Genomic organization and cloning of novel genes encoding toxin-like peptides of three superfamilies from the spider Orinithoctonus huwena

peptides 29 (2008) 1679–1684

available at www.sciencedirect.com

journal homepage: www.elsevier.com/locate/peptides

Genomic organization and cloning of novel genes encoding toxin-like peptides of three superfamilies from the spider Orinithoctonus huwena Liping Jiang a,b, Jinjun Chen a, Li Peng a, Yongqun Zhang a, Xia Xiong a, Songping Liang a,* a

Key Laboratory of Protein Chemistry and Developmental Biology of the Ministry of Education, College of Life Sciences, Hunan Normal University, Changsha, Hunan 410081, PR China b Xiangya Medical School, Central South University, Changsha, Hunan 410078, PR China

article info

abstract

Article history:

The bird spider Ornithoctonus huwena is one of the most venomous spiders in China. Its

Received 12 April 2008

venom is a mixture of various compounds with diverse bioactivities. Ninety proteins and 47

Received in revised form

peptides have been identified, and 67 cDNA sequences encoding different toxin precursors

30 May 2008

have been cloned. However, the genomic DNA of them is seldom reported. To characterize

Accepted 3 June 2008

the genomic DNA structure of huwentoxins, the genomic DNA encoding toxins of three

Published on line 12 June 2008

superfamilies were cloned by using sequence specific or partially degenerate primers based on their cDNA sequences. An unexpected finding was that the intron was lacking in the

Keywords:

genomic sequences of three superfamilies. The genomic DNA information has predictive

Ornithoctonus huwena

value for better understanding the relationship of spider toxin evolution. In addition, we

Spider

have cloned and analyzed 19 novel genes encoding toxin-like precursors by using the

Intron

genomic DNA of the spider O. huwena.

Genomic organization

# 2008 Published by Elsevier Inc.

Toxin-like peptide

1.

Introduction

The spider Ornithoctonus huwena is mainly distributed in the hilly areas of Guangxi and Yunnan provinces in the south of China. Using a combination of one-dimension gel electrophoresis (1-DE), two-dimension gel electrophoresis (2-DE) and mass spectrometry, 90 proteins have been identified from the spider venom, including dual-specificity phosphatase (DSP), heat shock cognate 70 protein (HSC70), and the protein with immunoglobulin heavy chain variable domain [28]. More than 100 components were detected by mass spectrometry and 47 peptides with divergent structures and biological activities were sequenced by Edman degradation [28]. 67 cDNA sequences encoding different toxin precursors are cloned by * Corresponding author. Tel.: +86 731 8872556; fax: +86 731 8861304. E-mail address: [email protected] (S. Liang). 0196-9781/$ – see front matter # 2008 Published by Elsevier Inc. doi:10.1016/j.peptides.2008.06.001

using the expressed sequence tag (EST) strategy. According to their sequence identity, these precursors can be classified into eight superfamilies, and most of them are composed of signal peptide, propeptide region and mature toxin region [13]. Spider venom contains a variety of small peptides, the structures of which have been reported, such as ‘inhibitor cystine-knot’ (ICK), disulfide-directed beta-hairpin (DDH) and Kunitz-type motif [16,21,23]. The spider toxins with different scaffolds result in diverse biological functions. HWTX-X can specifically block N-type Ca2+ channels [17], and HWTX-I can reduce the peak currents of both N-type Ca2+ channels and TTX-S Na+ channels on adult rat dorsal root ganglion (DRG) neurons [27]. HWTX-XI is a potent trypsin inhibitor and can also block K+ channels [21].

1680

peptides 29 (2008) 1679–1684

Many organizations about genomic DNA encoding toxinlike peptides from venomous animals have been reported, however, some of them contain the intron [14,29,30], whereas others have not any intron [8,18]. The genetic loci for many scorpion toxins have a conserved architecture in which a single intron interrupts the coding sequence for the signal peptide. This is different from that of cone snails where the encoding sequences for signal peptide, propeptide and mature toxin are neatly separated by two larger introns [2,25]. Currently available DNA sequence information encoding spider toxin is rare. On the one hand, the intron is lacking in the genomic sequence of SHT-I from the spider O. huwena [22]. On the other hand, the gene structure of the toxin sphingomyelinase D (SMaseD) from venoms of Loxosceles arizonica spider contains at least five introns [6]. While alpha- and deltalatroinsectotoxins sequences of the chromosomal DNA from black widow spider Latrodectus mactans do not contain any intron [8], gene for insecticidal peptide from the weaving spider Diguetia canities contains four introns [14]. To further investigate whether the genes encoding toxin-like peptides from the spider O. huwena contain a common intronless feature, we clone and analyze the genomic DNA sequences of three superfamilies in this study.

2.

Materials and methods

2.1.

Materials

Genomic DNA purification kit, pGEM1-T easy vector system and gel purification kit Wizard DNA Clean-Up System for PCR product were from Promega. X-gal (5-bromo-4-chloro-3indolyl-b-D-galactoside), IPTG (isopropyl-thio-b-D-galactoside) and dNTP were purchased from MBI. Taq DNA polymerase with proofreading function was from TaKaRa. XL1Blue Escherichia coli strain was from Stratagene. O. huwena alive spiders with the same sex and age were collected in Guangxi Province, China.

2.2.

Primer designing

The primers of 11gF and 11gR were designed according to the nucleotide sequences of HWTX-XI (accession number EU195290). 17gF and 17gR were designed based on the 50 untranslational region (50 UTR) and 30 untranslational region (30 UTR) of both HWTX-XVIIa (accession number EU195285) and HWTX-XVIIb4 (accession number EU195283), respectively. 18gLF and 18gLR were designed based on the 50 UTR and polyadenylation signal region of HWTX-XVIIIb (accession number EU195230), while 18gSF and 18gSR were designed corresponding to 230–221 and 378–397 nucleotides of putative mature peptide of HWTX-XVIIIb. All primers used in this study were synthesized by Shanghai Sangon Biological Engineering Technology and Service Co., Ltd and listed in Table 1.

2.3.

Preparation and amplification of genomic DNA

The total genomic DNA was extracted from the muscle tissue of three O. huwena specimens according to the manufacturer’s instructions. The PCR mixture contained 800 ng of genomic

Table 1 – The PCR primers Primer name 17gF 17gR 11gF

Sequence (50 –30 ) AGATC(C/G)CCTGAAAAAATCA CATTT(A/G)AAGCATATTGGTAG GAATCTT(G/T)GCGCTT(C/ G)TCTGTC CTCAAGTAGGTG(C/T)TGACGAT GACTCTAAGAAGGGGGAAG ACGCAAATTTCTTTATTTCTTAC GCGTGCAGCAAACAGATTG CTATACGCAAAACGAGAAGC

11gR 18gLF 18gLR 18gSF 18gSR

Sequences are displayed in Supplementary Figs. I–III.

DNA and 1 mM primers. The sample was subjected to an initial incubation at 94 8C for 5 min. It was then subjected to 30 cycles of 1 min at 94 8C, 1 min at 60 8C, and 2 min at 72 8C. The last cycle was followed by an extension step at 72 8C for 10 min. If the primers did not produce amplification products in the first round of PCR then 1 ml of this PCR product was used as the template for the second round. The PCR products were subjected to electrophoresis on a 1% agarose gel.

2.4.

Cloning and DNA sequencing

The PCR products were purified and ligated into a pGEM-T Easy vector. After transformation into XL1Blue E. coli competent cells, transformed colonies were screened using white-blue identification and the positive clones were sequenced using an ABI PRISMTM 3700 DNA Automatic Sequencer.

2.5.

Sequence analysis

Identity and similarity assessment were searched against Basic Local Alignment Search Tool (BLAST, www.ncbi.nlm.nih.gov/blast) [3]. The signal peptide was predicted with the SignalP 3.0 program (http://www.cbs.dtu.dk/services/SignalP/) [5]. The phylogenetic analysis of genes encoding toxin-like peptides was conducted by MEGA 3.1 [15]. Nucleotide and amino acid multiple alignments were generated using the Clustal W program [26].

3.

Results

3.1. Genomic organization and cloning of novel toxins of the HWTX-XVII superfamily The HWTX-XVII superfamily contains six novel toxin-like precursors cloned by EST strategy [13]. cDNA sequences of HWTX-XVIIa and HWTX-XVIIb4 have 72.5% sequence identity, while the open reading frames (ORF) have sequence identity of about 60%. So a set of degenerate primers based on cDNA sequences are designed to amplify their genomic DNA sequences. Genomic DNA of the HWIX-XVII superfamily were amplified and cloned by using the primer sets 17gF/17gR. 21 clones encoding the same ORF as HWTX-XVIIa and 11 clones encoding the identical ORF with HWTX-XVIIb4 are found out of 43 clones. No any intron is found in the cloned genomic sequences of HW17g1 and HW17g8. The sequences of the genomic DNA and

peptides 29 (2008) 1679–1684

1681

Fig. 1 – Alignment of the amino acid sequences of all members of the HWTX-XVII superfamily cloned in genomic DNA. Different amino acids in the sequences are shown by asterisks. Cysteine residues are boxed in black and different amino acids are shaded in grey compared with HWTX-XVIIa and HWTX-XVIIb4, respectively. Identity% is the identity score of the peptide compared with HWTX-XVIIa. The putative mature peptide is underlined and deletions (S) are introduced in the sequences to maximize homology.

cDNA are almost identical. There is only a different nucleotide between two primers region of HWTX-XVIIb4 and HW17g8, while HWTX-XVIIa and HW17g1 have three different nucleotides in the same region (Supplementary Fig. I online). Six novel genes encoding toxin-like peptides were also found from the genomic DNA, which can be grouped into two families (named HWTX-XVIIa and HWTX-XVIIb family) based on the sequence identity of their precursors. Both families share low sequence identity, although they have an identical framework of ‘‘-C-C-CCXXXCXC-CXC-’’, where X is any amino acid residue (Fig. 1). HW17g1, HW17g3 and HW17g20 belong to the HWTX-XVIIa family, and all of them have only one different amino acid. The remaining novel toxin-like peptides can be classified into the HWTX-XVIIb family with one amino acid residue difference between each other (Fig. 1).

3.2. Genomic organization and cloning of novel toxins of the HWTX-XVIII superfamily Owing to the possibility of genomic polymorphism, two pairs of primers were designed to amplify genomic DNA sequence of the HWTX-XVIII superfamily. The genomic DNA of HWTXXVIIIb family was successfully cloned. The genomic DNA is very similar to the cDNA, with only three nucleotides difference between HWTX-XVIIIb and HW18gL8 (Supplementary Fig. II online), so we draw a conclusion that the intron is also lacking in the genomic DNA of HWTX-XVIIIb family. The HWTX-XVIII superfamily includes HWTX-XVIIId (accession number EU195234), whose the mature peptide is different from any other member in this superfamily [13]. However, the genomic DNA of HWTX-XVIIId cannot be amplified by using the primer sets 18gLF/18gLR or 18gSF/18gSR. These findings demonstrate that the spider genomic DNA is very complex. HW18gS3 was cloned by the primer sets 18gSF/18gSR, the nucleotide sequence of which is highly variable compared with that of HWTX-XVIIIb. The identity score of HW18gS3 is only 44.7% compared with the ORF of HWTX-XVIIIb, while HW18gS3 share 81.2% sequence identity with the putative mature peptide of HWTX-XVIIIb. There are 12 different amino acid residues, four, four, two and two of which mutate isoleucines, histidines, serines and glutamic acids in HW18gS3 compared with the putative mature peptide of HWTX-XVIIIb, respectively. Eight novel genes encoding toxin-like peptides were cloned from genomic DNA using two pairs of primers, the

putative mature peptides of which are almost identical except HW18gS3 (Fig. 2). Using the primer sets 18gSF/18gSR, HW18gS5 and HW18gS6 were also cloned, with three amino acid residues difference between each other in their putative mature peptides. HW18gM4 contains an odd number of cysteines as HWTX-XVIIIc2 (accession number EU195232) and HWTX-XVIIIc3 (accession number EU195233) because of nucleotide mutation [13]. Moreover, peptides containing an odd number of cysteines were also found in other animals, such as v-Aga-IA from the American funnel web spider of Agelenopsis aperta having nine cysteines identified by Edman sequencing [1], QcaL-1 and QcaL-2 with three cysteines cloned from genomic DNA of cone snails [29].

3.3. Genomic organization and cloning of novel toxins of the HWTX-XI superfamily Using the primer sets 11gF and 11gR, genomic DNA sequences of the HWTX-XI superfamily were cloned (Supplementary Fig. III online). The cDNA sequence of HWTX-XI is highly similar to the genomic DNA sequence of HW11g8, both of which have only eight different nucleotides. At the same time, HW11g3 was cloned from the spider genomic DNA with the same primer sets, the sequence of which is different from those of HWTX-XI and HW11g8. While there are only three different nucleotides in HW11g3 compared with the cDNA sequences of HW11c10 cloned by PCR amplification using primers designed according to the nucleotide sequences of HWTX-XI (unpublished data). Surprising, the gene of HW11g14 and HW11g5 cannot encode any ORF. HW11g14 is shorter 129-nucleotide fragment than HW11g8, which have an AT-AG splice junction as the intron splice sites in the spider Argiope aurantia [4]. Furthermore, HW11g3 containing a 129-nucleotide fragment is longer than HW11g5, which also has a universal GT-AG splice junction (Supplementary Fig. III online). On the basis of the nucleotide sequences of cDNA and genomic DNA, first of all, we suppose that there is no any intron in region between 11gF and 11gR of the HWTX-XI superfamily. Furthermore, we presume that the intron is transformed into the exon because of alternative splicing to adapt to the environment. Five novel genes encoding toxin-like peptides of the HWTX-XI superfamily were cloned from the spider O. huwena genomic DNA. These toxin-like peptides deduced from genomic DNA can be classified into two families based on

1682

peptides 29 (2008) 1679–1684

Fig. 2 – Alignment of the amino acid sequences of all member of the HWTX-XVIII superfamily cloned in genomic DNA. Cysteine residues are boxed in black, different amino acids are shaded in grey. Identity% is the identity score of the peptide compared with HWTX-XVIIIb. The putative mature peptide is underlined and deletions (S) are introduced in the sequences to maximize homology.

Fig. 3 – Alignment of the amino acid sequences of all member of the HWTX-XI superfamily cloned in the spider Ornithoctonus huwena genomic DNA. Cysteine residues are boxed in black, different amino acids are shaded in grey. The mature peptide is underlined and Identity% is the identity score of the peptide compared with HWTX-XI.

the sequence identity. The ORF of HW11g11 and HW11g8 have high identity with that of HWTX-XI, all of which belong to the same family. HW11g3 and HW11g6 are highly identical with HW11g9, differing only one amino acid residue at position of 41 from each other, which can be classified into another family. The position of 41 in this family is a highly variable site due to the nucleotide mutation. At the site of 68, the amino acid residue is a tyrosine instead of a universal cysteine, which is another outstanding character of HW11g3, HW11g6 and HW11g9. The mutation results in forming an odd number of cysteines, suggesting that they might have structure and function different from HWTX-XI (Fig. 3). Based on HW11g14, HW11g5 and five novel genes encoding toxin-like peptides from the HWTX-XI superfamily, a phylogenetic tree was generated by using the neighbor-joining method. These sequences were clustered in the tree, which included three clades (data not shown). Five genes from two

clades were phylogenetically closed, which can encode toxinlike precursors. However, genes from the third clade, which cannot encode any ORF, are not close to those from other clades in the phylogenetic tree.

4.

Discussion

Some genomic DNA sequences encoding toxin peptides from cone snail and several arthropods have been reported. A long intron located in the pro-region of the alpha conotoxins was identified from the genomic DNA of cone snail [29]. The Mesotoxin from the old world scorpion Mesobuthus martensii genomic DNA contains two introns, located within 50 UTR and signal peptide coding region, respectively [30]. However, the genomic organization of two genes that codify for peptides devoid of cysteine residues from M. martensii has different

peptides 29 (2008) 1679–1684

characterization. The BmKa1 gene is not interrupted by any intron, while the intron of the BmKa2 gene is located in the DNA region encoding the mature peptide [18]. In the genomic DNA of the scorpion Leiurus quinquestriatus defensin gene, there is one intron towards the 30 end of the leader sequence, whereas in the tick (Ornithodoros moubata), there are two introns [10]. The defensin gene from hard tick Dermacentor variabilis does not contain any intron [12], and fly (Drosophila melanogaster) defensin genes have not any intron [10]. The absence of an intron in fly defensin genes can be explained by the loss of the intron during evolution to minimize genome size [20]. This variability suggests that the exon encoding the mature defensin has undergone exon-shuffling and integrated downstream of unrelated leader sequences during evolution [10]. The genomic DNA information will provide a better understanding of the relationship of toxin evolution. Currently, the genomic DNA has been used for spider systematics, such as ribosomal genes [7], elongation factor-1 gamma [4] and egg case silk genes [11]. Limited information about the organization of genomic DNA encoding the spider toxins has been reported. The SMaseD genes from Loxosceles arizonica span at least 6500 bp and contain at least 5 introns [6], which contribute to better understanding the evolution of this toxin. The gene structure of DTX9.2 from the primitive weaving spider Diguetia canities contain 4 introns, of which the first and second intron are located in the 50 UTR and propeptide region, respectively, while the remaining introns are situated in the mature toxin [14]. All members of the HWTX-XVII superfamily and DTX9.2 have an identical ‘‘-c-ccc-c-c-c-c-’’ cysteine framework in their mature toxin region, while any intron is not been found in the genomic DNA structural of the HWTX-XVII superfamily. The genes encoding the mature peptides of HWTX-IV and HWTX-VIII are intronless indicated by sized PCR products (data not shown). We tried to amplify the genomic DNA of the HWTX-XIV superfamily and HWTX-XV superfamily. The primers were designed corresponding to nucleotides of putative mature peptide of HWTX-XIVa2 (accession number EU195238) and HWTX-XVa1 (accession number EU195235). An unexpected finding was that we did not detect any amplification products by PCR. We chose the cDNA sequences of the spider O. huwena encoding different mature toxins to amplify their genomic DNA. The number of amino acid residues of ORF from HWTXXVIIb4, HWTX-XVIIIb and HWTX-XI is 78, 109 and 88, respectively, of which the genomic DNA does not contain any intron. There is also no any intron in the genomic DNA of HWTX-IV, HWTX-VIII and HWTX-XI judged by sized PCR products or sequence analysis. In addition, the intron is lacking in the genomic sequence of SHT-I from the spider O. huwena [22]. On the basis of the available genomic DNA encoding different toxins from the spider O. huwena, there is a common intronless feature in genomic DNA. This conclusion still requires to be clarified with more experiments. The absence of intron in the spider O. huwena genomic DNA encoding toxins maybe result from exon-shuffling, alternative splicing or RNA editing during toxin evolution. The spider O. huwena might minimize genome size by the loss of the intron during evolution to produce potent and specific toxins for different types of prey. However, the question that whether

1683

the absence of intron has an impact on the biological significance of spider toxins remains unanswered. The gene structure may be different among different spider species, which results in the diversification of the spider toxins, and thus varied toxins are found in different spiders. Using the genomic DNA of the brown spider Loxosceles genus, the DNA of LsD1 encoding a dermonecrotic protein was cloned [24]. Spider venoms can be regarded as a complex natural library of polypeptide components. A conservative estimation of 500 peptides per venom would lead to a total of 19,000,000 toxins for the 38,000 known spider species [9]. Up to now, only a few of known toxins or toxin-like genes have been reported. About 130 non-identical sequences from the spider Agelena orientalis were cloned by the design of hybrid partially degenerate primers for use with RT-PCR and RACE-PCR, which was an effective highthroughput methodology to identify novel neurotoxin-like peptides [19]. An EST cloning approach will be biased towards the highly abundant transcripts while lower abundance molecular species will likely escape detection. The genomic DNA is stable as a template to clone novel genes. Using specific or partially degenerate primers, 19 genes encoding toxin-like peptides were amplified and cloned, and could be grouped into three superfamiles according to their sequence identity. We did not get the cDNA sequence of 18gs3 from cDNA library while 18gs3 gene was found in the genomic DNA, which could be explained by the genomic DNA for its stability. 21 novel genomic DNA in this study were deposited in the GenBank under accession numbers EU635730 to EU635750. In summary, the absence of an intron in the spider O. huwena genomic DNA of three superfamily toxins will provide a better understanding of the relationship of toxin evolution. Using specific or partially degenerate primers, 19 novel genes encoding toxin-like peptides were found in genomic DNA for its stability.

Acknowledgements The authors are grateful to Dr. Dongyi Zhang and Dr. Zhonghua Liu for expert assistance and helpful discussions of this work. The authors thank Dr. Ying Wang and Yucheng Xiao for patiently giving us advice for revising the manuscript. This project was supported by the National Natural Science Foundation of China under contract nos. 30430170, 30870640 and 30700127.

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.peptides.2008.06.001.

references

[1] Adams ME, Bindokas VP, Hasegawa L, Venema VJ. Omegaagatoxins: novel calcium channel antagonists of two subtypes from funnel web spider (Agelenopsis aperta) venom. J Biol Chem 1990;265:861–7.

1684

peptides 29 (2008) 1679–1684

[2] Alami M, Ce´ard B, Legros C, Bougis PE, Martin-Eauclaire MF. Genomic characterisation of the toxin Amm VIII from the scorpion Androctonus mauretanicus mauretanicus. Toxicon 2006;47:531–6. [3] Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990;215:403–10. [4] Ayoub NA, Garb JE, Hedin M, Hayashi CY. Utility of the nuclear protein-coding gene, elongation factor-1 gamma (EF-1gamma), for spider systematics, emphasizing family level relationships of tarantulas and their kin (Araneae: Mygalomorphae). Mol Phylogenet Evol 2007;42:394–409. [5] Bendtsen JD, Nielsen H, von Heijne G, Brunak S. Improved prediction of signal peptides: SignalP 3.0. J Mol Biol 2004;340:783–95. [6] Binford GJ, Cordes MH, Wells MA. Sphingomyelinase D from venoms of Loxosceles spiders: evolutionary insights from cDNA sequences and gene structure. Toxicon 2005;45:547–60. [7] Crews SC, Hedin M. Studies of morphological and molecular phylogenetic divergence in spiders (Araneae: Homalonychus) from the American southwest, including divergence along the Baja California Peninsula. Mol Phylogenet Evol 2006;38:470–87. [8] Danilevich VN, Grishin EV. The chromosomal genes for black widow spider neurotoxins do not contain introns] [Article in Russian]. Bioorg Khim 2000;26:933–9. [9] Escoubas P. Molecular diversification in spider venoms: a web of combinatorial peptide libraries. Mol Divers 2006;10:545–54. [10] Froy O, Gurevitz M. Arthropod and mollusk defensins— evolution by exon-shuffling. Trends Genet 2003;19:684–7. [11] Garb JE, Hayashi CY. Modular evolution of egg case silk genes across orb-weaving spider superfamilies. Proc Natl Acad Sci 2005;102:11379–84. [12] Hynes WL, Ceraul SM, Todd SM, Seguin KC, Sonenshine DE. A defensin-like gene expressed in the black-legged tick, Ixodes scapularis. Med Vet Entomol 2005;19:339–44. [13] Jiang LP, Peng L, Chen JJ, Zhang YQ, Liang SP. Molecular diversification based on analysis of expressed sequence tags from the venom glands of the Chinese bird spider Ornithoctonus huwena. Toxicon 2008;51: 1479–89. [14] Krapcho KJ, Kraljr RM, Vanwagenen BC, Eppler KG, Morgan TK. Characterization and cloning of insecticidal peptides from the primitive weaving spider Diguetia canities. Insect Biochem Mol Biol 1995;25:991–1000. [15] Kumar S, Tamura K, Nei M. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform 2004;5:150–63. [16] Liang SP. An overview of peptide toxins from the venom of the Chinese bird spider Selenocosmia huwena Wang [=Ornithoctonus huwena (Wang)]. Toxicon 2004;43:575–85.

[17] Liu ZH, Dai J, Dai LJ, Deng MC, Hu Z, Hu WJ, et al. Function and solution structure of Huwentoxin-X, a specific blocker of N-type calcium channels, from the Chinese Bird Spider Ornithoctonus huwena. J Biol Chem 2006;281:8628–35. [18] Luo F, Zeng XC, Hahin R, Cao ZJ, Liu H, Li WX. Genomic organization of four novel nondisulfide-bridged peptides from scorpion Mesobuthus martensii Karsch: gaining insight into evolutionary mechanism. Peptides 2005;26:2427–33. [19] Pan Z, Barry R, Lipkin A, Soloviev M. Selection strategy and the design of hybrid oligonucleotide primers for RACE-PCR: cloning a family of toxinlike sequences from Agelena orientalis. BMC Mol Biol 2007;8:32. [20] Patthy L. Genome evolution and the evolution of exonshuffling—a review. Gene 1999;238:103–14. [21] Peng K, Lin Y, Liang SP. Nuclear magnetic resonance studies on huwentoxin-XI from the Chinese bird spider Ornithoctonus huwena: 15N labeling and sequence-specific 1H, 15N nuclear magnetic resonance assignments. Acta Biochim Biophys Sin (Shanghai) 2006;38:457–66. [22] Qiao P, Zuo XP, Chai ZF, Ji YH. The cDNA and genomic DNA organization of a novel toxin SHT-I from spider Ornithoctonus huwena. Acta Biochim Biophys Sin (Shanghai) 2004;36:656–60. [23] Shu Q, Lu SY, Gu XC, Liang SP. The structure of spider toxin huwentoxin-II with unique disulfide linkage: evidence for structural evolution. Protein Sci 2002;11:245–52. [24] Silvestre FG, De Castro CS, De Moura JF, Giusta MS, De Maria M, A´ lvares E´SS, et al. Characterization of the venom from the Brazilian Brown Spider Loxosceles similis Moenkhaus, 1898 (Araneae, Sicariidae). Toxicon 2005;46:927–36. [25] Sollod BL, Wilson D, Zhaxybayeva O, Gogarten JP, Drinkwater R, King GF. Were arachnids the first to use combinatorial peptide libraries? Peptides 2005;26:131–9. [26] Thompson JD, Higgins DG, Gibson TJ. ClustalW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl Acids Res 1994;22:4673–80. [27] Wang MC, Guan X, Liang SP. The cross channel activities of spider neurotoxin huwentoxin-I on rat dorsal root ganglion neurons. Biochem Biophys Res Commun 2007;357:579–83. [28] Yuan CH, Jin QH, Tang X, Hu WJ, Cao R, Yang SQ, et al. Proteomic and peptidomic characterization of the venom from the Chinese bird spider, Ornithoctonus huwena, Wang. J Proteome Res 2007;6:2792–801. [29] Yuan DD, Han YH, Wang CG, Chi CW. From the identification of gene organization of a conotoxins to the cloning of novel toxins. Toxicon 2007;49:1135–49. [30] Zhu S, Gao B. Molecular characterization of a possible progenitor sodium channel toxin from the Old World scorpion Mesobuthus martensii. FEBS Lett 2006;580:5979–87.