID
Genea and description
Forward primer (5 –3 )
Reverse primer (5 –3 )
XOO3261 XOO3260 XOO3259 XOO3258 XOO3255 XOO3254
aroC 2-hydroxyacid dehydrogenase asd FimV truA trpF
TCGACTGGGATGCGGTGGAAGACA CGGGTCGGTGCGGCGGAAATC GCAGGCGGCAGCGTGTCT CGCACGCCGCAGGAAGACG GAGTACGACGGCAGCGAGTTCC ACCGCACCCGTATCAAGTT
TCGTGCCGGCCGGTGGTGATGAC CGCCAGCAAGGTATCGAACTCAAC CTTCCTTGGTGTAGCCGTTGTCCT CACGGCAGCGACGATCAACACCAG ACCAAAATCAGCGAGCCCACAATA CCGCCGGCCAGCAGAAA
a
All genes sequences were attained from the X. oryzae KACC10331 genome (GenBank accession no. AE013598).
product of the kanamycin-resistant gene as a probe (Fig. 1C). These results indicated that the single transposon was inserted into the aroC gene of the mutant KXOM9 genome. 3.2. Virulence assay and in planta growth of the mutant In the virulence assay, the KXOM9 mutant showed severely decreased virulence to the susceptible rice cultivar IR24. Twentyone days after inoculation, the average length of the lesion caused by the KXOM9 mutant was 1.6 cm, whereas the length of the lesion caused by the wild-type strain was 21.7 cm (Fig. 2). For in planta growth assays, the mutant and wild-type strains were inoculated on rice cultivar IR24 by leaf clipping. Maximal
Fig. 1. Molecular analysis of the KXOM9 mutant strain. (A) The aroC gene flanking region of the KXOM9 mutant strain. The solid triangle indicates the site of the Tn5 transposon insertion. E, EcoRI; S, SphI; P, PstI. PCR assay and Southern hybridization analysis for reaffirmation of transposon insertion in the aroC gene: M, 1-kb ladder; lane 1, wild-type; lane 2, KXOM9 (B, C).
bacterial numbers of the mutant were reached 12 days after inoculation (4.09 × 107 CFU/ml) and then remained constant for 20 days, whereas the wild-type strain continued to multiply and reached a maximal population 16 days after inoculation (5.19 × 109 CFU/ml). Maximal bacterial numbers of the KXOM9 strain were only 2.7% of those of the wild-type strain in rice plants (Fig. 3). For the complementation test, a DNA fragment containing the aroC gene was cloned into the broad-host-range plasmid pHM1. The resulting plasmid was introduced into the KXOM9 mutant by electroporation. To test virulence and in planta growth of this complemented strain (KXOM9c), rice cultivar IR24 was inoculated. The
Fig. 2. Virulence of X. oryzae pv. oyrzae strains on the susceptible rice cultivar IR24. Lesion lengths were measured 3 weeks after inoculation. The virulence assay was performed three times, and the averages and standard deviations of lesion length were calculated for each repetition of the experiment. DW was used as the control.
E.-S. Song et al. / Microbiological Research 167 (2012) 326–331
329
3.4. Growth of the mutant KXOM9 strain
Fig. 3. In planta growth of X. oryzea pv. oryzae strains on rice leaves after inoculation. Bacterial numbers were determined every 4 days after inoculation. Mean CFU per leaf was calculated from three independent experiments. Standard deviation for each value is shown.
average lesion length caused by the KXOM9c strain ranged from 17.6 to 18.4 cm, similar to that of the wild-type strain (Fig. 2). In addition, in planta growth of the KXOM9c strain was nearly identical to that of the wild-type strain (Fig. 3). These results indicated that mutation of the aroC gene contributes to attenuated virulence as well as reduction of bacterial growth of X. oryzae pv. oryzae in the host plant.
3.3. Pigment production in the mutant Pigment was extracted from wild-type and KXOM9 strains and quantified as described in Materials and methods section. Pigment production by the mutant was considerably reduced (Fig. 4). The average OD value of the pigment extracted from the mutant was 0.042, whereas that of the pigment extracted from the wild-type strain was 0.474. In the complementation test, pigment production by the KXOM9c strain was 0.418 OD445 nm , similar to that of the wild-type strain (Fig. 4). These results indicated that mutation of the aroC gene affects pigment production in X. oryzae pv. oryzae.
Fig. 4. Pigment production assay of the wild-type, mutant, and complemented strains. The assay was performed three times, and the average and standard deviations of pigment production were calculated for each repetition of the experiment.
To evaluate the minimum concentration of aromatic amino acids required for bacterial cell growth, the KXOM9 mutant was incubated in minimal media supplemented with 0.001–1 mM of phenylalanine, tyrosine, and tryptophan. The KXOM9 mutant was able to grow in minimal media supplemented with more than 0.01 mM of the three aromatic amino acids. In minimal media supplemented with 1 mM of the three aromatic amino acids, the average growth of the mutant was 1.625 OD600 nm , similar to that of the wild-type and complemented strain (Fig. 5). Interestingly, the mutant did not grow in the minimal media supplemented with tyrosine and phenylalanine or tryptophan (data not shown). However, the growth rate of the mutant was about 50% less than that of wild-type strain in minimal media supplemented with 1 mM each of phenylalanine and tryptophan (Fig. 6). Also, the complemented strain KXOM9c was able to grow in minimal media irrespective of the addition of aromatic amino acids (Figs. 5 and 6). These results indicate that aromatic amino acid auxotrophy caused by a mutation in the aroC gene is effectively overcome by the addition of all three aromatic amino acids, phenylalanine, tyrosine, and tryptophan. 3.5. RT-PCR assay RT-PCR was performed to confirm the effect of disruption of the aroC gene on the expression of the respective genes within the same orientation. RNA was extracted from the KXOM9 mutant and primers specific to each of the six genes were used (Table 2). The RTPCR results revealed that the expression of five genes downstream of the KXOM9, Xoo3260 (2-hydroxyacid dehydrogenase), Xoo3259 (asd), Xoo3258 (FimV), Xoo3255 (truA), and Xoo3254 (trpF), was downregulated by the mutation in the aroC gene (Fig. 7). Also, no RT-PCR product was obtained when aroC gene-specific primers were used. These data indicate that mutation of the aroC gene affects the expression of other genes (located downstream of aroC), including the trpF gene, within the same orientation. 4. Discussion We constructed a random insertion mutant library of X. oryzae pv. oyrzae and identified a mutant, KXOM9, that is deficient for pigment production and virulence against rice, as well as auxotrophic for aromatic amino acids. Sequence analysis of KXOM9 revealed that the transposon was inserted into the aroC gene, which encodes a chorismate synthase, an enzyme in the shikimate pathway. A striking feature of the genus Xanthomonas, including X. oyrzae pv. oryzae, is the production of yellow, membrane-bound, halogenated, aryl-ployene pigments called xanthomonadins (Andrewes et al. 1976; Starr 1981) that have been used as diagnostic and taxonomic markers (Starr et al. 1977). In one study, pigmentdeficient mutants that were isolated from Xanthomonas campestris pv. campestris were unaffected with regard to their pathogenicity and in planta growth in the host plant, suggesting that the pigments do not play an important role in pathogenesis (Poplawsky and Chun 1997). However, X. oryzae pv. oryzae mutants deficient in pigment production were isolated and identified to be deficient for virulence in rice plants. Genetic studies indicated that the deficiencies in pigment - and virulence of the X. oryzae pv. oyrzae mutant are due to mutations in genes involved in the shikimate pathway (Goel et al. 2001; Park et al. 2009). These results suggest that disruptions in genes involved in the shikimate pathway of X. oryzae pv. oyrzae, including aroC, are responsible for pigment production and attenuation of virulence. Previous studies have indicated that mutants of pathogenic bacteria that lack any of the enzymes of the shikimate pathway require
330
E.-S. Song et al. / Microbiological Research 167 (2012) 326–331
Fig. 5. Growth of the wild-type, mutant, and complemented strains in minimal media supplemented with phenylalanine, tyrosine and tryptophan. The concentrations of aromatic amino acids ranged from 0.001 to 1 mM. The values are represented as means and standard deviations based on three independent experiments.
aromatic amino acids for growth and are thus unable to grow in the host (Herrmann 1995; Bereswill et al. 1997). It has also been reported that aromatic amino acid auxotrophs show deficiency in their virulence for rice plants (Goel et al. 2001; Park et al. 2009). In planta growth analysis of the KXOM9 mutant showed that growth of this mutant in rice leaves was severely reduced compared to the wild-type strain (Fig. 3). These results suggest that the attenuation of virulence of KXOM9 may be due to an inability to use sufficient aromatic amino acids in the host. Interestingly, we were able to obtain the complemented strain (KXOM9c) with a clone (pHMAROC3) containing a 7.9-kb fragment, including the aroC to trpF genes (Fig. 1A). When the pHMAROC, pHMAROC1, and pHMAROC2 clones were introduced into the KXOM9 strain (Table 1), this strain could not recover its virulence and pigment production, and was unable to grow in minimal media (data not shown). We found that the trpF gene is located downstream of the aroC gene. The trpF gene encodes N(5-phosphoribosyl) anthranilate isomerase (PRAI), which catalyzes the conversion of N-(5-phosphoribosyl) anthranilate (PRA) to l(o-carboxyphenylamino)-1-deoxyribulose 5-phosphate (CDRP) in the third step of tryptophan biosynthesis (Ross et al. 1990). Transcriptional analysis of the KXOM9 strain revealed that mutation of aroC downregulated the expression of all five genes (Xoo3260,
Xoo3259, Xoo3258, Xoo3255, and Xoo3254) (Fig. 7). These results suggest that this co-regulation may be due to the polar effect the mutation of one gene effecting the expression of other genes in the same operon (Park et al. 2009). Moreover, the addition of phenylalanine and tryptophan to minimal media supported the growth of the KXOM9 mutant (Fig. 6). In contrast, the KXOM9 mutant did not grow on minimal media supplemented with phenylalanine and tyrosine or tyrosine and tryptophan (data not shown). Zhao et al. (1994) reported that the phhA gene encodes phenylalanine 4-monooxygenase, which catalyzes the conversion of phenylalanine to tyrosine in the first reaction of phenylalanine metabolism. Thus, these results suggest that this mutant might utilize the tyrosine through the salvage pathway. In addition, auxotrophic assays revealed that aromatic amino acid auxotrophy caused by disruption in genes involved in the shikimate pathway is effectively overcome by the addition of phenylalanine, tryptophan, and tyrosine. In conclusion, the aroC gene of X. oryzae pv. oryzae plays a crucial role in growth, attenuation of virulence, and pigment production. The shikimate pathway has been found in bacteria, fungi, and plants, whereas it is absent in mammals. These results suggest that the aroC gene can be used as an important target for development of antibacterial agents against X. oryzae pv. oyrzae.
Fig. 6. Growth of the wild-type, mutant, and complemented strains in minimal media supplemented with 1 mM phenylalanine and tryptophan. The values are represented as means and standard deviations based on three independent experiments.
Fig. 7. RT-PCR assay of seven genes of the wild-type (lane 1) and KXOM9 strains (lane 2). Xoo3261, aroC; Xoo3260, 2-hydroxyacid dehydrogenase; Xoo3259, asd; Xoo3258, FimV; Xoo3255, truA; Xoo3254, trpF; and 16S rRNA gene.
E.-S. Song et al. / Microbiological Research 167 (2012) 326–331
Acknowledgements This work was supported by a 2011 Postdoctoral Fellowship Program of the National Academy of Agricultural Science (No. PJ0066312011) and by the Next-Generation BioGreen 21 program (No. PJ008099032011), Rural Development Administration, Republic of Korea. References Andrewes AG, Jenkins CL, Starr MP, Shepherd J, Hope H. Structure of xanthomonadin I, a novel dibrominated aryl-ployene pigment produced by the bacterium Xanthomonas juglandis. Tetrahedron Lett 1976;45:4023–4. Bereswill S, Faßbinder F, Völzing C, Haas R, Reuter K, Ficner R, Kist M. Cloning and functional characterization of the genes encoding 3-dehydrogquinate synthase (aroB) and tRNA-quanine transglycosylase (tgt) from Helicobacter pylori. Med Microbiol Immunol 1997;186:125–34. Goel AK, Rajagopal L, Sonti RV. Pigment and virulence deficiencies associated with mutations in the aroE gene of Xanthomonas oryzae pv. oryzae. Appl Environ Microbiol 2001;67:245–50. Herrmann KM. The skihimate pathway: early steps in the biosynthesis of aromatic compounds. Plant Cell 1995;7:907–19. Herrmann KM, Weaver LM. The skihimate pathway. Annu Rev Plant Phys 1999;50:473–503. Hu J, Qian W, He C. The Xanthomonas oryzae pv. oryzae eglXoB endoglucanase gene is required for virulence to rice. FEMS Microbiol Lett 2007;269:273–9. Kelemu S, Leach JE. Cloning and characterization of an avirulence gene from Xanthomonas campestris pv. oryzae. Mol Plant Microbe Interact 1990;3:59–65.
331
Mew TW, Alvarez AM, Leach JE, Swing J. Focus on bacterial blight of rice. Plant Dis 1993;77:5–12. Park YJ, Song ES, Kim YT, Noh TH, Kang HY, Lee BM. Analysis of virulence and growth of a purine auxotrophic mutant of Xanthomonas oyrzae pathovar oryzae. FEMS Microbiol Lett 2007;276:55–9. Park YJ, Song ES, Noh TH, Kim H, Yang KS, Hahn JH, Kang HW, Lee BM. Virulence analysis and gene expression profiling of the pigment-deficient mutant of Xanthomonas oryzae pathovar oryzae. FEMS Microbiol Lett 2009;301: 149–55. Poplawsky AR, Chun W. pigB determines a diffusible factor needed for EPS and xanthomonadin production in Xanthomonas campestris pv. campestris. J Bacteriol 1997;179:439–44. Ross CM, Kaplan JB, Winkler ME, Nichols BP. An evolutionary comparison of Acinetobacter calcoaceticus trpF with trpF genes of several organisms. Mol Biol Evol 1990;7:74–81. Sambrook J, Russell DW. Molecular cloning: a laboratory manual. 3rd ed. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press; 2001. Shen Y, Ronald P. Molecular determinants of disease and resistance in interactions of Xanthomonas oyrzae pv. oyrzae and rice. Microbes Infect 2002;4:1361–7. Starr MP. The genus Xanthomonas. In: Starr MP, Stolp H, Truper GH, Balows A, Schlegel GH, editors. The Prokaryotes, vol. 1. Berlin: Springer Verlag; 1981. p. 742–63. Starr MP, Jenkins CL, Bussey LB, Andrewes AG. Chemotaxonomic significance of the xanthomonadins, novel brominated aryl polyene pigments produced by bacteria of the genus Xanthomonas. Arch Microbiol 1977;113:1–9. Subramoni S, Jha G, Sonti PV. Plant-associated bacteria: virulence functions of Xanthomonads. The Netherlands: Springer; 2006, 535–571. Zhao G, Xia T, Song J, Jensen RA. Pseudomonas aeruginosa possesses homologues of mammalian phenylalanine hydroxylase and 4␣-carbinolamine dehydratase/DCoH as part of a three-component gene cluster. Proc Natl Acad Sci USA 1994;91:1366–70.