Genotyping by allele-specific l -DNA-tagged PCR

Journal of Biotechnology 135 (2008) 157–160

Contents lists available at ScienceDirect

Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec

Short communication

Genotyping by allele-specific l-DNA-tagged PCR Gosuke Hayashi, Masaki Hagihara, Kazuhiko Nakatani ∗ Department of Regulatory Bioorganic Chemistry, The Institute of Scientific and Industrial Research, Osaka University, 8-1 Mihogaoka, Ibaraki 567-0047, Japan

a r t i c l e

i n f o

Article history: Received 3 September 2007 Received in revised form 28 January 2008 Accepted 14 March 2008 Keywords: Single nucleotide polymorphism (SNP) typing Allele-specific PCR l-DNA Surface plasmon resonance (SPR) imaging

a b s t r a c t We have developed a novel method for typing single-nucleotide polymorphisms (SNPs) that can be applicable to rapid screening. The method involves the fusion of two PCR techniques, allele-specific PCR (AS-PCR) and l-DNA-tagged PCR (LT-PCR), which enables us to label PCR products with sequence-defined tags of mirror-image DNA (l-DNA). PCR products were applied without any purification or denaturation steps to gold surfaces where complementary single-stranded l-DNA was immobilized, and the products were detected with surface plasmon resonance (SPR) imaging. We were able to clearly discriminate 3 genotypes at position 2677 of the MDR1 gene (G/G-homozygote, G/T-heterozygote, and T/T-homozygote) by comparing SPR difference images. © 2008 Elsevier B.V. All rights reserved.

1. Introduction Single nucleotide polymorphisms (SNPs) are common variations in genomic DNA sequences, and many methods for detecting SNPs have been developed (McCarthy and Hilfiker, 2000; Syvanen, 2001; Kwok, 2001; Nakatani, 2004; Strerath and Marx, 2005). More than two million SNPs have been discovered and identified so far. Characterization of SNPs provides insights into how to develop tailor-made therapies optimized to match the genetic composition of the individual. After previously unknown SNPs are identified, high-throughput screening is needed to score the genotypes of large numbers of samples at the position of the SNP. Allele-specific PCR (AS-PCR; Newton et al., 1989; Okayama et al., 1989) assay is one of the best methods for SNP typing because of the cost, convenience, and detection time. Mutated DNA polymerases with high fidelity have been developed and will be applicable better SNP typing by AS-PCR (Summerer et al., 2005; Rudinger et al., 2007; Strerath et al., 2007). However, it is difficult to adapt AS-PCR to highthroughput screening systems because the PCR product is normally detected by gel analysis or monitored in real-time by using a dye specific for double-stranded DNA. High-throughput SNP genotyping by AS-PCR was achieved first through the use of universal FRET primers that are independent of the target sequence (Myakishev et al., 2001). This method is rapid and simple but needs expensive fluorescent dyes, and designing the sequence of universal primers is not straightforward.

∗ Corresponding author. E-mail address: [email protected] (K. Nakatani). 0168-1656/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.jbiotec.2008.03.011

Recently, we have reported that l-DNA-tagged PCR (LT-PCR) offers amplified DNA coded by sequence-defined l-DNA tag (Hayashi et al., 2007). l-DNA is an enantiomer of natural d-DNA (Fujimori et al., 1990; Urata et al., 1991; Garbesi et al., 1993) that consists of l-2 -deoxynucleotides. Single-stranded l-DNA can interact with complementary l-DNA but not with any d-DNA, and natural enzymes such as nuclease and polymerase cannot act on l-DNA because of the chirality of the macromolecule (Williams et al., 1997; Hauser et al., 2006). Because Taq DNA polymerase cannot elongate primer on an l-DNA template, the l-DNA-tagged primer (LT-primer) produces PCR product with an anchoring lDNA sticky end after the PCR reaction. Here, we present a new SNP typing method that provides rapid and fluorescent label-free platform by using l-DNA tag technology (Fig. 1). Our method combines conventional AS-PCR with LT-PCR, leading to microarray analyses applicable to rapid screening of genotypes. To demonstrate the method, we used surface plasmon resonance (SPR) imaging assays to genotype a well-studied SNP site located on exon 21 of the MDR1 gene (G2677T) that encodes the multidrug-resistant transporter belonging to the ATP-binding cassette superfamily of membrane transporter (Chen et al., 1986; Morita et al., 2003). 2. Materials and methods 2.1. LT-primers and l-oligodeoxynucleotides LT-primers (L1-MDR1-MU and L2-MDR1-WT) and 3 -thiolmodified l-DNAs (L1C and L2C) were synthesized on an Applied Biosystems 392 DNA/RNA synthesizer (Applied Biosystems, Foster City, CA) using a conventional solid-phase method. The reverse

158

G. Hayashi et al. / Journal of Biotechnology 135 (2008) 157–160

Fig. 1. Schematic representation of SNP typing using an allele-specific LT-PCR method. Spotted lines and shaded lines are different l-oligonucleotides. Black filled lines are d-oligonucleotides. l-Oligonucleotides complementary to the l-DNA tag sequences in the LT-primers are immobilized onto a SPR sensor chip, enabling the detection of each amplified product.

primer (MDR1-RV) was purchased from Hokkaido System Science (Sapporo, Japan). l-Deoxynucleoside phosphoramidites (A, G, C, and T) were synthesized according to reported procedures (Urata et al., 1992). Synthesized oligonucleotides were purified by reversed phase HPLC; elution was performed with a solvent mixture of 0.1 M triethylammonium acetate (TEAA) buffer and acetonitrile. LT-primers were further purified by polyacrylamide gel electrophoresis (PAGE) in a 10% polyacrylamide gel containing 7 M urea, and stained with SYBR Green I. Each oligonucleotide was identified by MALDI-TOF MS with a matrix of 2 ,3 ,4 -trihydroxyacetophenone.

5 mg/mL MAL-PEG12 -NHS ester (Quanta Biodesign), a heterobifunctional crosslinker, to create a maleimido-modified surface (Kyo et al., 2004). Ten-nanoliter drops of 20 ␮M thiol-terminated l-DNA were delivered onto the maleimido surface using an automated spotter (TOYOBO). The maleimido-thiol coupling reaction was left overnight. The array surface was further reacted with 200 ␮L of 2 mg/mL PEG-thiol for 2 h to block the remaining maleimido groups. The array surface was rinsed with a phosphate buffer (10 mM phosphate [pH 7.2] and 150 mM NaCl) and water. This phosphate buffer was used for all reactions in array fabrications. 2.4. SPR imaging analysis of LT-PCR products

2.2. Allele-specific LT-PCR The allele-specific LT-PCR was carried out with a forward primer of L1-MDR1-MU or L2-MDR1-WT and a reverse primer MDR1-RV on 381 bp of PCR-amplified DNA templates, including the G2677T SNP site in the human MDR1 gene. The template DNA was given by TOYOBO Co., Ltd. Biotechnology Frontier Project (Japan). All PCR reactions were carried out in a total volume of 25 ␮L, containing 400 nM of primer set, 1.5 mM MgCl2 , 200 ␮M each dNTP and 10,000-fold diluted DNA template with Taq PCR Master Mix Kit (QIAGEN). The amplification program consisted of 95 ◦ C for 120 s, followed by 35 cycles of 95 ◦ C for 6 s, annealing at 62 ◦ C for 15 s, and 72 ◦ C for 20 s. The PCR products were analyzed by native PAGE (10% polyacrylamide gel, stained by ethidium bromide). 2.3. Fabrication of an l-DNA-immobilized SPR imaging array A gold-coated chip (SPR-200) for SPR imaging analysis was purchased from TOYOBO (Tsuruga, Japan). A 200 ␮L solution of 1 mM 8-amino-1-octanethiol (DOJINDO, JAPAN) in ethanol was dripped onto the gold surface, and the reaction proceeded for more than 7 h. After washes with ethanol and distilled water, the aminoalkyl-modified surface was reacted for 2 h with 200 ␮L of

The l-DNA-immobilized gold chip was placed in the SPR imaging instrument (SPR-101, TOYOBO, Japan). After surface was washed with 10 mM NaOH for 2 min, running buffer (phosphate buffer, 10 mM phosphate [pH 7.2] and 150 mM NaCl) was applied to the array for 5 min. Before measurement, the two allele-specific LT-PCR products (L1-MDR1-MU and L2-MDR1-WT) were mixed and then applied to the l-DNA SPR array. During the SPR imaging analysis, running buffer was applied to the array for the first 100 s, and the array was exposed to the LT-PCR products for the next 10 min, with a flow speed of 100 ␮L/min. The array surface was washed with the running buffer for 5 min before we obtained the images. All SPR experiments were performed at 30 ◦ C. The SPR array was reused after washes with 0.5 M NaOH for 3 min. The SPR images and signal data were collected with the MultiSPRinter Analysis program (TOYOBO). The SPR difference images were constructed by using Scion Image (Scion, MD, USA). 3. Results and discussion First, we confirmed that the l-DNA tag attached to the 5 end of the LT-primer had no apparent effect on the allele specificity

Table 1 Oligodeoxynucleotides used in allele-specific LT-PCR and SPR measurements

Allele-specific Forward primer Reverse primer Oligonucleotide immobilized on SPR gold surface a

Names

Sequencesa

L1-MDR1-MU L2-MDR1-WT MDR1-RV L1C L2C

5 -L (ATGCTACCGTATGCCCAGTGTTT)-AGTTTGACTCACCTTCCCTGA-3 5 -L (GACAACGGAGACAGAGCCAATTT)-AGTTTGACTCACCTTCCCTGC-3 5 -GCTATAGGTTCCAGGCTTGCT-3 5 -L CACTGGGCATACGGTAGCAT-SH-3 5 -L TTGGCTCTGTCTCCGTTGTC-SH-3

The boldface letters show the SNP site and the underlined letters are deliberate mismatches for increasing allele specificity. The parentheses indicate the l-DNA tags.

G. Hayashi et al. / Journal of Biotechnology 135 (2008) 157–160

of primer elongation by Taq DNA polymerase. The allele-specific L1-MDR1-MU and L2-MDR1-WT primers (Table 1) were designed by adding L1 and L2 sequence tags to the 5 end of the reported primers for mutant and wild type alleles, respectively (Song et al., 2002). The 3 terminal nucleotide (A or C) of each LT-primer corresponds to the SNP site, whereas the third nucleotide (T) from the 3 terminus generates an internal primer/template mismatch to prevent amplification of the mismatched primer. In order to increase allele specificity of primers, it is general to insert a deliberate mismatch (Ishiguro et al., 2005). Allele-specific LT-PCR was carried out toward G/G-homozygous, G/T-heterozygous, and T/T-homozygous templates separately with the L1-MDR1-MU and L2-MDR1-WT primers. The PAGE analysis showed proper allele specificity (Fig. 2), in good agreement with the results of normal AS-PCR without the l-DNA tag (data not shown). These data indicate that the l-DNA tag does not decrease allele specificity during the AS-PCR reaction. The combination of LT-PCR and an SPR sensor with immobilized l-DNA enabled us to detect the PCR products directly without any separation, purification, or denaturing-annealing processes (Hayashi et al., 2007). The products of the allele-specific LT-PCR with each of the two LT-primers were mixed together without any purification and analyzed on the SPR imaging array where L1C and L2C were each immobilized at defined addresses (Fig. 3a). SPR diagrams of the time-course of the SPR signal change clearly showed an increase of the signal intensity selectively at the L1C or L2C spots depending on the genetic type of the template used for the LT-PCR (Fig. 3b). SPR difference images obtained by subtracting the raw data at 0 s from that at 1000 s after hybridization with LT-PCR prod-

159

Fig. 2. Native PAGE analysis of allele-specific LT-PCR products. Lane 1, DNA marker; lanes 2, 4, 6, and 8, L2-MDR1-WT primer (W); lanes 3, 5, 7, and 9, L1-MDR1-MU primer (M); lanes 2 and 3, G/G-homozygote template; lanes 4 and 5, G/Theterozygote template; lanes 6 and 7, T/T-homozygote template; and lanes 8 and 9, no template. The gel was stained with ethidium bromide.

ucts showed three distinct patterns (Fig. 3c): weak L1C and strong L2C for the G/G-homozygote, strong L1C and L2C for the G/T heterozygote, and strong L1C and weak L2C for the T/T-homozygote. The weak signals at L1C spots in G/G-homozygote and at L2C spots for the T/T-homozygote may be due to the presence of unconsumed

Fig. 3. SNP typing on an SPR surface array with immobilized l-DNA using allele-specific LT-PCR. Amplification reactions were performed for G/G-homozygous, G/Theterozygous, and T/T-homozygous templates. (a) The immobilization pattern of L1C (open circles) and L2C (filled circles) on the SPR imaging array. (b) The time profile of the SPR signal and (c) SPR difference images showing the SNP type of MDR1 gene G2677T. The SPR signal changes were monitored over the following periods: exposure to phosphate buffer (0–100 s), the PCR products (100–700 s), and again to the buffer (700–1000 s). The SPR changes were detected at the addresses of L1C (dashed), L2C (thick), and background (thin).

160

G. Hayashi et al. / Journal of Biotechnology 135 (2008) 157–160

L1-MDR1-MT or L2-MDR1-WT. Subtraction of these background signals would be desirable if an all-or-nothing presentation of the results were necessary in practical applications of SNP typing. The genotyping patterns determined with the l-DNA-immobilized SPR array were fully consistent with those determined by the PAGE analysis. This report demonstrates that l-DNA technology integrated with allele-specific PCR provides an innovative method of SNP typing. The important features of the l-DNA tag are that (1) a large number of sequence tags are available and (2) the tag remains in a single-stranded form even after the PCR reaction. By immobilizing l-DNAs complementary to the tags on a DNA micorarray, the LT-PCR products can be directly delivered to the designated addresses on the microarray without any purification. Although primers for single base extension (SBE) with a generic-sequence d-DNA tag have been reported (Fan et al., 2000; Hirschhorn et al., 2000), the d-DNA sequence is not suitable for our method because the sequence tag will not be present in a single-stranded form in the PCR products. A single base extension method using LT primer has been reported (Hauser et al., 2006). While the SBE method needs 4 kinds of fluorescent-dye-conjugated dideoxynucleotide-triphosphate that are expensive compounds, our method requires just general dNTPs during the reaction. Additionally, the amount of DNA template used in AS-LT-PCR is much less than that in SBE method because our method is amplification reaction. We believe that the unique character of l-DNA, when used in combination with other biological technologies, brings a technical advance to broad biological area. References Chen, C., Chin, J.E., Ueda, K., Clark, D.P., Pastan, I., Gottesman, M.M., Roninson, I.B., 1986. Internal duplication and homology with bacterial transport proteins in the MDR1 (P-glycoprotein) gene from multidrug-resistant human cells. Cell 47, 381–389. Fan, J., Chen, X., Halushka, M.K., Berno, A., Huang, X., Ryder, T., Lipshutz, R.J., Lockhart, D.J., Chakravarti, A., 2000. Parallel genotyping of human SNPs using generic highdensity oligonucleotide tag arrays. Genome Res. 10, 853–860. Fujimori, S., Shudo, K., Hashimoto, Y., 1990. Enantio-DNA recognizes complementary RNA but not complementary DNA. J. Am. Chem. Soc. 112, 7436–7438. Garbesi, A., Capobianco, B.L., Colonna, F.P., Tondelli, L., Arcamone, F., Manzini, G., Hilbers, C.W., Aelen, J.M.E., Blommers, M.J.J., 1993. l-DNA as potential antimesseger oligonucleotides: a reassessment. Nucleic Acid Res. 21, 4159–4165. Hauser, N.C., Martinez, R., Jacob, A., Rupp, S., Hoheisel, J.D., Matysiak, S., 2006. Utilising the left-helical conformation of l-DNA for analyzing different marker types on a single universal microarray platform. Nucleic Acid Res. 34, 5101–5111. Hayashi, G., Hagihara, M., Kobori, A., Nakatani, K., 2007. Detection of l-DNA-tagged PCR products by surface plasmon resonance imaging. ChemBioChem 8, 169–171.

Hirschhorn, J.N., Sklar, P., Lindblad-Toh, K., Lim, Y., Ruiz-Gutierrez, M., Bolk, S., Langhorst, B., Schaffner, S., Winchester, E., Lander, E.S., 2000. SBE-TAGS: an arraybased method for efficient single-nucleotide polymorphism genotyping. Proc. Natl. Acad. Sci. U.S.A. 97, 12164–12169. Ishiguro, A., Kubota, T., Soya, Y., Sasaki, H., Yagyu, O., Takarada, Y., Iga, T., 2005. Highthroughput detection of multiple genetic polymorphisms drug metabolism with mismatch primers in allele-specific polymerase chain reaction. Anal. Biochem. 337, 256–261. Kwok, P.Y., 2001. Methods for genotyping single nucleotide polymorphisms. Annu. Rev. Genomics Hum. Genet. 2, 235–258. Kyo, M., Yamamoto, T., Motohashi, H., Kamiya, T., Kuroita, T., Tanaka, T., Engel, J.D., Kawakai, B., Yamamoto, M., 2004. Evaluation of MafG interaction with Maf recognition element arrays by surface plasmon resonance imaging technique. Genes Cells. 9, 153–164. McCarthy, J.J., Hilfiker, R., 2000. The use of single-nucleotidepolymorphism maps in pharmacogenomics. Nat. Biotechnol. 18, 505–508. Morita, N., Yasumori, T., Nakayama, K., 2003. Human MDR1 polymorphism: G2677T/A and C3435T have no effect on MDR1 transport activities. Biochem. Pharmacol. 65, 1843–1852. Myakishev, M.V., Khripin, Y., Hu, S., Hamer, D.H., 2001. High-throughput SNP genotyping by allele-specific PCR with universal energy-transfer-labeled primers. Genome Res. 11, 163–169. Nakatani, K., 2004. Chemistry challenges in SNP typing. ChemBioChem 5, 1623–1633. Newton, C.R., Graham, A., Heptinstall, L.E., Powel, S.J., Summers, C., Kalsheker, N., Smith, J.C., Markham, A.F., 1989. Analysis of any point mutaion in DNA. The amplification refractory mutation system (ARNS). Nucleic Acid Res. 17, 2503–2516. Okayama, H., Curiel, D.T., Brantly, M.L., Holmes, M.D., Crystal, R.G., 1989. Rapid, nonradioactive detection of mutations in the human genome by allele specific amplification. J. Lab. Clin. Med. 114, 105–113. Rudinger, N.Z., Kranaster, R., Marx, A., 2007. Hydrophobic amino acid and singleatom substitutions increase DNA polymerase selectivity. Chem. Biol. 14, 185–194. Song, P., Li, S., Meibohm, B., Gaber, A.O., Honaker, M.R., Kotb, M., Yates, C.R., 2002. Detection of MDR1 single nucleotide polymorphisms C3435T and G2677T using realttime polymerase chain reaction: MDR1 single nucleotide polymorphism genotyping assay. AAPS Pharmsci. 4 (article 29). Strerath, M., Marx, A., 2005. Genotyping-from genomic DNA to genotype in a single tube. Angew. Chem. Int. Ed. 44, 7842–7849. Strerath, M., Gloeckner, C., Liu, D., Schnur, A., Marx, A., 2007. Directed DNA polymerase evolution: effects of mutations in motif C on the mismatch-extension selectivity of thermus aquaticus DNA polymerase. ChemBioChem 8, 395– 401. Summerer, D., Rudinger, N.Z., Detmer, I., Marx, A., 2005. Enhanced fidelity in mismatch extension by DNA polymerase through directed combinatorial enzyme design. Angew. Chem. Int. Ed. 44, 4712–4715. Syvanen, A.C., 2001. Accessing genetic variation: genotyping single nucleotide polymorphisms. Nat. Rev. Genet. 2, 930–942. Urata, H., Shinohara, K., Ogura, E., Ueda, Y., Akagi, M., 1991. Mirror-image DNA. J. Am. Chem. Soc. 113, 8174–8175. Urata, H., Ogura, E., Shionoya, K., Ueda, Y., Akagi, M., 1992. Synthesis and properties of mirror-image DNA. Nucleic Acid Res. 20, 3325–3332. Williams, K.P., Liu, X., Schumacher, T.N.M., Lin, H.Y., Ausiello, D.A., Kim, D.P., Bartel, P., 1997. Bioactive and nuclease-resistant l-DNA ligand of vasopressin. Proc. Natl. Acad. Sci. U.S.A. 94, 11285–11290.