Generation of two iPSC lines derived from two unrelated patients with Gaucher disease

Stem Cell Research xxx (xxxx) xxxx

Contents lists available at ScienceDirect

Stem Cell Research journal homepage: www.elsevier.com/locate/scr

Lab Resource: Multiple Cell Lines

Generation of two iPSC lines derived from two unrelated patients with Gaucher disease Maike Nagela,b, Jennifer Reichbauera,b, Judith Böhringerc, Yvonne Schellingb, ⁎ Inge Krägeloh-Mannc, Rebecca Schülea,b, , Ulrike Ulmera,b a

Department of Neurodegenerative Diseases, Hertie-Institute for Clinical Brain Research and Center of Neurology, University of Tübingen, Hoppe-Seyler-Str. 3, 72076 Tübingen, Germany b German Center for Neurodegenerative Diseases (DZNE), University of Tübingen, Tübingen, Germany c Department of Neuropediatrics, Children's University Hospital, Tübingen, Germany

ABSTRACT

Gaucher disease is the most common autosomal recessive lysosomal storage disorder, caused by mutations in the β-glucocerebrosidase gene GBA. Here we describe generation of iPSC from skin-derived fibroblasts from two unrelated individuals with neuronopathic forms of Gaucher disease. The donor for line iPSC-GBA-1, a 21 month old girl, carried the recurring GBA mutation c.1448 T > C, p.Leu483Pro at homozygous state; fibroblasts for line iPS-GBA-2 were obtained from a 4 year old girl compound heterozygous for the GBA mutations c.667 T > C, p.Trp223Arg and c.1226A > G, p.Asn409Ser. iPSCs were developed using integration free episomal vectors (OCT4, KLF4; L-MYC, SOX2 (OSKM) and LIN28). Resource table Unique stem cell lines identifier Alternative names of stem cell lines Institution Contact information of distributor Type of cell lines Origin Cell source Clonality Method of reprogramming Multiline rationale Gene modification Type of modification Associated disease Gene/locus

Method of modification Name of transgene or resistance Inducible/constitutive system

⁎

HIHRSi001-A HIHRSi002-A iPSC-GBA-1 (HIHRSi001-A) iPSC-GBA-2 (HIHRSi002-A) Hertie Institute for Clinical Brain Research and German Center for Neurodegenerative Diseases (DZNE), Tübingen, Germany Rebecca Schüle [email protected] Induced pluripotent stem cell (iPSC) Human Fibroblasts Clonal Non-integrating episomal plasmids Two cell lines carrying individual GBA mutations Yes inherited mutation Gaucher Disease, neuronopathic (OMIM # 230900, 23100) GBA iPSC-GBA-1: NM_000157.3(GBA): c.[1448 T > C]; [1448 T > C] | p.[Leu483Pro]; [Leu483Pro] (originally published as Leu444Pro (Tsuji et al., 1987)) iPSC-GBA-2: NM_000157.3(GBA): c.[667 T > C];[1226A > G] | p.[Trp223Arg];[Asn409Ser] (Trp223Arg originally published as Trp184Arg (Choy et al., 2000)) N/A N/A N/A

Corresponding author at: Dept. of Neurology, Hertie Institute for Clinical Brain Research, Hoppe-Seyler-Straße 3, 72076 Tübingen, Germany. E-mail address: [email protected] (R. Schüle).

https://doi.org/10.1016/j.scr.2018.10.021 Received 3 September 2018; Received in revised form 22 October 2018; Accepted 31 October 2018 1873-5061/ © 2018 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

Please cite this article as: Nagel, M., Stem Cell Research, https://doi.org/10.1016/j.scr.2018.10.021

Stem Cell Research xxx (xxxx) xxxx

M. Nagel et al. Date archived/stock date Cell line repository/bank Ethical approval

June 2017 N/A Institutional Review Board (“Ethikkommission”) University of Tübingen Medical School, Germany, approval number 819/2016A (2016/12/21)

Resource utility

hUL,ID: #27080; pCXLE-hSK, ID: #27078 and pCXLE-hOCT3/4, ID: 27076 as described by Okita et al. (Okita et al., 2011) purchased from Addgene, Cambridge, Massachusetts), transferred to an electroporation cuvette and electroporated using the Amaxa 2b nucleofector, program P-022 (Human Dermal Fibroblast Nucleofection Kit VPD-1001 (Lonza, Basel, Switzerland)). After electroporation, cells were equally seeded into a matrigel-coated (1:60, Corning, New York, U.S.) 6-well plate in fibroblast culture medium. On the second day, medium was changed to fibroblast culture medium supplemented with 2 ng/ml FGF2 (Peprotech, Rocky Hill, New Jersey). On day three, medium was switched to E8 medium (DMEM/F12 (Life Technologies)), 64 mg/l L-ascorbic acid2-phosphate magnesium (Sigma-Aldrich, St. Louis, Missouri), 1% ITSSupplement 100× (Life technologies), 100 μg/l FGF2, 2 μg/l TGFβ1 (Peprotech) containing 100 μM Sodium Butyrate (Sigma-Aldrich) and subsequently changed every other day. After 2 to 3 weeks iPSC colonies were picked manually and placed separately onto matrigel-coated (1:60) 24-well plates. At 80% confluency iPSCs were passaged at a ratio of 1:12 using 0.2% (w/v) EDTA (AppliChem, Darmstadt, Germany) in PBS (Sigma-Aldrich) and placed onto matrigel-coated 6-well plates. During each replating, E8 medium was supplemented with the Rock inhibitor Y-27632 (1 μM, Abcam Biochemicals, Cambridge, UK). Cryostocks were archived using 50% E8, 40% KnockOut Serum Replacement (KO-SR, Life Technologies), 10% DMSO (Sigma-Aldrich) and 1 μM Y27632. Mycoplasma testing was performed using a PCR Mycoplasma Test Kit (AppliChem) following manufacturer's recommendations.

Gaucher disease is the most common autosomal recessive lysosomal storage disease and is caused by mutations in the β-glucocerebrosidase gene GBA, resulting in intracellular accumulation of glucosylceramide. The iPSC lines reported here can be used to study the pathophysiology of Gaucher disease and to carry out pharmacological screenings. Resource details Human skin fibroblasts, obtained from two unrelated individuals with neuronopathic forms of Gaucher disease, were reprogrammed using episomal plasmids encoding human OCT4, KLF4; L-MYC, SOX2 (OSKM) and LIN28 (Okita et al., 2011). Fibroblasts for line iPSC-GBA-1 were obtained from a skin biopsy of a 21 month old girl of Turkish origin carrying the recurring mutation c.1448 T > C; p.Leu483Pro (originally published as Leu444Pro, (Tsuji et al., 1987)). Fibroblasts for line iPSC-GBA-2 were acquired from a 4 year old girl carrying compound-heterozygous GBA mutations: c.667 T > C, p.Trp223Arg (originally published as Trp184Arg (Choy et al., 2000)) and c.1226A > G, p.Asn409Ser (Tsuji et al., 1988). 8–10 days after nucleofection, iPSC-like colonies became visible and could be manually picked after 20–25 days. The iPSCs exhibited an embryonic stem cell like morphology (Supplementary Fig. 1C) and were expanded for several passages. By passage 5 the iPSC lines were both transgene-free (Fig.1E) and the cell lines were confirmed to be mycoplasma-free (Supplementary Fig. 1A). Whole-genome SNP genotyping established genomic integrity (Fig. 1A and B). In addition, presence of the disease-causing mutations was confirmed via Sanger sequencing (Fig. 1C and D). The pluripotency of both lines was confirmed on protein level by immunocytochemistry for TRA-1-81, OCT4 and SSEA4 (Fig. 1F, scale bars 20 μm) and an alkaline phosphatase staining (Supplementary Fig. 1B). On transcript level, expression of OCT4, SOX2, KLF4, C-MYC, NANOG, DNMT3B and TDGF1 was verified by RT-qPCR (Fig. 1H). The two generated iPSC lines show distinct expression patterns compared to fibroblasts and have similar expression patterns as the human embryonic stem cell line HUES 6. In vitro, the differentiation potential of the iPSC lines towards the three germ layers was further demonstrated by embryoid-body-based differentiation to mesodermal, ectodermal and endodermal cell lineages (Fig. 1G, scale bars 20 μm), confirming pluripotency of the generated iPSC lines (Tables 1 and 2).

Analysis of genomic integrity Genomic DNA was extracted after the 5th passage by using a GeneJET-Genomic DNA Purification Kit (Thermo Fisher Scientific, Waltham, Massachusetts). To exclude unintentional plasmid integration, DNA was analyzed via PCR with primers specific to the reprogramming factors (Table. 3) in a Bio-Rad T100 Thermal Cycler. Hereby, a touchdown PCR was used (annealing temperature (TA) 65 °C, TA decreasing by 1 °C each cycle to 55 °C, continuing for another 25 cycles at 55 °C, elongation time (TE) 30 s). All mutation positions were confirmed by conventional Sanger sequencing on a Genetic Analyzer 3130xl (Applied Biosystems, Waltham, Massachusetts) using BigDye® Terminator v3.1 chemistry; specific amplification and sequencing primers are listed in Table 3. To target specifically the GBA gene and exclude overlapping sequences with the pseudogene a nested PCR for exon 8–11 was applied (GBA1 exon 8–11: 35 cycles, TA 60 °C, TE 90s; GBA1 exon 10: 25 cycles, TA 56 °C, TE 30se; GBA1 exon 9: 25 cycles, TA 60 °C, TE 30s; GBA1 exon 6: 25 cycles, TA 55 °C, TE 30 s). Whole-genome SNP genotyping was performed using the Infinium OmniExpressExome-8 BeadChip (Illumina, San Diego, California) to confirm genomic integrity as well as the parentage of the iPSCs from the reprogrammed fibroblasts (Fig. 1A, B). However, balanced translocations cannot be detected with this method. To independently confirm the identity of the reprogrammed cells an STR analysis of the fibroblasts and iPSCs was performed. For this, six short tandem repeats loci (D6S1624; D6S265; D10S537; D10S606; D10S1730; D10S605) were amplified via PCR (25 cycles, TA 62 °C, TE 30 s). Resulting fragments

Materials and methods Cell culture and reprogramming All cells were maintained at 37 °C and 5% CO2. Skin fibroblasts were cultured in Dulbecco's Modified Eagle's Medium (Life Technologies, Carlsbad, California) supplemented with 10% FCS (Life Technologies) to about 80% confluence. For electroporation, fibroblasts (105 cells) were resuspended in 82 μl Human Dermal Fibroblast Nucleofector solution, 18 μl supplement solution and 1 μg of each plasmid (pCXLE-

2

Stem Cell Research xxx (xxxx) xxxx

M. Nagel et al.

Fig. 1. Characterization and validation of HIHRSi001-A and HIHRSi002-A cell lines.

3

Stem Cell Research xxx (xxxx) xxxx

M. Nagel et al.

Table 1 Summary of lines. iPSC line names

Abbreviation in figures

Gender

Age

Ethnicity

Genotype of locus

Disease

iPSC-GBA-1 (HIHRSi001-A) iPSC-GBA-2 (HIHRSi002-A)

GBA-1 GBA-2

Female Female

21 months 4 years

Arab (Caucasian) European (Caucasian)

c.1448 T > C; c.1448 T > C c.667 T > C; c.1226A > G

Gaucher disease, neuronopathic Gaucher disease, neuronopathic

Table 2 Characterization and validation. Classification

Test

Result

Data

Morphology Phenotype

Photography Qualitative analysis

Normal Immunocytochemistry of pluripotency markers: OCT4, TRA-1-81, SSEA4 RT-qPCR for: OCT4, SOX2, KLF4, c-MYC, NANOG, DNMT3B, TDGF1 No large chromosomal aberrations or copy number variations;

Supplementary Fig.C Fig. 1F

Quantitative analysis (RT-qPCR) Genotype Identity

Whole genome SNP genotyping with Infinium OmniExpressExome-8 BeadChip (Illumina) Spacing (kbp): mean: 3,03; median: 1,36 STR analysis

Mutation analysis

Microsatellite PCR (mPCR) Sequencing

Microbiology and virology Differentiation potential

Southern Blot OR WGS Mycoplasma Embryoid body formation

Donor screening Genotype additional info (OPTIONAL)

HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing

6 loci (D6S1624; D6S265; D10S537; D10S606; D10S1730; D10S605) were tested; all loci match N/A iPSC-GBA-1: NM_000157.3(GBA): c.[1448 T > C]; [1448 T > C] (homozygous) iPSC-GBA-2: NM_000157.3(GBA): c.[667 T > C];[1226A > G] (compound heterozygous) N/A E.g. Mycoplasma testing by RT-PCR; Negative ß-tubulin (TUJ) smooth muscle actin (SMA) FOXA2 SOX17 Fibroblast cultures: negative N/A N/A

were analyzed using the Gene Mapper generic software (Applied Biosystems).

Fig. 1H Fig. 1 A + B Data available with the authors N/A Fig. 1C Fig. 1D N/A Supplementary Fig.A Fig. 1G Available upon request N/A N/A

mercaptoethanol (Merck)). For plating the EBs, 1 μM Y-27632 was added to the medium. After 4 days cells were plated onto coverslips coated with either matrigel (1:30) for ectodermal differentiation or gelatin (0.1%) for mesodermal differentiation and cultivated for 2 weeks in either ectodermal medium (50% DMEM/F12 with N-2 supplement (Life Technologies), 50% Neurobasal medium (Life Technologies) 1% NEAA, 1% B27-supplement with retinoic acid (RA) (Life Technologies), 1% penicillin-streptomycin, 1 mM L-glutamine,) or mesodermal medium (82% DMEM high glucose (Life Technologies), 16% FCS, 1% penicillin-streptomycin, 1% NEAA, 55 μM β-mercaptoethanol 0.0004% α-thioglycerol (Sigma-Aldrich)). Definitive endodermal differentiation was performed as described in (Carpentier et al., 2014). Endodermal, mesodermal and ectodermal differentiation was validated by immunostaining for specific markers of the three germ layers: FOXA2, SMA and TUJ (Table 3). For RT-qPCR, RNA was extracted using the High Pure RNA Isolation Kit (Roche, Penzberg, Germany) and RNA was transcribed to cDNA with the Transcriptor First Strand cDNA Synthesis Kit (Roche) according to manufacturer's instructions. The analysis was done using Light Cycler 480 SYBR Green I Master (Roche). Values were normalized to GAPDH and the pluripotency gene expression was compared to the expression pattern of the human embryonic stem cell line HUES 6 (HUES 6 cDNA was provided by courtesy of the MPI for Molecular Medicine, Münster, Germany). For relative quantification, the 2-∆∆Ct method was applied. Supplementary data to this article can be found online at https:// doi.org/10.1016/j.scr.2018.10.021.

Assessment of pluripotency The expression of pluripotency markers was validated by immunostaining, alkaline phosphatase staining and RT-qPCR. For immunostaining cells were fixed with 4% paraformaldehyde (PFA) for 15 min at RT (Merck, Darmstadt, Germany), permeabilized with 0.1% triton X (Carl Roth, Karlsruhe, Germany) and blocked with 5% bovine serum albumin (Thermo Fisher scientific) for 1 h at RT and incubated with specific antibodies for pluripotency markers (Table 3) over night at 4 °C. These were detected via secondary antibody staining (1 h at RT) with Alexa fluorophores (Table 3). Nuclear staining was performed with Hoechst 33342 (1:10.000, 5 min at RT, Invitrogen, Carlsbad, California). Images were acquired with Axio Imager Z1 with ApoTome (Zeiss, Oberkochen, Germany). For alkaline phosphatase staining, cells were fixed with 4% PFA for 1 min at RT, washed thrice with PBS and then incubated in the staining solution (20 μl naphthol AS-MX phosphate alkaline solution (SigmaAldrich) and 500 μl Fast Red (1 mg/ml, Sigma-Aldrich)) for 30 min at RT. To demonstrate the differentiation potential of iPSC into cells of all 3 germ layers an embryoid body (EB) based protocol was used. Briefly, 9*105 cells were seeded into aAggrewell 800 plate (Stemcell Technologies, Vancouver, Canada) and cultivated in EB medium (80% DMEM/F12, 20% KO-SR, 1 x NEAA (Sigma-Aldrich), 1× penicillinstreptomycin (Merck), 2 mM L-glutamine (Life technologies), 0.1 mM ß-

4

Stem Cell Research xxx (xxxx) xxxx

M. Nagel et al.

Table 3 Reagents details. Antibodies used for immunocytochemistry

Pluripotency markers Differentiation markers Secondary antibodies

Antibody

Dilution

Company Cat # and RRID

Goat anti-OCT4 Mouse anti TRA-1-81 Mouse anti SSEA-4 Mouse anti-SMA Rabbit anti-FOXA2 Mouse anti-ß-Tubulin III (TUJ) Alexa Fluor 488 donkey anti-goat IgG Alexa Fluor 488 donkey anti-mouse IgG Alexa Fluor 488 goat anti-rabbit IgG Alexa Fluor 488 goat anti-mouse IgG

1:100 1:500 1:500 1:100 1:300 1:1000 1:500 1:500 1:500 1:500

Santa Cruz, sc-8628, AB_653551 Millipore, MAB4381, AB_177638 Abcam, ab16287, AB_778073 Dako, M0851, AB_2223500 Millipore, 07-633, AB_390153 Sigma-Aldrich, T8660, AB_477590 Thermo Fisher, A11055, AB_142672 Thermo Fisher, A21202, AB_141607 Thermo Fisher, A11008, AB_143165 Thermo Fisher, A11001, AB_2534069

Primers

Episomal plasmids (PCR)

Pluripotency markers (qPCR)

House-keeping genes (qPCR) Genotyping targeted mutation analysis/sequencing

Target

Forward/Reverse primer (5′-3′)

OCT3/4_Plasmid Length: 124 bp SOX2_Plasmid Length: 111 bp KLF4_Plasmid Length: 156 bp L-MYC_Plasmid

CATTCAAACTGAGGTAAGGG/TAGCGTAAAAGGAGCAACATAG

Length: 122 bp OCT4 SOX2 KLF4 C-MYC NANOG DNMT38 TDGF1 GAPDH GBA1 Exon 8–11 Length: 1682 bp GBA1 Exon 10 Length: 329 bp GBA1 Exon 9 Length: 307 bp GBA1 Exon 6 Length: 271 bp

Acknowledgements

TTCACATGTCCCAGCACTACCAG/TTTGTTTGACAGGAGCGACAAT CCACCTCGCCTTACACATGAAG/TAGCGTAAAAGGAGCAACATAG GGCTGAGAAGAGGATGGCTAC/TTTGTTTGACAGGAGCGACAAT GGAAGGTATTCAGCCAAACG/CTCCAGGTTGCCTCTCACTC AGCTCGCAGACCTACATGAA/CCGGGGAGATACATGCTGAT CCCCAAGATCAAGCAGGAGG/GGGCAGGAAGGATGGGTAAT ATTCTCTGCTCTCCTCGACG/CTGTGAGGAGGTTTGCTGTG CAAAGGCAAACAACCCACTT/TGCGTCACACCATTGCTATT ACGACACAGAGGACACACAT/AAGCCCTTGATCTTTCCCCA GGTCTGTGCCCCATGACA/AGTTCTGGAGTCCTGGAAGC TCACCAGGGCTGCTTTTAAC/GACAAGCTTCCCGTTCTCAG TGTGTGCAAGGTCCAGGATCAG/ACCACCTAGAGGGGAAAGTG CAGGAGTTATGGGGTGGGTC/GAGGCACATCCTTAGAGGAG CACAGGGCTGACCTACCCAC/GCTCCCTCGTGGTGTAGAGT CTCTGGGTGCTTCTCTCTTC/ACAGATCAGCATGGCTAAAT

S.S., Feinstone, S.M., Liang, T.J., 2014. Engrafted human stem cell-derived hepatocytes establish an infectious HCV murine model. J. Clin. Invest. 124, 4953–4964. Choy, F.Y., Wong, K., Vallance, H.D., Baldwin, V., 2000. Novel point mutation (W184R) in neonatal type 2 Gaucher disease. Pediatr. Dev. Pathol. 3, 180–183. Okita, K., Matsumura, Y., Sato, Y., Okada, A., Morizane, A., Okamoto, S., Hong, H., Nakagawa, M., Tanabe, K., Tezuka, K., Shibata, T., Kunisada, T., Takahashi, M., Takahashi, J., Saji, H., Yamanaka, S., 2011. A more efficient method to generate integration-free human iPS cells. Nat. Methods 8, 409–412. Tsuji, S., Choudary, P.V., Martin, B.M., Stubblefield, B.K., Mayor, J.A., Barranger, J.A., Ginns, E.I., 1987. A mutation in the human glucocerebrosidase gene in neuronopathic Gaucher's disease. N. Engl. J. Med. 316, 570–575. Tsuji, S., Martin, B.M., Barranger, J.A., Stubblefield, B.K., Lamarca, M.E., Ginns, E.I., 1988. Genetic heterogeneity in type 1 Gaucher disease: multiple genotypes in Ashkenazic and non-Ashkenazic individuals. Proc. Natl. Acad. Sci. U. S. A. 85, 2349–2352.

This study was funded by the E-RARE JTC grant “NEUROLIPID” (BMBF, 01GM1408B to RS), the European Union grant “Solve-RD” from the Horizon 2020 research and innovation programme (to RS), and the National Institute of Health (NIH) (grant 5R01NS072248 to RS). We acknowledge support by Deutsche Forschungsgemeinschaft and Open Access Publishing Fund of University of Tübingen. References Carpentier, A., Tesfaye, A., Chu, V., Nimgaonkar, I., Zhang, F., Lee, S.B., Thorgeirsson,

5