Molecular analysis of the hrp gene cluster in Xanthomonas oryzae pathovar oryzae KACC10859

ARTICLE IN PRESS

MICROBIAL PATHOGENESIS Microbial Pathogenesis 44 (2008) 473–483 www.elsevier.com/locate/micpath

Molecular analysis of the hrp gene cluster in Xanthomonas oryzae pathovar oryzae KACC10859 Hee-Jung Choa, Young-Jin Parka, Tae-Hwan Nohb, Yeong-Tae Kima, Jeong-Gu Kima, Eun-Sung Songa, Dong-Hee Leec, Byoung-Moo Leea, a

Microbial Genetics Division, National Institute of Agricultural Biotechnology (NIAB), RDA, Suwon 441-707, Republic of Korea b Plant Environment Division, Honam Agricultural Research Institute (HARI), RDA, Iksan 570-080, Republic of Korea c Department of Life Science, Ewha Womans University, Seoul 120-750, Republic of Korea Received 31 July 2007; received in revised form 8 November 2007; accepted 14 December 2007 Available online 23 December 2007

Abstract Xanthomonas oryzae pathovar oryzae is the causal agent of rice bacterial blight. The plant pathogenic bacterium X. oryzae pv. oryzae expresses a type III secretion system that is necessary for both the pathogenicity in susceptible hosts and the induction of the hypersensitive response in resistant plants. This specialized protein transport system is encoded by a 32.18 kb hrp (hypersensitive response and pathogenicity) gene cluster. The hrp gene cluster is composed of nine hrp, nine hrc (hrp conserved) and eight hpa (hrp-associated) genes and is controlled by HrpG and HrpX, which are known as regulators of the hrp gene cluster. Before mutational analysis of these hrp genes, the transcriptional linkages of the core region of the hrp gene cluster from hpaB to hrcC of the X. oryzae pv. oryzae KACC10859 was determined and the non-polarity of EZTn5 insertional mutagenesis was demonstrated by reverse transcription polymerase chain reaction. Pathogenicity assays of these non-polar hrp mutants were carried out on the susceptible rice cultivar, Milyang-23. According to the results of these assays, all hrp–hrc, except hrpF, and hpaB mutants lost their pathogenicity, which indicates that most hrp–hrc genes encode essential pathogenicity factors. On the other hand, most hpa mutants showed decreased virulence in a different pattern, i.e., hpa genes are not essential but are important for pathogenicity. r 2007 Elsevier Ltd. All rights reserved. Keywords: Effector; Operon; Plant-inducible promoter (PIP) box; Transcription unit

1. Introduction Bacterial blight, caused by Xanthomonas oryzae pathovar oryzae, is one of the most destructive diseases of rice plants in the rice-growing regions. The causal organism invades the rice plant through the water pores and wounds of leaves. As a result, X. oryzae pv. oryzae causes a vascular disease resulting in tannish-gray to white lesions along the leaf veins, which results in yield losses [1]. Many Gram-negative plant pathogens cause disease through the type III secretion (TTS) systems, which are encoded by the hrp genes. The TTS systems are essential determinants of bacterial pathogenicity that control the Corresponding author. Tel.: +82 31 299 1764; fax: +82 31 299 1752.

E-mail addresses: [email protected] (H.-J. Cho), [email protected] (B.-M. Lee). 0882-4010/$ - see front matter r 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.micpath.2007.12.002

secretion and translocation of effector proteins to cause disease in susceptible hosts [2]. In resistant and non-host plants, the TTS systems are involved in the induction of the hypersensitive response (HR) manifested as rapid cell death at the infection site [3]. In xanthomonads, the hrp genes are highly conserved and clustered [4]. The whole genome sequence of X. oryzae pv. oryzae Korean Agricultural Culture Collection (KACC)10331 (AE013598) was determined and reported by a group from Korea in 2005 [5]. According to the genome sequence of X. oryzae pv. oryzae KACC10331, the hrp gene cluster was composed of nine hrp (hrpF, hrpE, hrpD6, hrpD5, hrpB1, hrpB2, hrpB4, hrpB5, and hrpB7), nine hrc (hrp conserved; hrcS, hrcR, hrcQ, hrcV, hrcU, hrcJ, hrcN, hrcT and hrcC) and eight hpa (hrp-associated; hpaF, hpaB, hpaA, hpaP, hpa1, hpa2, hpa3, and hpa4) genes. The expression of these genes is thought to be controlled by

ARTICLE IN PRESS H.-J. Cho et al. / Microbial Pathogenesis 44 (2008) 473–483

474

HrpG and HrpX, which are the OmpR family regulator and the AraC-type regulator, respectively [6,7]. In this study, we demonstrated the transcriptional linkages of the X. oryzae pv. oryzae KACC10859 hrp gene cluster using reverse transcription polymerase chain reaction (RT-PCR). The RT-PCR results showed that the core region of the hrp gene cluster including hpaB to hrcC is composed of three transcriptional units and each unit is transcribed as a polycistronic mRNA. Using mutational analysis of the hpaA gene in the operon and subsequent RT-PCR, it was demonstrated that EZTn5 insertional mutagenesis was non-polar. We assessed the pathogenicity of 28 hrp mutants, including 26 hrp genes in the hrp gene cluster as well as their regulatory genes, hrpG and hrpX. This is the first report on integration of the pathogenicity of all hrp genes in the hrp gene cluster of X. oryzae pv. oryzae. With the results of pathogenicity assays, we could figure the outline of the functions of proteins expressed from the hrp gene cluster. The same phenotype of hrp–hrc mutants provided a clue that Hrp–Hrc proteins were coordinated as structural components of the TTS system;

on the other hand, the differential phenotype of hpa mutants showed that Hpa proteins work individually according to each role. 2. Materials and methods 2.1. Bacterial strains and growth conditions The bacterial strains used in this study are listed in Table 1. X. oryzae pv. oryzae strain KACC10859 was obtained from the KACC in the National Institute of Agricultural Biotechnology, Rural Development Administration, Korea. The X. oryzae pv. oryzae strains were grown in Nutrient broth (NB; 0.3% beef extract, 0.5% peptone, Difco) or on YDC plates (1% yeast extract, 2% D-glucose, 2% calcium carbonate and 2% agar) at 28 1C. Escherichia coli DH5a cells (Gibco-BRL) were cultivated in Luria–Bertani broth (LB; 1% bacto tryptone, 0.5% bactoyeast extract, 0.5% sodium chloride) or on LB agar (2% agar) plates at 37 1C. Antibiotics were used at the following concentrations: 100 mg/ml ampicillin or 30 mg/ml

Table 1 Bacterial strains used in this study Strain Escherichia coli DH5a

Characteristics

Source of reference

 + F j80dlacZDM15 D(lacZYA-argF)U169 endA1 deoR recA1 hsdR17(r KmK ) phoA supE44 l thi-l gyrA96 relA1

Gibco-BRL

Xanthomonas oryzae pv. oryzae KACC10859 Wild type, Korean race 1 hpaF::EZTn5 Xoo KACC10859 hpaF::EZTn5/KAN-2S, 722/1942 (+)b hrpF:: EZTn5 Xoo KACC10859 hrpF:: EZTn5/KAN-2S, 379/2409 (+) hpaB:: EZTn5 Xoo KACC10859 hpaB:: EZTn5/KAN-2S, 90/471 (+) hrpE:: EZTn5 Xoo KACC10859 hrpE:: EZTn5/KAN-2S, 194/282 () hrpD6:: EZTn5 Xoo KACC10859 hrpD6:: EZTn5/KAN-2S, 58/243 () hrpD5:: EZTn5 Xoo KACC10859 hrpD5:: EZTn5/KAN-2S, 876/939 (+) hpaA:: EZTn5 Xoo KACC10859 hpaA:: EZTn5/KAN-2S, 590/828 (+) hrcS:: EZTn5 Xoo KACC10859 hrcS:: EZTn5/KAN-2S, 127/261 () hrcR:: EZTn5 Xoo KACC10859 hrcR:: EZTn5/KAN-2S, 317/645 (+) hrcQ:: EZTn5 Xoo KACC10859 hrcQ:: EZTn5/KAN-2S, 448/915 (+) hpaP:: EZTn5 Xoo KACC10859 hpaP:: EZTn5/KAN-2S, 135/618 () hrcV:: EZTn5 Xoo KACC10859 hrcV:: EZTn5/KAN-2S, 672/1938 () hrcU:: EZTn5 Xoo KACC10859 hrcU:: EZTn5/KAN-2S, 583/1080 (+) hrpB1:: EZTn5 Xoo KACC10859 hrpB1:: EZTn5/KAN-2S, 246/456 () hrpB2:: EZTn5 Xoo KACC10859 hrpB2:: EZTn5/KAN-2S, 41/393 (+) hrcJ:: EZTn5 Xoo KACC10859 hrcJ:: EZTn5/KAN-2S, 486/762 () hrpB4:: EZTn5 Xoo KACC10859 hrpB4:: EZTn5/KAN-2S, 354/630 () hrpB5:: EZTn5 Xoo KACC10859 hrpB5:: EZTn5/KAN-2S, 244/702 () hrcN:: EZTn5 Xoo KACC10859 hrcN:: EZTn5/KAN-2S, 306/1329 (+) hrpB7:: EZTn5 Xoo KACC10859 hrpB7:: EZTn5/KAN-2S, 332/510 () hrcT:: EZTn5 Xoo KACC10859 hrcT:: EZTn5/KAN-2S, 405/831 () hrcC:: EZTn5 Xoo KACC10859 hrcC:: EZTn5/KAN-2S, 477/1818 () hpa1:: EZTn5 Xoo KACC10859 hpa1:: EZTn5/KAN-2S, 43/420 () hpa2:: EZTn5 Xoo KACC10859 hpa2:: EZTn5/KAN-2S, 248/474 (+) hpa3:: EZTn5 Xoo KACC10859 hpa3:: EZTn5/KAN-2S, 271/447 (+) hpa4:: EZTn5 Xoo KACC10859 hpa4:: EZTn5/KAN-2S, 1162/1986 () hrpG:: EZTn5 Xoo KACC10859 hrpG:: EZTn5/KAN-2S, 505/975 (+) hrpX:: EZTn5 Xoo KACC10859 hrpX:: EZTn5/KAN-2S, 130/1527 (+) a

KACC, Korean Agricultural Culture Collection. Insertion site (bp)/gene size (bp) (orientation of EZTn5 in ORF. +, right, –, inverse).

b

KACCa This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study

ARTICLE IN PRESS H.-J. Cho et al. / Microbial Pathogenesis 44 (2008) 473–483

kanamycin for E. coli and 10 mg/ml kanamycin for X. oryzae pv. oryzae. 2.2. Construction of hrp gene disruption cassettes X. oryzae pv. oryzae strain KACC10859 was grown in 100 ml of NB medium at 28 1C and 200 rpm in a rotary shaker for 24 h. The cells were harvested by centrifugation at 9000g, 4 1C for 5 min. After washing with 30 ml of

475

distilled water, genomic DNA was prepared using the MagExtractorTM Nucleic Acid Purification kit (Toyobo) as described in the user’s manual. The hrpG, hrpX gene sequences and 26 hrp gene sequences in the 32.18 kb hrp gene cluster of X. oryzae pv. oryzae was obtained from the NCBI GenBank Database (AE013598). The primer sequences for isolation are listed in Table 2. PCR was carried out using Ex Taq polymeraseTM (Takara), and the parameters used for PCR

Table 2 Primer sequences used in isolation and RT-PCR of 28 hrp genes Primer

ORF/specificity

Sequence (50 -30 )

Positiona

1F 1R 2F 2R 3F 3R 4F 4R 5F 5R 6F 6R 7F 7R 8F 8R 9F 9R 10F 10R 10iR 11F 11iF 11R 11iR 12F 12iF 12R 12iR 13F 13iF 13R 14F 14R 15F 15R 16F 16R 17F 17R 18F 18iF 18R 19F 19iF 19R 19iR 20F 20R 21F

hpaF hpaF hrpF hrpF hpaB hpaB hrpE hrpE hrpD6 hrpD6 hrpD5 hrpD5 hpaA hpaA hrcS hrcS hrcR hrcR hrcQ hrcQ Internal hpaP Internal hpaP Internal hrcV Internal hrcV Internal hrcU Internal hrcU hrpB1 hrpB1 hrpB2 hrpB2 hrcJ hrcJ hrpB4 hrpB4 hrpB5 Internal hrpB5 hrcN Internal hrcN Internal hrpB7 hrpB7 hrcT

ATGTTCAATATAAATCGCCTACTG CTAATGGATGCCCCATTCCC ATGTCGCTCAACATGCTTTC TTATCTGCGACGTATCCTGA ATGAGCAGCGCGCGATTCGA TCAGGCGCGCAACCACAGAT ATGGAAATACTTCCGCAAATC TTACTGGCCAACGAGCTGCT ATGTTCGATGCAATGACCGA TTACCGCATATTTGCGATATG ATGACCATGCAGCTTCGCGT TCATTGCGCCGCTTGCTGCG ATGATCCGTCGCATCTCGCC TCATGGGCGAACCTCCTGAG ATGGACCACGACGATCTAGT TCATGGGAACGCCGCCTG ATGCAGATGCCTGACGTTG TCACCGATAGCTCAGAACC GTGTTCGGCGATCCACGC TCAGGCATCTGCATGCGTG CCCAGTGTCATACCGATGCC GTGCGCATCCTGCCGGTC CAAATGGCGATCGACCACATC TTAGACGACCTCGATGCTGA GATGTGGTCGATCGCCATTTG ATGCTAGGAGATCGCGTGC GATGTTGACCGAATATGTGC TCACACCACCACTCTACCG CATGCAGAAGGATCGACTTC ATGTCGGAAGAAAAAACCGAG ATGGTGGTCAACCCGACCCA CTAGCATGGCAGGGCTCC GTGGAGAAGATTCAATGTCC TCAGGCGCGCAGGTACTG GTGATGACGCTCATTCCTCCTGT CTACTGGTTCTTCACCAGC ATGCGCGCGCTGAGATACC TCACCCGGCTTTGCCTTTC ATGGACAACACGCGGATCG TCAACCAGACACGCATGACG ATGCGTGTCTGGTTGAGGTC CACCTGCGAGCACGTCATC TCAGCCAACATCCGCGGGC ATGTTGGCTGAGACGCCCC CAATCGACGTGTTGGCCAG TCACGCATCGTCGGTCACG GCGAGATCGCGACTGAAGC ATGCGTGAGCCTGCCTACAC TCATCGGGCGCCCCCATG ATGAACGACGTCACCGATGC

60190–60213 58273–58292 63166–63185 60777–60796 72585–72604 72134–72153 72920–72940 72659–72678 73244–73263 73021–73041 74192–74211 73273–73292 75016–75035 74208–74227 75273–75292 75032–75049 75923–75941 75297–75315 76825–76842 75928–75946 76532–76551 77574–77591 77232–77252 76974–76993 77232–77252 79534–79552 77965–77984 77615–77634 79267–79286 80605–80625 79826–79845 79546–79563 80840–80859 81278–81295 81326–81348 81703–81721 81723–81741 82466–82484 82492–82510 83102–83121 83106–83125 83468–83488 83789–83807 83797–83815 84848–84868 85107–85125 83993–84011 85118–85137 85610–85627 85624–85643

of hrcQ of hpaP of hpaP of hrcV of hrcV of hrcU

of hrpB5

of hrcN of hrcN

ARTICLE IN PRESS H.-J. Cho et al. / Microbial Pathogenesis 44 (2008) 473–483

476 Table 2 (continued ) Primer

ORF/specificity

Sequence (50 -30 )

Positiona

21iF 21R 21iR 22F 22R 22iR 23F 23R 24F 24R 25F 25R 26F 26R 27F 27R 28eF 28eR

Internal of hrcT hrcT Internal of hrcT hrcC hrcC Internal of hrcC hpa1 hpa1 hpa2 hpa2 hpa4 hpa4 hpa3 hpa3 hrpG hrpG Upstream of hrpX Downstream of hrpX

GTTATCCAGCAATACGACAG TCAGTGCGACGCGCCTGC ATGAACGCCTCCTTGAACAC ATGGCTCCTGCCTGTACCAC TCAGGGCGACACCACATGTGGGGTC CACCTCTGGCGAGATCCAG ATGAATTCTTTGAACACACAATTCG TTACTGCATCGATGCGCTGT GTGCACGCGCAATTGTCCC CTATTCACCAATCACACCACG ATGAAACTCTCCGGCGGTATCGAG TCATGCTCGCCCGCTTTGCCACTGG ATGATCTTGGAATCGCACAATC TCATGATGCCACCTCCTGCG GTGAAACTTTTCCTCGTTGCA TCAGCAGGCGGCTGTGCGAT TCGTTTGAGAACAGAGTGAGGT GCAGGTAGCGCTACCAAGC

86164–86183 86437–86454 85864–85883 86537–86556 88330–88354 86737–86755 89488–89512 89093–89112 89978–89996 90431–90451 69734–69757 71695–71719 69291–69312 69718–69737 1411979–1411999 1411025–1411044 1412435–1412456 1414026–1414044

a

Numerical position on the X. oryzae pv. oryzae KACC10331 genome (GeneBank accession no. AE013598).

were as follows: step 1, 94 1C for 2 min; step 2, 94 1C for 30 s; step 3, 55 1C for 30 s; step 4, 72 1C for 1 min/kb; 30 cycles from steps 2 to 4; and step 5, 72 1C for 10 min. The PCR fragments were ligated into the pGEM-T Easy vector (Promega), and the clones were subjected to mutagenesis with EZ-Tn5TM /KAN-2S (Epicentre). The sites and the orientations of inserted Tn5 transposon in the disruption cassettes were identified with sequencing analysis. Sequence analysis was performed with the BigDyeTM terminator (Applied Biosystems) and the ABI3100 automatic sequencer. The primer was designed from the 30 end of the transposon (50 -ACCTACAACAAAGCTCTCATCAACC-30 ). Disruption cassettes were selected so that the transposon was inserted near the center of the target gene.

20 mM at pH 7.0) at 28 1C on a rotary shaker for 4 h. After recovery, cell cultures were spread on NB agar plates containing 10 mg/ml kanamycin, and then the plate was followed by incubation at 28 1C for 5–7 days. The colonies were picked out and were cultured in NB media containing 10 mg/ml kanamycin at 28 1C on a rotary shaker overnight. Disruption of each hrp gene was verified by PCR with each primer pair and confirmed by Southern hybridization using Gene Images AlkPhos Direct Labeling and Detection System (Amersham Biosciences). PCR amplification of the kanamycin resistance gene from EZ-Tn5TM /KAN-2S was used as a probe. The following sequences were the used for primers: 50 -AGCCATATTCAACGGGAAA-30 , 50 -CCGGCGCAGGAACACTGCC-30 .

2.3. Marker exchange

2.4. Pathogenicity assays

The disruption cassettes of each of the 28 hrp genes were introduced individually into wild-type strain X. oryzae pv. oryzae KACC10859. To prepare electro-competent X. oryzae pv. oryzae cells, the cells were cultured up to 1 OD600 in 100 ml of NB media in the 200 rpm rotary shaker at 28 1C. The cells were harvested by centrifugation at 9000g for 2 min at 4 1C. Harvested cells were washed with 30 ml of ice-cold distilled water twice and again washed with 30 ml of 15% ice-cold glycerol. After centrifugation at 9000g for 2 min at 4 1C, the supernatant was removed completely and the pellet was resuspended with 200 ml of 15% ice-cold glycerol. X. oryzae pv. oryzae competent cells (200 ml) were mixed with 200 ng of the hrp-disruption cassette DNA, and then placed on ice for 10 min. Transformation was performed using the Gene PulserII (Bio-Rad) electroporator with the 0.2 cm gap cuvette at 12.5 kV/cm. After electro-pulse, cells were incubated in 800 ml of SOC medium (tryptone 2%, yeast extract 0.5%, NaCl 0.05%, KCl 2.5 mM, MgCl2 10 mM, D-glucose

Rice plant line Milyang-23, which is a susceptible cultivar to X. oryzae pv. oryzae KACC10859, was used for pathogenicity assays of X. oryzae pv. oryzae and its derived hrp mutants. Eight-week-old greenhouse-grown Milyang-23 rice plants were inoculated with mid-exponential-phase cultures of X. oryzae pv. oryzae hrp mutants (0.5 OD600). The rice leaves were cut with sterilized scissors and then painted with the bacterial culture at the clipped site. Each mutant sample was inoculated onto three rice leaves, followed by incubation of the rice plants in the green house. Lesion length was measured at regular intervals and pictures of the leaf-clip inoculations were taken after 20 days. 2.5. RT-PCR analysis X. oryzae pv. oryzae KACC10859 and hrp mutants were grown in PSB (Bacto peptone 0.5%, sucrose 1%, K2HPO4 0.05%, MgSO4  7H2O 0.025% at pH 7.2–7.4) medium to

ARTICLE IN PRESS H.-J. Cho et al. / Microbial Pathogenesis 44 (2008) 473–483

approximately 0.6 OD600 and their total RNA was extracted using the RNeasy Mini kit (Qiagen). The extracted RNA was treated with DNase I (Qiagen) and purified using the RNeasy column (Qiagen). Reverse transcription was carried with 1.5 mg total RNA, 2.5 pmol random 9-mers and 100 units of the ReverTra Ace as instructed by the manufacturer (Toyobo). The reaction was performed at 30 1C for 10 min, 42 1C for 60 min and inactivated at 99 1C for 5 min. Five microliters of the cDNA products and the gene-specific primers (Table 2) were added in the PCR reaction using the AccuPower HL PCR premix (Bioneer). The PCR program was as follows: step 1, 94 1C for 5 min; step 2, 94 1C for 30 s; step 3, 55 1C for 30 s; step 4, 72 1C for 2 min; 30 cycles from steps 2 to 4; and step 5, 72 1C for 10 min. For a positive control, the genomic DNA of X. oryzae pv. oryzae KACC10859 was used as a PCR template, and for a negative control, 1.5 mg of total RNA was used. 3. Results 3.1. Organization of the hrp gene cluster The information for the 28 hrp genes was obtained from GenBank accession number AE013598. In X. oryzae pv. oryzae, the hrp gene cluster contains 26 genes, which are composed of nine hrp, nine hrc, and eight hpa genes. The regulatory genes of the hrp cluster, hrpG and hrpX, were located apart and downstream of the hrp gene cluster. These 28 genes and the primers used in this study are listed in Table 2. The core region of the hrp gene cluster, from hpaB to hrcC, was composed of 22 genes: hpaB, hrpE, hrpD6, hrpD5, hpaA, hrcS, hrcR, hrcQ, hpaP, hrcV, hrcU, hrpB1, hrpB2, hrcJ, hrpB4, hrpB5, hrcN, hrpB7, hrcT, and hrcC. Two genes, hpa1 and hpa2, were located downstream of hrcC and two genes, hpa3 and hpa4, were located upstream of hpaB. hrpF and hpaF genes were also located downstream of hpaB, but they were about 9 kb distal from hpaB in X. oryzae pv. oryzae KACC10859, as in KACC10331, which was confirmed by Southern hybridization (data not shown). The hrpF gene was 6 kb distal from hpa3 in X. oryzae pv. oryzae KACC10859, as in KACC10331, which was confirmed by Southern hybridization (data not shown). This region had four transposase genes [5,8], which were distinctive features of X. oryzae pv. oryzae among xanthomonas. 3.2. Transcription units in the core region of the hrp gene cluster

477

hrcT, was transcribed as a single polycistronic mRNA and hrcC was also transcribed linked to the hrpB operon (Fig. 1A). To confirm the transcriptional linkage of the hrpB operon and hrcC, we used the same primer pairs (21iF-22iR) for positive and negative controls, which verified that the primer pairs worked specifically and there was no contamination of genomic DNA in the RNA sample. In the region from hrcU to hpaB, the results from RT-PCR indicated that there were two transcriptional units—one was from hrcU to hpaP and the other was from hrcQ to hpaB (Fig. 1B). The primer pairs (11iF-10iR) used for identification of separate transcripts for hpaP and hrcQ were also used as positive and negative controls of PCR. 3.3. Construction of hrp gene disruption mutants To assess the pathogenicity of the individual hrp genes, the 28 hrp genes of X. oryzae pv. oryzae KACC10859 were disrupted by insertional mutagenesis of EZTn5. Mutations in these hrp genes were confirmed by Southern hybridization and sequence analysis. The EZTn5 insertion site and the orientation of the 28 hrp mutants are described in Table 1. 3.4. Non-polarity of the EZTn5 insertional mutagenesis The mutations by EZTn5 insertion were non-polar, which was demonstrated by RT-PCR of X. oryzae pv. oryzae KACC10859 hpaA::EZTn5 mutant (Fig. 2). According to the results of RT-PCR, all genes in the operon, inclusive of hrcQ through hpaB, with the exception of the EZTn5-inserted hpaA gene, were detected in the transcript of the hpaA::EZTn5 mutant. In the mutations of the hrpB operon, hrpB1::EZTn5 and hrpB5::EZTn5 mutants were also were not interrupted by the transcription of mRNA about their downstream genes and all downstream genes of the disrupted gene were detected with RT-PCR (data not shown). The transcript of hpaA with the EZTn5 insert was not detected with hpaA ORF primers (7F-7R) because the property of bacterial RNA was unstable and the target size was large (2049 bp) to detect with RT-PCR. Instead, in the transcript from the hrpB1::EZTn5 mutant, all genes in the hrpB operon including EZTn5-inserted hrpB1 as well as downstream genes were detected (data not shown). These results indicated that the EZTn5 insertion into any gene in the operon did not affect expression of downstream genes. 3.5. Phenotypes of hrp–hrc mutants

We used reverse transcription polymerase chain reaction (RT-PCR) to determine the transcriptional linkage in the core region (hpaB through hrcC) of the hrp gene cluster. As shown in Fig. 1, we used primer pairs (Table 2) to detect the intergenic junction among the hrp genes. RT-PCR indicated that the hrpB operon, inclusive from hrpB1 to

Each hrp–hrc–hpa mutant was assayed for pathogenicity in rice plant Milyang-23, susceptible cultivar to X. oryzae pv. oryzae. The assays were performed using the leaf-clip method with X. oryzae pv. oryzae KACC10859 and its derived 28 non-polar hrp mutants. The lesion lengths of

ARTICLE IN PRESS H.-J. Cho et al. / Microbial Pathogenesis 44 (2008) 473–483

478

C

PCR1 PCR2 PCR3 PCR4 PCR5 PCR6 PCR7 PCR8

bp

T

B7

N

B5

B4

J

B2 B1

((882 bp p) (1159 bp) (1399 bp) (1316 bp) (544 bp) (780 bp) (766 bp) (592 bp)

M

C+

1 kb

C-

2,000 1,650 1000 850 650 500 400 300

U

V

PCR11 (579 bp) PCR12 (753 bp) PCR13 (721 bp) PCR14 (1546 bp) PCR15 (910 bp) PCR16 (1085 bp) PCR17 (1763 bp) PCR18 (1191 bp) PCR19 (605 bp) PCR20 (807 bbp))

bp

M

P

Q

R

S

A

D5

D6 E

B

1 kb

C+

C-

2,000 1,650 1,000 850 650 500 400

Fig. 1. RT-PCR analysis of transcriptional units in the core region of the hrp gene cluster of X. oryzae pv. oryzae KACC10859: (A) Schematic representation of the hrpB operon and RT-PCR products amplified using primers designed to span the intergenic junctions. The black arrow indicates the extension and transcription direction of the hrpB operon and the open arrows represent the ORFs of hrp genes—hrpB1 (B1), hrpB2 (B2), hrcJ (J), hrpB4 (B4), hrpB5 (B5), hrcN (N), hrpB7 (B7), hrcT (T), and hrcC (C). The thick black lines indicate the eight PCR products and the expected sizes of the corresponding RT-PCR products. PCR1 denotes PCR reactions with primer pairs 14F-15R; PCR2 is 15F-16R; PCR3 is 16F-17R; PCR4 is 17F-18R; PCR5 is 18iF-19iR; PCR6 is 19iF-20R; PCR7 is 20F-21iR; and PCR8 is 21iF-22iR. The lower panel shows the agarose gel analysis of the RT-PCR products. M, 1 kb plus DNA ladder; C+, PCR8 product with DNA template (positive control); C–, PCR8 product with RNA template (negative control). (B) Schematic representation of the hrcU through the hpaB region and RT-PCR products amplified using primers designed to span the intergenic junctions. The open arrows represent the ORFs of hrp genes—hrcU (U), hrcV (V), hpaP (P), hrcQ (Q), hrcR (R), hrcS (S), hpaA (A), hrpD5 (D5), hrpD6 (D6), hrpE (E), and hpaB (B). The thick black lines indicate the ten PCR products and the expected sizes of the corresponding RT-PCR products. PCR11 denotes PCR reactions with primer pairs 13iF-12iR; PCR12 is 12iF-11iR; PCR13 is 11iF-10iR; PCR14 is 10F-9R; PCR15 is 9F-8R; PCR16 is 8F-7R; PCR17 is 7F-6R; PCR18 is 6F-5R; PCR19 is 5F-4R; and PCR20 is 4F-3R. The lower panel shows the agarose gel analysis of the RT-PCR products. M, 1 kb plus DNA ladder; C+, PCR13 product with DNA template (positive control); C, PCR13 product with RNA template (negative control).

infected rice leaves were measured at 20 days after inoculation (Fig. 3). According to the pathogenicity assays, with the exception of hrpF, all hrp–hrc mutants—hrpE, hrpD6, hrpD5, hrcS, hrcR, hrcQ, hrcV, hrcU, hrpB1, hrpB2, hrcJ, hrpB4, hrpB5, hrcN, hrpB7, hrcT, hrcC, hrpG, and hrpX—completely lost virulence (Fig. 3). The lesion lengths

of these hrp–hrc mutants were less than 0.5 cm, which was the same phenotype of the negative control. The hrpF mutant resulted in slightly longer lesions of approximately 3 cm. The pathogenicity of the hrpF mutant was not significant. These results indicated that hrp–hrc genes in the hrp gene cluster and hrpG, hrpX genes are essential for the pathogenicity of X. oryzae pv. oryzae (Fig. 4).

ARTICLE IN PRESS H.-J. Cho et al. / Microbial Pathogenesis 44 (2008) 473–483

Q

bp 11,000 850 650 500 400 300

R

M

1

S

2

A

EZTn5

3

4

5

6

7

D5

8

9

D6 E

479

B

500 bp

10 KACC10859

hpaA::EZTn5

Fig. 2. Identification of non-polar mutagenesis of X. oryzae pv. oryzae KACC10859 hpaA::EZTn5: (A) Schematic representation of the operon including EZTn5 inserted hpaA of the hpaA::EZTn5 mutant. The black arrow indicates the transcription unit and the direction of the operon including hrcQ (Q), hrcR (R), hrcS (S), hpaA (A), hrpD5 (D5), hrpD6 (D6), hrpE (E), and hrpB (B) genes. (B) RT-PCR products amplified using primers specific for each gene. M, 1 kb plus DNA ladder; lane 1, PCR product of a DNA template detected with primer pairs 3F-3R for hpaB (positive control); lane 2, PCR product of an RNA template detected with primer pairs 3F-3R for hpaB (negative control); lanes 3–10, RT-PCR products corresponding to the hrcQ (10F-10iR), hrcR (9F-9R), hrcS (8F-8R), hpaA (7F-7R), hrpD5 (6F-6R), hrpD6 (5F-5R), hrpE (4F-4R) and hrpB (3F-3R).

3.6. Phenotypes of hpa mutants Disruption of hpa genes had various effects on pathogenicity. Most hpa mutants (except the hpaB mutant) displayed some virulence although significantly decreased (Fig. 3). The hpaB mutant lost its virulence completely, which was the same phenotype displayed by the hrp–hrc mutants. The result suggests that hpaB is essential for pathogenicity. The hpaA, hpaF, hpaP, hpa1, and hpa2 mutants showed a delay in pathogenicity. Specifically, the disruptions of hpaA, hpa2, and hpaF were critical to pathogenicity, suggesting their involvement in pathogenicity. The lesion lengths of the hpaA and hpa2 mutants were decreased to 6.73 and 7.27 cm, respectively, from 46.83 cm of wild type; the hpaF mutant was 17.07 cm, which was less than half of the wild-type’s lesion length. hpaP and hpa1 also had an influence on pathogenicity. The lesion lengths of the respective mutants were 28.6 and 34.5 cm, which were greater than half of the wild type’s. The variation in lesion length of hpa1 mutants was large while the hpaP mutant variation was small. From these results, we consider that HpaP contributes more to pathogenicity than Hpa1. Disruptions in the hpa3 and hpa4 genes had no effect on pathogenicity. The phenotypes of the hpa3 and hpa4 mutants were similar to wild type and retained full pathogenicity. The lesion lengths of these mutants were shorter than that of the wild type, but they were within the range of standard deviation. Therefore, it is possible that hpa3 and hpa4 genes are not involved in TTS systems. 4. Discussion This study investigated the pathogenicity of X. oryzae pv. oryzae hrp mutants. First, we determined the transcriptional linkages in the core region of the hrp gene cluster and

our data showed that the core region consisted of three transcription units—hrpB1 to hrcC, hrcU to hpaP and hrcQ to hpaB. It had been reported that there was a plantinducible promoter (PIP) box (TTCGN15TTCG) upstream of the hrpB1, hrcU, and hrcQ genes [5] and our data verified these bioinformatics predictions. Interestingly, the transcriptional unit of the hrcQ to hpaB region in X. oryzae pv. oryzae did not correspond with that of Xanthomonas campestris pv. vesicatoria. In X. oryzae pv. oryzae, PCR products spanning hpaA–hrpD5, hrpD5–hrpD6, hrpD6–hrpE and hrpE–hpaB were obtained, suggesting they were transcribed as one unit. On the other hand, in X. campestris pv. vesicatoria, PCR products spanning hrpD5–hrpD6 and hrpD6–hrpE were obtained, but hpaA–hrpD5 and hrpE–hpaB were not, which suggested that the transcription units were separated into three parts—one is from hrcQ to hpaA, another is from hrpD5 to hrpE and the other is an hpaB transcript [9]. Within X. oryzae pv. oryzae and X. campestris pv. vesicatoria, the sequences of hpaA and hrpD5 shared four base pairs for the start codon of hrpD5 (ATG) and the stop codon of hpaA (TGA). Furthermore, the sequences spanning hpaA–hrpD5 had an exact match with 46 bps— 50 -AACAGGCGGCTCAGGAGGTTCGCCCATGACCATGCAGCTTCGCGTA-30 —including the PIP box (underlined sequences) newly reported in X. campestris pv. vesicatoria [9]. The forward primer for hrpD5 (primer 6F) and the reverse primer for hpaA (primer 7R) were located in this sequence, and using RT-PCR, these primers could detect expression of hrpD5 and hpaA (Fig. 2), which also indicated that this junction was expressed as mRNA. The discrepancy between X. oryzae pv. oryzae and X. campestris pv. vesicatoria with regard to hpaA and hrpD5 transcription might be a simple difference as species, or it might be a dual regulation of hrpE expression to produce more HrpE protein production. Non-polarity of EZTn5 insertional mutagenesis was demonstrated primarily by RT-PCR and secondarily by

ARTICLE IN PRESS H.-J. Cho et al. / Microbial Pathogenesis 44 (2008) 473–483

480

KACC10859

Only media

hrpF –

hrpE –

hrpD6 –

hrpD5 –

hrcS –

hrcR –

hrcQ –

hrcV –

hrcU –

hrpB1 –

hrpB2 –

hrcJ –

hrpB4 –

hrpB5 –

hrcN –

hrpB7 –

hrcT –

hrcC –

hrpG –

hrpX –

2cm

KACC10859 Only media hpaF – hpaB – hpaA – hpaP – hpa1 – hpa2 – hpa3 – hpa4 –

60.00

Lesion-length (cm)

50.00 40.00 30.00 20.00

0.00

KACC10859 Only media hpaF hrpF hpaB hrpE hrpD6 hrpD5 hpa4hrcS hrcR hrcQ hpaP hrcV hrcU hrpB1hrpB2 hrcJ hrpB 4hrpB5 hrcN hrpB7 hrcT hrcChpa1hpa2 hpa3 hpa4hrpGhrpX -

10.00

Mutants Fig. 3. Infection of susceptible rice leaves with the hrp–hrc–hpa mutants. These data were collected at 20 days after inoculation: (A) hrp–hrc gene mutants. These mutants showed complete loss of virulence, with the exception of mutant hrpF. hrpF- had slight virulence. (B) hpa gene mutants. Most hpa mutants still possessed virulence, but the hrpB- had a complete loss of virulence, similar to the hrp–hrc mutants. (C) Measurement of lesions induced by the hrp–hrc–hpa mutants.

pathogenicity assays. Within the operon from hrcQ to hpaB, the hpaA::EZTn5 mutant had a slight virulence, which suggested that expression of hrpD6 or hrpD5 genes downstream from the hpaA gene was not affected by EZTn5 insertion. If the expressions of hrpD6 or hrpD5 gene had been interrupted by EZTn5 insertion into the hpaA

gene, the hpaA::EZTn5 mutant would have lost its virulence completely, similar to the hrpD6::EZTn5 or the hrpD5::EZTn5 mutant. According to the pathogenicity assays, all hrp–hrc genes were very critical, i.e., each gene disruption resulted in loss of disease symptoms in the susceptible rice cultivar. The

ARTICLE IN PRESS H.-J. Cho et al. / Microbial Pathogenesis 44 (2008) 473–483

481

Fig. 4. The pathogenicity of the hrp–hrc–hpa gene disruption mutants of X. oryzae pv. oryzae. The hrpG and hrpX genes are located apart downstream of the hrp gene cluster. The red flag represents the insertion and orientation of the EZTn5 transposon. hrp (hypersensitive response and pathogenciticy), hrc (hrp-conserved genes), hpa (hrp-associated genes), P (pathogenicity), M (mutant): 1, hpaF::EZTn5; 2, hrpF::EZTn5; 3, hpaB::EZTn5; 4, hrpE::EZTn5; 5, hrpD6::EZTn5; 6, hrpD5::EZTn5; 7, hpaA::EZTn5; 8, hrcS::EZTn5; 9, hrcR::EZTn5; 10, hrcQ::EZTn5; 11, hpaP::EZTn5; 12, hrcV::EZTn5; 13, hrcU::EZTn5; 14, hrpB1::EZTn5; 15, hrpB2::EZTn5; 16, hrcJ::EZTn5; 17, hrpB4::EZTn5; 18, hrpB5::EZTn5; 19, hrcN::EZTn5; 20, hrpB7::EZTn5; 21, hrcT::EZTn5; 22, hrcC::EZTn5; 23, hpa1::EZTn5; 24, hpa2::EZTn5; 25, hpa4::EZTn5; 26, hpa3::EZTn5; 27, hrpG::EZTn5; 28, hrpX::EZTn5. The pathogenicity of each hrp mutant is represented as follows and cm refers to lesion length: , less than 1 cm; +, 1–10 cm; ++, 10–40 cm; +++, and more than 40 cm.

pathogenicity of these hrp–hrc mutants of X. oryzae pv. oryzae was similar to those of their respective X. campestris pv. vesicatoria and Xanthomonas axonopodis pv. glycines [4,6,10–20]. Most Hrp–Hrc proteins in the hrp gene cluster form the primary structure of TTS systems, like the hrp pilus or translocon [10,17,21,22]. If one of the Hrp–Hrc proteins had not been expressed, the hrp pilus would not have been constructed. Therefore, the pathogen could not interact with and penetrate into the host cell. As a result, each hrp–hrc gene disruption mutant would reveal the same phenotype, as shown in the results. The pathogenicity of the hrpF-disrupted mutant showed minimal virulence, which is a distinguishing difference from the other hrp–hrc mutants. The phenotype of this hrpF mutant was also evident in PXO99A, but not in X. axonopodis pv. glycines [4,16]. The HrpF protein was known as a type III translocon protein, which is a translocation channel in the eukaryotic plasma membrane, in X. campestris pv. vesicatoria [10]. It could be expected that the reduced pathogenicity of the hrpF mutant was due to its incomplete channels, which may exist in other components of the translocon. Disruption of the hpa genes resulted in different patterns of pathogenicity. Infection studies revealed that disruption of the hpaB gene abolished disease symptoms in susceptible

rice plants, which was similar to the effects of the hrp–hrc mutations. This result was consistent with the phenotype of the hpaB mutant of X. campestris pv. vesicatoria and X. axonopodis pv. glycines [4,23]. The hpaP mutant also showed decreased pathogenicity. This result was apparent in the disruption of the hpaC gene of X. campestris pv. vesicatoria, which is homologous to hpaP of X. oryzae pv. oryzae. HpaB and HpaC of X. campestris pv. vesicatoria were reported to promote the secretion of effector proteins and prevent the delivery of non-effectors into the plant cell, and to comprise the HpaB–HpaC hetero-oligomeric protein complex [11,24]. But the results of pathogenicity assays are imcompatible with the HpaB–HpaC hetero-oligomeric protein complex. If HpaB and HpaC form a hetero-oligomeric complex, the hpaC mutant must have little to no virulence, similar to the hpaB mutant. Or, if HpaB is the main component and HpaC is the ancillary component of the complex, the pathogenicity of each mutant might not be extremely different. Hence, further study of the HpaB–HpaC complex is required. Disruption of the hpaA gene showed a different result with respect to pathogenicity within X. oryzae pv. oryzae and X. campestris pv. vesicatoria. In our experiment, disruption of the hpaA gene of X. oryzae pv. oryzae had significantly reduced pathogenicity. However, in X. campestris

ARTICLE IN PRESS 482

H.-J. Cho et al. / Microbial Pathogenesis 44 (2008) 473–483

pv. vesicatoria, hpaA mutants did not confer disease symptoms on all tested susceptible plant lines [12]. It had been reported that HpaA had two nuclear localization signals and was targeted to the nucleus of the eukaryotic host cell [12]. From the reports, we expect that the HpaA protein may be disturb the host defense systems. By blocking a part of the host defense systems with HpaA, X. oryzae pv. oryzae may augment the virulence. Disruption of the hpa1 gene of X. oryzae pv. oryzae affected virulence, which was slightly reduced. This result was consistent with the phenotype of the hpaG mutant of X. axonopodis pv. glycines, which is the hpa1 homolog of X. oryzae pv. oryzae. The feature of Hpa1 was well characterized in X. axonopodis pv. glycines as HpaG, which was an amyloid-forming protein under an apoplast-like condition and was important to work as harpins [25]. A mutation in the hpa2 gene resulted in a significant reduction of virulence in X. oryzae pv. oryzae. This result corresponded to the hpaH mutant of X. axonopodis pv. glycines, which was homologous to hpa2 of X. oryzae pv. oryzae [4]. Hpa2 protein has homology with lysozymelike proteins and it may improve the virulence of pathogens by digestion of some functional proteins. In the case of hpaF, the mutation of this gene resulted in significantly reduced virulence. The same result was shown in the hpaF mutant of X. axonopodis pv. glycines [4]. The function of HpaF is not clear, but it has been reported that HpaF has leucine-rich repeats and is not secreted into culture supernatants [13]. By the b-glucuronidase assays in X. axonopodis pv. glycines, the expression levels of hpaF gene were the highest among the tested hrp/hrc/hpa genes [4]. With these features, we suppose that HpaF may form oligomer, like HrpF translocon proteins, and stabilize the TTS systems by interacting with some other proteins in the cytoplasm of bacteria. Most hpa mutants showed reduced bacterial pathogenicity, but mutations of the hpa3 and hpa4 gene had no apparent effect on pathogenicity. The homolog of Hpa4 was reported in X. campestris pv. vesicatoria as XopF1, which was identified as a type III effector [26]. It has been suggested that Hpa3 may be a chaperone for secretion of Hpa4 proteins by the TTS system [16]. It is reasonable because Hpa4 may need a kind of chaperone for its successful translocation and Hpa3 may be helpful with small, acidic and leucine-rich features and with forward expression of Hpa4. As a consequence, because the effect of Hpa3 depends on the working of Hpa4, the virulence of the hpa3 mutant was similar to that of the hpa4 mutant. From the results of pathogenicity assay, we could expect that the proteins encoded by the hpa gene may work individually as a modulator or an effector, etc. If these proteins compose the main structure of the TTSS, the virulence of the hpa mutants would show a pattern of phenotype identical to the hrp–hrc mutants. The differential virulence patterns of the hpa mutants suggest that these Hpa proteins have unique and individual roles in TTS systems.

Acknowledgments This work was supported by a grant from National Institute of Agricultural Biotechnology (05-4-12-4-3), Rural Development Administration, Republic of Korea.

References [1] Ezuka A, Kaku H. A historical review of bacterial blight of rice. Japan: Bull. Natl. Inst. Agrobiol. Resour.; 2000. [2] Alfano JR, Collmer A. The type III (Hrp) secretion pathway of plant pathogenic bacteria: trafficking harpins, Avr proteins, and death. J Bacteriol 1997;179:5655–62. [3] Kelment Z. Hypersensitivity. In: Mount MS, Lacy GH, editors. Phytopathogenic prokaryotes. New York: Academic Press; 1982. [4] Kim JG, Park BK, Yoo CH, Jeon E, Oh J, Hwang I. Characterization of the Xanthomonas axonopodis pv. glycines Hrp pathogenicity island. J Bacteriol 2003;185:3155–66. [5] Lee BM, Park YJ, Park DS, Kang HW, Kim JG, Song ES, et al. The genome sequence of Xanthomonas oryzae pathovar oryzae KACC10331, the bacterial blight pathogen of rice. Nucl Acids Res 2005;33:577–86. [6] Wengelnik K, Bonas U. HrpXv, an AraC-type regulator, activates expression of five of the six loci in the hrp cluster of Xanthomonas campestris pv. vesicatoria. J Bacteriol 1996;178:3462–9. [7] Wengelnik K, Rossier O, Bonas U. Mutations in the regulatory gene hrpG of Xanthomonas campestris pv. vesicatoria result in constitutive expression of all hrp genes. J Bacteriol 1999;181:6828–31. [8] Ochiai H, Inoue Y, Takeya M, Sasaki A, Kaku H. Genome Sequence of Xanthomonas oryzae pv. oryzae suggests contribution of large numbers of effector genes and insertion sequences to its race diversity. Jpn Agric Res Q 2005;39:275–87. [9] Weber E, Berger C, Bonas U, Koebnik R. Refinement of the Xanthomonas campestris pv. vesicatoria hrpD and hrpE operon structure. Mol Plant Microbe Interact 2007;20:559–67. [10] Bu¨ttner D, Nennstiel D, Klusener B, Bonas U. Functional analysis of HrpF, a putative type III translocon protein from Xanthomonas campestris pv. vesicatoria. J Bacteriol 2002;184:2389–98. [11] Bu¨ttner D, Gurlebeck D, Noe¨l LD, Bonas U. HpaB from Xanthomonas campestris pv. vesicatoria acts as an exit control protein in type III-dependent protein secretion. Mol Microbiol 2004;54: 755–68. [12] Huguet E, Hahn K, Wengelnik K, Bonas U. hpaA mutants of Xanthomonas campestris pv. vesicatoria are affected in pathogenicity but retain the ability to induce host-specific hypersensitive reaction. Mol Microbiol 1998;29:1379–90. [13] Noe¨l L, Thieme F, Nennstiel D, Bonas U. Two novel type IIIsecreted proteins of Xanthomonas campestris pv. vesicatoria are encoded within the hrp pathogenicity island. J Bacteriol 2002;184: 1340–8. [14] Oh C, Heu S, Yoo JY, Cho Y. An hrcU-homologous gene mutant of Xanthomonas campestris pv. glycines 8ra that lost pathogenicity on the host plant but was able to elicit the hypersensitive response on nonhosts. Mol Plant Microbe Interact 1999;12:633–9. [15] Rossier O, Van den Ackerveken G, Bonas U. HrpB2 and HrpF from Xanthomonas are type III-secreted proteins and essential for pathogenicity and recognition by the host plant. Mol Microbiol 2000;38:828–38. [16] Sugio A, Yang B, White FF. Characterization of the hrpF pathogenicity peninsula of Xanthomonas oryzae pv. oryzae. Mol Plant Microbe Interact 2005;18:546–54. [17] Weber E, Ojanen-Reuhs T, Huguet E, Hause G, Romantschuk M, Korhonen TK, et al. The type III-dependent Hrp pilus is required for productive interaction of Xanthomonas campestris pv. vesicatoria with pepper host plants. J Bacteriol 2005;187:2458–68.

ARTICLE IN PRESS H.-J. Cho et al. / Microbial Pathogenesis 44 (2008) 473–483 [18] Wengelnik K, Marie C, Russel M, Bonas U. Expression and localization of HrpA1, a protein of Xanthomonas campestris pv. vesicatoria essential for pathogenicity and induction of the hypersensitive reaction. J Bacteriol 1996;178:1061–9. [19] Wengelnik K, Van den Ackerveken G, Bonas U. HrpG, a key hrp regulatory protein of Xanthomonas campestris pv. vesicatoria is homologous to two-component response regulators. Mol Plant Microbe Interact 1996;9:704–12. [20] Zhu W, Magbanua MM, White FF. Identification of two novel hrpassociated genes in the hrp gene cluster of Xanthomonas oryzae pv. oryzae. J Bacteriol 2000;182:1844–53. [21] Bogdanove AJ, Beer SV, Bonas U, Boucher CA, Collmer A, Coplin DL, et al. Unified nomenclature for broadly conserved hrp genes of phytopathogenic bacteria. Mol Microbiol 1996;20:681–3. [22] Weber E, Koebnik R. Domain structure of HrpE, the Hrp pilus subunit of Xanthomonas campestris pv. vesicatoria. J Bacteriol 2005;187:6175–86.

483

[23] Knoop V, Staskawicz B, Bonas U. Expression of the avirulence gene avrBs3 from Xanthomonas campestris pv. vesicatoria is not under the control of hrp genes and is independent of plant factors. J Bacteriol 1991;173:7142–50. [24] Bu¨ttner D, Lorenz C, Weber E, Bonas U. Targeting of two effector protein classes to the type III secretion system by a HpaC- and HpaB-dependent protein complex from Xanthomonas campestris pv. vesicatoria. Mol Microbiol 2006;59:513–27. [25] Oh J, Kim JG, Jeon E, Yoo CH, Moon JS, Rhee S, et al. Amyloidogenesis of type III-dependent harpins from plant pathogenic bacteria. J Biol Chem 2007;282:13601–9. [26] Roden JA, Belt B, Ross JB, Tachibana T, Vargas J, Mudgett MB. A genetic screen to isolate type III effectors translocated into pepper cells during Xanthomonas infection. Proc Natl Acad Sci USA 2004;101:16624–9.