Glatiramer Acetate administration does not reduce damage after cerebral ischemia in mice

Journal of Neuroimmunology 254 (2013) 55–62

Contents lists available at SciVerse ScienceDirect

Journal of Neuroimmunology journal homepage: www.elsevier.com/locate/jneuroim

Glatiramer Acetate administration does not reduce damage after cerebral ischemia in mice Marine Poittevin a, Nicolas Deroide a, b, Feriel Azibani c, Claude Delcayre c, Claire Giannesini e, Bernard I. Levy a, b, d, Marc Pocard a, b, Nathalie Kubis a, b,⁎ a

Université Paris Diderot, Sorbonne Paris Cité, Angiogenesis and Translational Research Center, INSERM U965, F-75475 Paris, France AP-HP, Hôpital Lariboisière, F-75475 Paris, France INSERM U942, Biomarqueurs et Insuffisance cardiaque, Hôpital Lariboisière, F-75475 Paris, France d Institut Vaisseaux Sang, Hôpital Lariboisière, F-75475 Paris, France e AP-HP, Hôpital Tenon, F-75020 Paris, France b c

a r t i c l e

i n f o

Article history: Received 9 May 2012 Received in revised form 23 August 2012 Accepted 7 September 2012 Keywords: Cerebral ischemia Stroke Copaxone® Glatiramer acetate Inflammation Neurogenesis

a b s t r a c t Inflammation plays a key role in ischemic stroke pathophysiology: microglial/macrophage cells and type-1 helper cells (Th1) seem deleterious, while type-2 helper cells (Th2) and regulatory T cells (Treg) seem protective. CD4 Th0 differentiation is modulated by microglial cytokine secretion. Glatiramer Acetate (GA) is an immunomodulatory drug that has been approved for the treatment of human multiple sclerosis by means of a number of mechanisms: reduced microglial activation and pro-inflammatory cytokine production, Th0 differentiation shifting from Th2 to Th2 and Treg with anti-inflammatory cytokine production and increased neurogenesis. We induced permanent (pMCAo) or transient middle cerebral artery occlusion (tMCAo) and GA (2 mg) or vehicle was injected subcutaneously immediately after cerebral ischemia. Mice were sacrificed at D3 to measure neurological deficit, infarct volume, microglial cell density and qPCR of TNFα and IL-1β (pro-inflammatory microglial cytokines), IFNγ (Th2 cytokine), IL-4 (Th2 cytokine), TGFβ and IL-10 (Treg cytokines), and at D7 to evaluate neurological deficit, infarct volume and neurogenesis assessment. We showed that in GA-treated pMCAo mice, infarct volume, microglial cell density and cytokine secretion were not significantly modified at D3, while neurogenesis was enhanced at D7 without significant infarct volume reduction. In GA-treated tMCAo mice, microglial pro-inflammatory cytokines IL-1β and TNFα were significantly decreased without modification of microglial/macrophage cell density, cytokine secretion, neurological deficit or infarct volume at D3, or modification of neurological deficit, neurogenesis or infarct volume at D7. In conclusion, Glatiramer Acetate administered after cerebral ischemia does not reduce infarct volume or improve neurological deficit in mice despite a significant increase in neurogenesis in pMCAo and a microglial pro-inflammatory cytokine reduction in tMCAo. © 2012 Elsevier B.V. All rights reserved.

1. Introduction Stroke is the leading cause of permanent disability in adults. Despite the availability of prophylactic strategies and physical therapy for stroke survivors, therapeutic options in the acute phase are still limited to a Abbreviations: CCA, common carotid artery; ECA, external carotid artery; ICA, internal carotid artery; MCA, middle cerebral artery; MCAo, MCA occlusion; pMCAo, permanent MCAo; tMCAo, transient MCAo; D, day; SVZ, subventricular zone; Treg, T regulatory cells; Th2 /Th2, T‐helper lymphocyte subpopulation; EAE, experimental allergic encephalomyelitis; CNS, central nervous system; MS, multiple sclerosis. ⁎ Corresponding author at: Service de Physiologie Clinique-Explorations Fonctionnelles and UI 965, Hôpital Lariboisière, 2 rue Ambroise Paré, 75010 Paris, France. Tel.: +33 1 49 95 83 14; fax: +33 1 49 95 86 71. E-mail address: [email protected] (N. Kubis). 0165-5728/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jneuroim.2012.09.009

restricted number of patients. Post-stroke inflammatory response contributes to the exacerbation of brain injury. Innate immune cells, microglia and macrophages are recruited immediately after ischemia, and contribute to post-ischemic inflammation by producing tumor necrosis factor α (TNFα) and interleukin 1β (IL-1β). They are followed by adaptive immune cells, B cells and Th0 (naive CD4+ helper) lymphocytes, which peak at D3 (Gelderblom et al., 2009). Depending on the cytokine environment, CD4 Th0 can differentiate into Th1, Th2 or Treg lymphocytes. The Th1 immune response is characterized by pro-inflammatory cytokine secretion including interferon γ (IFNγ), which promotes the cellular immune response and may play a deleterious role in the pathogenesis of stroke (Yilmaz et al., 2006). The Th1 response enhances microglia/macrophage activation, and subsequently, secretion of TNFα and IL-1β. By contrast, Th2 and Treg immune

56

M. Poittevin et al. / Journal of Neuroimmunology 254 (2013) 55–62

responses are characterized by anti-inflammatory cytokine secretion, including IL-4, IL-10 and transforming growth factor β (TGFβ), which modulate the innate immune response and play a protective role (Liesz et al., 2009). After cerebral ischemia, there is an early enhancement of spontaneous neurogenesis from progenitor cells in the subventricular zone (SVZ) lining the lateral ventricles. This neurogenesis is blocked by TNFα, IL-1β and IFNγ, or enhanced by anti-inflammatory IL-4 and TGFβ cytokines (Butovsky et al., 2006a; Ekdahl et al., 2009; Minmin et al., 2008). Modulation of the inflammatory response could therefore be a strategy to increase neurogenesis and limit cerebral ischemic damage. Glatiramer Acetate (GA) (Copaxone®), a synthetic amino acid containing four amino acids (alanine, lysine, glutamic acid and tyrosine) is an immunomodulator that suppresses experimental allergic encephalomyelitis (EAE), the experimental model of multiple sclerosis (MS). MS is an inflammatory autoimmune disease of the central nervous system (CNS), characterized by a strong inflammatory Th1 response (Aharoni et al., 1997). The immunomodulatory effect of GA has been attributed to its ability to i) reduce monocyte reactivity in vitro and in vivo and subsequent TNFα production (Weber et al., 2004), ii) inhibit Th1 pro-inflammatory cytokine IFNγ (Jee et al., 2006), iii) induce Th2 and Treg cell activation; these cells cross the blood–brain barrier and express anti-inflammatory cytokines Il-4, IL-10 and TGFβ in situ (Aharoni et al., 2000) and iv) enhance brain-derived neurotrophic factor (BDNF) production and neurogenesis (Aharoni et al., 2005a,b). To our knowledge, the effects of GA in cerebral ischemia have only been studied once in a transient middle cerebral artery occlusion rat model (Ibarra et al., 2007). The authors showed neurological recovery and infarct volume reduction at day 7 but they did not study any mechanisms of action. The aim of the present study was to evaluate the effects of GA in two models of focal cerebral ischemia in mice, permanent MCAo (pMCAo) and transient MCAo (tMCAo), at two time points, day 3 (D3) and day 7 (D7). We evaluated infarct volume and neurological deficit, and correlation with the innate immune response, mainly pro-inflammatory microglia/macrophage responses, the adaptive immune Th1, Th2 and Treg response and neurogenesis. 2. Materials and methods All animal experiments were performed according to the National Institute of Health guidelines for the care and use of laboratory animals (permit no. B 75-10-03). Our local ethics committee (LariboisiereVillemin Ethics Committee for Animal Experimentation number 09)

specifically approved this study (#CEEALV/2011-01-03). Mice were housed under specific pathogen-free conditions in a 12 h light/dark cycle and had free access to food and water. 2.1. Animals Male C57BL/6 J mice (Janvier, France) aged 10 to 12 weeks with a mean body weight of 25–30 g were used. 2.2. Distribution of groups The investigators in all the experiments were blinded to the treatment of each animal (n= 6–11/group). Mice were divided into 2 experimental groups receiving one subcutaneous vehicle (saline solution) or Glatiramer Acetate (GA) injection immediately after permanent focal cerebral ischemia (pMCAo) or after reperfusion in the transient middle cerebral artery occlusion (tMCAo) model. In both models, infarct volume was assessed at D3 and D7, microglial/macrophage cerebral infiltration and their pro-inflammatory cytokine profile, and Th1, Th2 and Treg cytokine profiles were assessed at D3, and cell proliferation and neurogenesis were assessed at D7. In addition, neurological deficit was assessed in the tMCAo model at D3 and D7. The experimental schedule is shown in Fig. 1. 2.3. Permanent focal cerebral ischemia occlusion (pMCAo) Mice were anesthetized using isoflurane (initially 2%, followed by 1.5 to 1.8% in O2). Body temperature was monitored during both procedures by a rectal probe and normothermia was maintained (37 ± 0.5 °C) by a heating blanket (Homeothermic Blanket Control Unit; Harvard Apparatus Limited, UK). Under low-power magnification, the left temporal–parietal region of the head was shaved and a 1-cm incision was made between the orbit and the ear. A second incision was made on the temporal muscle, and the lateral aspect of the skull was exposed after reflecting the muscle forward. The middle cerebral artery (MCA) could then be seen through the semi translucent skull. A small burr hole (1–2 mm) was drilled into the outer surface of the skull just above the MCA (Technobox 810, Bien Air Dental SA, Bienne, Switzerland). Dura mater was removed with fine forceps. The left MCA was then occluded (MCAo) by electrocoagulation with a bipolar forceps. After surgery, the wound was sutured and mice were returned to their cage and placed under a heating lamp until recovery from anesthesia. None of the animals showed a significant

pMCAo Treatment: Day 0 GA (n=8) vehicle (n=7) pMCAo + treatment Day 0 Treatment: GA (n=9) vehicle (n=11) pMCAo + treatment

Day 3 Infarct volume Microglial cell infiltration

Day 7 Infarct volume Cell proliferation Neurogenesis

Day 3 Th1, Th2 and Treg cytokines Microglial pro-inflammatory cytokines

tMCAo Day 0 Treatment: GA (n=7) vehicle (n=6) tMCAo + treatment Treatment: Day 0 GA (n=6) vehicle (n=6) tMCAo + treatment

Day 3 Infarct volume Neurological assessment Microglial cell infiltration Day 3

Day 7 Infarct volume Neurological assessment Cell proliferation Neurogenesis

Th1, Th2 and Treg cytokines Microglial pro-inflammatory cytokines

Fig. 1. Experimental protocol and time schedule. GA: Glatiramer Acetate; vehicle: saline solution.

M. Poittevin et al. / Journal of Neuroimmunology 254 (2013) 55–62

neurological deficit at any time during the experimental protocol. The overall mortality in the coagulation model was less than 5% over an observation period of 7 days. The day of pMCAo was considered as day 0. 2.4. Transient middle cerebral artery occlusion (tMCAo) Focal cerebral ischemia was induced by 45 min occlusion and reperfusion of the left MCA under the anesthesia protocol previously described, using the intraluminal filament technique. Throughout surgery, body temperature was monitored by a rectal probe and normothermia was maintained (37 ± 0.5 °C) by a heating blanket (Homeothermic Blanket Control Unit; Harvard Apparatus Limited, UK). The left common carotid artery (CCA) and the external carotid artery (ECA) were isolated by performing a midline cervical skin incision under a microscope. Unilateral MCA occlusion was performed by inserting a nylon monofilament (Sensas, Feeling Competition, France) (diameter 80 μm) with heat-blunted tip (diameter 190 μm) coated with “thermo-melting” glue (Jet Melt, Radiospares, Beauvais, France), introduced through an arteriotomy performed in the left external carotid artery. The monofilament was advanced forward into the internal carotid artery (ICA) up to the origin of the MCA. Occlusion was confirmed by laser Doppler flowmetry (Moor Instruments Ltd, Millwey, England) with a probe positioned over the ipsilateral hemisphere at the mid ear-to-eye distance, for 5 min after insertion of the monofilament. Forty-five minutes after MCAo, the occluding filament was pulled back to allow reperfusion. The wound was sutured and mice were returned to their cage with free access to food and water after 2 h in an incubator (29 °C). Systematic subcutaneous sodium chloride administration was performed twice a day for the first 48 h to avoid dehydration. All animals showed a significant neurological deficit immediately after the transient MCAo. The day of tMCAo was considered as day 0. 2.5. Assessment of neurological deficit Each experiment was conducted randomly and blindly. Permanent MCAo generated an isolated cortical infarct with no associated neurological deficit. Transient MCAo generated a cortical and striatal infarct associated with a neurological deficit. Neurological evaluation was therefore performed at day 3 and day 7 after tMCAo, using 6 neurological tests: exit circle test, neurological score, grip and string test, beam walking and pole test, and an overall neurological score was given (/38) (Haddad et al., 2008). The lower the neurological score, the more severe the deficit. 2.6. Treatment Mice were randomly assigned into two groups receiving 200 μl of saline solution (vehicle) or Glatiramer Acetate (GA) (Copaxone®) (Sanofi, Paris, France), 2 mg in 200 μl saline solution. Treatments were injected subcutaneously into the neck immediately after cerebral ischemia in the pMCAo group and immediately after reperfusion in the tMCAo group.

57

Carl Zeiss International, Germany) and Cartograph software (v6.3.1, Microvision Instruments, France). The total infarct volume (mm 3) was determined by integrating measured areas and distances between sections using NIH Image J (v 1.33, National Institute of Health, USA) analysis software. Measured infarct volume was corrected for edema with the following formula: corrected infarct volume = measured infarct volume × (contralateral hemisphere volume / ipsilateral hemisphere volume). 2.8. Real-time PCR analysis Mice were deeply anesthetized with an overdose of isoflurane, and then decapitated. Brains were removed and the hemisphere ipsilateral to the ischemia was used for further analysis. RNAs were isolated with the RNEasy lipid mini kit (Qiagen, Courtaboeuf, France) and standard procedures. Reverse transcription was performed with Ready To Go RT Beads (GE Healthcare) and real-time PCR with MesaGreen (Eurogentec, Angers, France) on a Mastercycler Realplex2 from Eppendorf. We designed primers for each gene: TNFα (sense: TGGCCTCCCTCTCATCAGTTC; antisense: TTGGTGGTTTGCTACGACGTG), IL-1β (sense: ACCTTCCAGGATG AGGACATGA, antisense: AACGTCACACACCAGCAGGTTA), IFNγ (sense: GCTTTGCAGCTCTTCCTCAT, antisense: GTCACCATCCTTTTGCCAGT), IL-10 (sense: CCAAGCCTTATCGGAAATGA, antisense: TTTTCACAGGGGAGAAAT CG), TGFβ (sense: TTGCTTCAGCTCCACAGAGA, antisense: TGGTTGTAG AGGGCAAGGAC), IL-4 (sense: TCAACCCCCAGCTAGTTGTC, antisense: TG TTCTTCGTTGCTGTGAGG) and peptidylprolyl isomerase A (cyclophilin A) (ready-to-use primer, Qiagen, France). We ran all assays in triplicate. We normalized the results for each individual gene to the level of the housekeeping gene encoding cyclophilin A. 2.9. Proliferation assessment Mice were given the DNA synthesis marker 5-bromo-2′-deoxyuridine (BrdU, Sigma, USA) (100 mg/kg in 0.9% NaCl) intraperitoneally, at 4 h and 2 h before sacrifice. The distribution of the marker was determined by immunohistochemistry as described below. 2.10. Immunohistochemistry Coronal 30 μm-thick floating sections were incubated with primary antibody overnight at 4 °C: anti-BrdU (AbCys, Paris, France, 1:100), anti-microglial-specific ionized calcium binding adaptor molecule 1 (Iba1, Wako Pure Chemical Industries, Neuss, Germany, 1:250) and anti-Doublecortin (Dcx, Santa-Cruz, USA, 1:100) were used to detect proliferating cells, microglial/macrophage cells and immature neurons respectively. Appropriate fluorescent-labeled secondary Alexa Fluor 594 or 488 antibodies (Molecular Probes, Oregon, USA, 1:400) were applied for 1 h at room temperature. Specificity was checked by omitting the primary antibody. The phenotype of BrdU-labeled cells was determined using double immunofluorescence staining and for BrdU immunofluorescence (assessment of cell proliferation), brain sections were pretreated with 2 N HCl and rinsed in boric acid, pH= 8.5 (Sigma, USA) before being stained with specific antibodies. 2.11. Morphoanalysis

2.7. Assessment of infarct volume On the day of sacrifice, mice were deeply anesthetized with an intravenous overdose of intraperitoneal pentobarbital (100 mg/kg) and transcardially perfused with heparinized saline, followed by 4% paraformaldehyde (PFA) in 0.1 M phosphate buffer. Brains were removed, post-fixed overnight in PFA and cryoprotected in 20% sucrose. Coronal 30 μm-thick floating sections were cut using a cryomicrotome (CM3050S, Leica, Germany). Every 8th coronal section was mounted on a glass slide, dried and stained with cresyl violet. Sections were then digitized using a Zeiss microscope (Imager Z1 with Apotom,

All counts were conducted blindly and performed on 3 coronal brain levels at +0.80 mm, −0.80 mm and −1.20 mm relative to bregma, which consistently contained the infarct area in pMCAo and tMCAo, either in a region of interest (ROI) (microglial/macrophage cell infiltration) or in the whole section (proliferating cells and neuroblasts). Microglial/macrophage (Iba1+) cells were counted in 3 randomly chosen ROI (0.15 mm 2) in the peri-infarct area where they were the most densely expressed, to assess microglia/macrophage activity. Images were captured with a Zeiss Apotom (Z1 imager with Apotom, Carl Zeiss International, Germany) and AxioVision (20 ×, v4.6.3.0, Carl

58

M. Poittevin et al. / Journal of Neuroimmunology 254 (2013) 55–62

Zeiss International, Germany) and were analyzed using the NIH Image J 1.38 program (National Institute of Health, Bethesda, Maryland, USA). Cells were expressed by the average number of Iba-1+ cells/ROI. Cell proliferation count was measured in the whole ipsilateral hemisphere and in the subventricular zone in particular, and expressed by the average number of BrdU + cells/section. Neurogenesis count was measured in the whole ipsilateral hemisphere and in the subventricular zone in particular, and expressed as the percentage of BrdU+/Dcx+ cells/section.

3.3. Effect of GA on innate immune cells: the microglial/macrophage inflammatory response

2.12. Statistics Statistical analyses were performed with Prism 5 software (Prism 5.03, GraphPad, San Diego, USA). Data were expressed as means ± standard deviation (SD). The comparison of the GA- and vehicle-treated groups was analyzed using the non-parametric Mann–Whitney test at each time point and for each ischemic model. A value of p b 0.05 was considered statistically significant. 3. Results 3.1. Mortality and group homogeneity No animals died during the induction of pMCAo or showed a significant neurological deficit at any time during the experimental protocol. Thirty percent of animals died during the induction of tMCAo or between D0 and D7. All animals showed a significant neurological deficit immediately after tMCAo, according to the tests described below. Body weight (21.5 g ± 2.0 g versus 21.0 g ± 1.0 g) and temperature (36.9 °C ± 0.3 °C versus 37.0 °C ± 0.4 °C) were similar in vehicle- and GA-treated mice. 3.2. Effect of GA on infarct volume and neurological deficit At D3, there was no significant difference in infarct volume between the vehicle and GA groups after pMCAo (21.9 ± 4.2 mm3 versus 22.0± 5.6 mm3) and after tMCAo (46.3 ±21.8 mm3 versus 50.7 ± 10.3 mm3) (Fig. 2A,B). In both models, there was about 10% swelling in the two groups at D3. At D7, infarct volume was still not significantly different after pMCAo (13.8± 4.2 mm3 versus 13.3 ± 4.3 mm3) or after tMCAo

3.4. Effect of GA on adaptive immune cells: Th1, Th2 and Treg responses We assessed IFNγ (main Th1 cytokine), IL-4 (main Th2 cytokine), IL-10 and TGFβ (main Treg cytokines) RNA levels by RT-PCR. At D3, there was no significant difference between the vehicle and GA groups in pMCAo for the Th1 cytokine: IFNγ (2.0 ± 0.6 AU versus 2.0 ± 0.5 AU), Th2 cytokine: IL-4 (0.6 ± 0.2 AU versus 0.6 ± 0.2 AU) or Treg cytokines: IL-10 (0.9 ± 0.4 AU versus 1.0 ± 0.3 AU) and TGFβ (0.2 ± 0.07 AU versus 0.2 ± 0.07 AU) (Fig. 4A). We also found no significant difference in the tMCAo model for Th1 cytokines: IFNγ (1.4 ± 0.4 AU versus 1.2 ± 0.4 AU), Th2 cytokines: IL-4 (1.8 ± 1.1 AU versus 1.0 ± 0.3 AU) or Treg cytokines: IL-10 (vehicle 7.2 ± 2.4 AU versus 6.1 ± 2.9 AU) and TGFβ (0.9 ± 0.4 AU versus 1.0 ± 0.3 AU) (Fig. 4B).

B

pMCAo

tMCAo

500 µm

500 µm

Mean neurological score (/38)

Day 3

Day 3 Infarct volume (mm³)

Microglial/macrophage inflammatory response was assessed at D3 after pMCAo and tMCAo, by Iba-1 positive cell density and IL-1β and TNFα mRNA cytokine expression by RT-PCR. In pMCAo, there was no significant difference between the vehicle and GA groups in terms of microglial/macrophage cell density (92 ± 12 cells/ROI versus 84 ± 14 cells/ROI), IL-1β (0.2± 0.05 AU (arbitrary units) versus 0.2 ± 0.07 AU) and TNFα levels (0.8 ± 0.2 AU versus 0.9 ±0.3 AU) (Fig. 3A). By contrast, in tMCAo, there was a significant decrease in pro-inflammatory cytokines IL-1β (1.5 ± 0.7 AU versus 0.7 ± 0.2 AU, p b 0.05) and TNFα (1.5 ± 0.7 AU versus 0.6 ± 0.2 AU; p b 0.01) in the vehicle group compared to the GA group, respectively, with no significant change in microglial/macrophage cell density (82 ± 21 cells/ROI versus 87± 17 cells/ROI) (Fig. 3B).

Infarct volume (mm³)

A

vehicle GA

vehicle GA

vehicle GA

vehicle GA

500 µm

Infarct volume (mm³)

500 µm

Mean neurological score (/38)

Day 7

Day 7 Infarcct volume (mm³)

(37.8 ± 7.5 mm3 versus 32.3± 15.2 mm3) (Fig. 2A,B). PMCAo generated a cortical infarct only, with no neurological deficit in contrast to transient MCAo, which generated a cortical and striatal infarct and induced a neurological deficit. The lowest overall neurological score (/38) corresponds to the most severe deficit. There was no significant difference between the vehicle and GA groups in terms of overall neurological score at D3 (17 ± 10 versus 19±5) or at D7 (20 ± 4 versus 19± 6) (Fig. 2B).

vehicle GA vehicle GA

Fig. 2. Effect of GA on infarct volumes and behavioral deficit. Infarct volumes (mm3) at D3 and D7 after treatment by vehicle or GA following pMCAo (A) and tMCAo (B) with representative cresyl violet stained coronal sections used to analyze infarct size and neurological deficit. Overall neurological score (/38) is the sum of 6 neurological tests (exit circle test, neurological score, grip and string test, beam walking and pole test). The lower the neurological score, the more severe the deficit. Data are expressed as mean volume measurement ± SD.

M. Poittevin et al. / Journal of Neuroimmunology 254 (2013) 55–62

A

B

pMCAo p

59

tMCAo

Day 3

Iba1 cell density / ROI

Iba1 cell density / ROI

Day 3

vehicle GA

GA

Pro-inflammatory cytokines

Pro-in i flammatory cytokines ki

*

TNFα mRNA RE E

TNFα mRNA RE T

IL-1β mRNA RE

** IL-1β mRNA m RE E

vehicle

vehicle GA

vehicle GA

vehicle GA

vehicle GA

Fig. 3. Effect on GA of microglial/macrophage inflammatory response. Microglial/macrophage (Iba1+) cell density and pro-inflammatory cytokine TNFα and IL-1β mRNA levels at D3 after treatment by vehicle or GA following pMCAo (A) and tMCAo (B) with immunohistochemical section showing Iba1+ staining. ROI (regions of interest) are represented by 3 small boxes on the photographs. Data are expressed as mean ± SD, *p b 0.05; **p b 0.01.

3.5. Effect of GA on cell proliferation and neurogenesis We injected BrdU (thymidine analog incorporated into DNA of dividing cells) to label proliferative cells, and Dcx to label immature neurons. At D7, in the pMCAo mice, the number of proliferative cells per section was not significantly different between GA- and vehicle-treated mice, while there was a significant increase in neurogenesis (double labeled BrdU+/Dcx+ cells) in the ipsilateral subventricular zone and in the corpus callosum where cells were migrating towards the infarct in the GA-treated mice (+40±16%, pb 0.05) (Fig. 5A). At D7, in the tMCAo

We evaluated the effects of Glatiramer Acetate (GA) at D3 and D7, in two murine models of focal cerebral ischemia: permanent and

B

pMCAo

IL-4 mRNA RE vehicle

GA

tMCAo

Day 3 Th1 cytokines IFNγ mRNA RE

Th2 cytokines

IFNγ mRNA RE vehicle

4. Discussion

vehicle

GA

GA

vehicle

GA

TGFβ mRNA RE

IL-10 mRNA RE

TGFβ mRNA RE

IL-10 mRNA RE

GA

vehicle

GA

Treg cytokines

Treg cytokines

vehicle

Th2 cytokines IL-4 mRNA RE

A

Day 3 Th1 cytokines

mice, there was no significant difference in the number of proliferative cells per section or in neurogenesis per section between the two groups (Fig. 5B). In the hemisphere contralateral to ischemia, there was limited neurogenesis along the lateral ventricle but we observed no cell migration along the corpus callosum (data not shown).

vehicle

GA

vehicle

GA

Fig. 4. Effect of GA on Th1, Th2 and Treg responses. IFNγ (main Th1 cytokine), IL-4 (main Th2 cytokine), IL-10 and TGFβ (main Treg cytokines) mRNA levels by RT-PCR at D3 after treatment by vehicle or GA following pMCAo (A) or tMCAo (B). Data are expressed as mean mRNA cytokine ± SD, RE: relative expression.

M. Poittevin et al. / Journal of Neuroimmunology 254 (2013) 55–62

A

B

pMCAo

Day 7 *

BrdU+ cells (%)

BrdU+/Dcx+ cells (%)

BrdU+ cells (%)

vehicle

vehicle

GA

BrdU staining

Dcx staining

tMCAo

Day 7

BrdU+/Dcx+ cells (%)

60

vehicle

GA

BrdU/Dcx staining

Vehicle

BrdU staining

vehicle

GA

Dcx staining

GA

BrdU/Dcx staining

Vehicle

V

V 40x

V 40x

40x

V

40x

V

40x

V

40x

GA

GA

40x

40x

V

V

V

V

V

40x

40x

V 40x

40x

Fig. 5. Effect of GA on cell proliferation and neurogenesis. Number of proliferative (BrdU+) cells and proliferative neuronal progenitor (BrdU+/Dcx+) cells per section after vehicle or GA treatment at D3 following pMCAo (A) and tMCAo (B) (*p b 0.05).

transient MCAo. We hypothesized that GA injection would reduce infarct volume and improve neurological deficit through microglial/ macrophage activation reduction and/or a shift in Th0 differentiation from Th1 to Th2 and Treg responses, and/or neurogenesis enhancement. In our study, microglial/macrophage activation was reduced as shown by a decrease in pro-inflammatory cytokines (TNFα and IL-1β) at D3 in the tMCAo GA-treated mice only. However, this was not associated with any changes in IFNγ (main Th1 cytokine), IL-4 (main Th2 cytokine), IL-10 or TGFβ (main Treg cytokines) levels in either of the models. Neurogenesis was significantly increased at D7 in pMCAo GA-treated mice only. Infarct volume was not modified in either model, nor was neurological deficit in tMCAo mice at D3 or at D7. Microglial cells are the resident macrophages of the brain and were activated at D3 in both models of cerebral ischemia. Microglial/macrophage cells infiltrated the ischemic core and the peri-ischemic area. They adopted the characteristic amoeboid shape, compared to the adjacent healthy area where they were scarce and inactivated, exhibiting a small cell body and long ramified processes. They contribute to post-ischemic inflammation and are known to secrete a plethora of pro-inflammatory cytokines, including TNFα and IL-1β, which exacerbate tissue damage. In the stroke-lesioned rodent brain, these two cytokines are mainly produced by resident microglia and infiltrating monocyte-derived macrophages (Iadecola and Anrather, 2011). Most experimental cerebral ischemia studies show that IL-1β is harmful to brain tissue (Rothwell et al., 1997; Touzani et al., 2002). It is still under debate as to whether the role of TNFα in the outcome of brain ischemia is deleterious (Barone et al., 1997; Iosif et al., 2008) or beneficial (McCoy and Tansey, 2008). In many models of central nervous system injury such as HIV-1 encephalitis (Gorantla et al., 2007), Alzheimer's disease (Butovsky et al., 2006b) and EAE (Burger et al., 2009) or in models of peripheral nervous system injury (Leger et al., 2011), chronic administration of GA induces decreased microglial activation and the secretion of pro-inflammatory cytokines TNFα and IL-1β. These studies show

constant decreased microglial/macrophage cell density and downregulation of pro-inflammatory cytokines. Accordingly, we showed that IL-1β and TNFα mRNA were significantly reduced at D3 in the tMCAo mice treated with GA. However, we did not observe a microglial/macrophage density reduction. It could be that microglial/ macrophage cell infiltration is modified earlier in stroke, at day 1, as suggested by Liesz et al. (2009) or that activation but not recruitment is modified by GA administration. Furthermore, in contrast to the aforementioned studies, we did not administer GA chronically and this may explain the discrepancy between their results and our own. Bone marrow-derived monocytes (the major circulating antigen presenting cells [APC]) cultured in vitro in the presence of GA, and monocytes cultured ex vivo from GA-treated multiple sclerosis patients, release significantly less TNFα in response to LPS, suggesting that the properties of the monocyte are modified by GA peripherally, producing an anti-inflammatory phenotype (Weber et al., 2004). In the same way, GA has also been shown to directly inhibit blood monocyte-derived dendritic cells, another rarer type of professional antigen-presenting cell, both in vitro (Vieira et al., 2003) and ex vivo in multiple sclerosis patients (Ruggieri et al., 2008). We did not study this particular subset of APC in our experimental design. However, given that acute GA administration did not modify infarct volume or neurological deficit in our experimental design, the effect of GA on dendritic cells would probably only have had a modest impact, if any. Microglial/macrophage activation is one of the first steps in the immune response after cerebral ischemia and influences the differentiation of CD4 Th0 into Th1 or Th2 and Treg. In return, Th1, Th2 and Treg cytokine secretion modulates microglial/macrophage activity. Thus, the observed GA effect on microglial/macrophage activation could come from a direct interaction between GA and microglia/ macrophages (Weber et al., 2004) or from GA-induced modulation of T cell differentiation from Th1 into Th2 and Treg lymphocytes.

M. Poittevin et al. / Journal of Neuroimmunology 254 (2013) 55–62

IFNγ mRNA, a cytokine absent from normal brain parenchyma and produced by infiltrating Th1 cells during the inflammatory condition, was therefore explored in our model. IFNγ plays a deleterious role in the pathogenesis of stroke, IFNγ deficient mice showing an improvement in ischemic stroke injury (Yilmaz et al., 2006). However, IFNγ mRNA was not significantly modified in our two models at this time point. Little is known about the role of Th2 in the outcome of brain ischemia. IL-4, the representative Th2 cytokine, was shown to be protective since, in IL-4 deficient mice, microglial activation and Th1/Th2 ratio were increased and associated with a worse outcome. This effect was reversed by exogenous IL-4 administration after tMCAo at D1, whereas exogenous IL-4 injection in wild type mice did not limit cerebral ischemic damage (Xiong et al., 2011). However, this Th2 cytokine mRNA was not significantly modified in either of our two models after ischemia. IL-10 and TGFβ cytokines are mainly secreted by Treg cells (O'Garra et al., 2004; Hong et al., 2005). An up-regulation of the Treg population would be particularly relevant in stroke since after cerebral ischemia, Treg cell depletion by CD25-specific antibody administration exacerbates ischemic brain injury (Liesz et al., 2009). These authors showed that Treg lymphocytes prevent secondary infarct growth between D3 and D7 by counteracting the excessive production of pro-inflammatory cytokines such as TNFα and IFNγ secreted in the ischemic brain by microglia/macrophages and Th1 lymphocytes respectively. IL-10 cytokine is known to be cerebroprotective, since post ischemic IL-10 gene transfer reduces infarct volume (Ooboshi et al., 2005), as is TGFβ, since its intranasal administration reduces infarct volume, improves functional neurological recovery and enhances neurogenesis in mice after stroke (Ma et al., 2008). However, we failed to show any modifications of TGFβ or IL-10 in our two models. Liesz et al. (2009) also failed to show any modifications of ischemic brain IL-10 and TGFβ cytokine mRNAs in Treg-depleted mice compared to wild-type mice, but evidenced the role of IL-10, by intracerebroventricular administration in Treg-depleted mice, thus antagonizing the effects on infarct growth. All these data do not allow us to definitively conclude which mechanism leads to GA activity in ischemic brain injury. As microglial pro-inflammatory cytokines were the only ones to show mRNA reduction, but not the associated Th1, Th2 or Treg cytokines, we can hypothesize that the observed GA effect on microglial/macrophage activation comes from a direct interaction between GA and microglia/macrophages. However, we cannot rule out the possibility that mRNA expression may not be indicative of protein expression, and that GA may have an effect on the post-transcriptional regulatory processes of cytokines that are not detected by measuring mRNA expression alone. Adaptive immune cells could then also have been involved in the responses we saw after GA administration. Furthermore, our technique of determining mRNA expression from whole tissue lysate does not allow us to preclude the possibility that cells other than microglia/macrophages or T cells may contribute to TNFα, IL-1, IFNγ, IL-4, TGFβ and IL-10 secretion. Regulatory macrophages, for instance, whose hallmark is the production of high levels of IL-10, when activated in the EAE model, induce a marked reduction in neurological deficit (Fleming and Mosser, 2011). Again, as we did not find any significant modifications of IL-10 mRNA expression, we did not further characterize the cytokine sources, except for TNFα and IL-1, which have already been shown to be mainly produced by microglia/macrophages after stroke. Neurogenesis is a spontaneous reparative phenomenon after cerebral ischemia (Greenberg, 2007). Neuroblast progenitors generated in the subventricular zone (SVZ) migrate towards the striatum. Unfortunately, this endogenous neurogenesis is insufficient for repair because 80% of these new neurons die within the first two weeks after cerebral ischemia (Thored et al., 2006). This neurogenesis is enhanced by neurotrophic factors, such as brain-derived neurotrophic factor

61

(BDNF) (Barami, 2008). In the EAE model, Aharoni et al. (2003) showed that GA increases neurogenesis and neuroprotection by releasing BDNF, secreted in part by T-lymphocytes (Chen et al., 2003). The inflammatory response has a major effect on neurogenesis. Indeed, minocycline treatment reduces microglia activation, thus enhancing neurogenesis after cerebral ischemia (Liu et al., 2007). TNFα up-regulation secondary to microglial/macrophage activation could be detrimental to the survival of newly born neurons (Butovsky et al., 2006a; Ekdahl et al., 2009). Depending on the cytokine environment (IL-4 or low level of IFNγ), microglia induce neurogenesis and oligodendrogliogenesis in vitro and in an EAE model in vivo (Butovsky et al., 2006c), suggesting that the microglial phenotype is critical to impair or support cell renewal from adult stem cells. Indeed, at D7, in pMCAo only, we found significantly increased neurogenesis in ipsilateral ischemic hemispheres of GA-treated mice, these proliferating neuroblasts migrating from the SVZ through the corpus callosum towards the cortical infarct. However, decreased microglial activation was only found in the tMCAo mice. This discrepancy between the two models, which we had already evidenced for microglia/macrophage cytokine production, may come from a different duration of infarct development, i.e. the tMCAo model might evolve over a longer duration. We did not find any significant infarct volume reductions in our two models of cerebral ischemia either at D3 or at D7. In the only other study on rats receiving tMCAo and GA treatment (Ibarra et al., 2007), infarct volumes were significantly reduced at D7 in the GA-treated mice. In both groups, the authors systematically added Complete Freund's Adjuvant (CFA), which is a pro-inflammatory immunopotentiator, effective in stimulating cell-mediated immunity and currently used to induce EAE. CFA induces Glatiramer Acetate and naive Th0 lymphocyte interaction allowing their polarization into Th2 and Treg lymphocytes. To explain our conflicting results, we could hypothesize that i) GA is more effective in rats than in mice, or ii) that CFA itself could have increased infarct volume, whereas CFA + GA could have limited brain injury (CFA alone was not evaluated in Ibarra's study), or iii) that CFA + GA association provides a more constant, longer lasting molecule delivery than GA alone. We therefore evaluated two additional groups, CFA + GA and CFA alone, but did not find any difference in infarct volume (data not shown). In this study, we chose to inject GA subcutaneously at a dose of 2 mg, a common route and dose used in EAE studies in mice. GA was injected once, as a post-stroke treatment, immediately after experimental cerebral ischemia. In MS, which is a chronic disease, GA is effective when applied daily. Two hypotheses might explain the limited observed effect of GA in our models. Firstly, a single dose may be insufficient for extended effects. Secondly, it is possible that the GA effect is not immediate and occurs too late to antagonize the early inflammatory response after stroke. Because of our mechanistic hypotheses, we used two different models of cerebral ischemia: tMCAo, the chosen model in Ibarra's study (2007), and pMCAo, the model already studied for Treg and microglial activation after cerebral ischemia (Liesz et al., 2009). As detailed above, we chose two time points in our experimental procedure in accordance with what we know about innate and adaptive immunity involvement after stroke: inflammatory cells peak at D3 until D7 (Gelderblom et al., 2009) and the involvement of Treg cells is prominent between D3 and D7 (Liesz et al., 2009). We chose the C57BL/6 mouse strain, which is regarded as a Th1-type strain. We cannot exclude the possibility that the Th2 response elicited in outbred rats (the model used by Ibarra et al. (2007), who showed infarct volume reduction and neurological improvement after GA administration), is greater than that elicited in the C57BL/6 mouse thus leading to a greater effect. Studies on a different strain of mouse may shed light on this possibility. In conclusion, our study fails to confirm the previous report of a protective effect of GA in experimental ischemic stroke on infarct volume and neurological deficit, despite reduced microglial activation at

62

M. Poittevin et al. / Journal of Neuroimmunology 254 (2013) 55–62

D3 in the tMCAo mice, and enhanced neurogenesis at D7 in the pMCAo mice. Immunomodulatory therapy, such as GA in stroke, has to take into account the complexity and dynamics of post-ischemic cerebral inflammation. Source of funding INSERM: French Institute for Health and Medical Research. Marine Poittevin received a grant from the French Ministry of Higher Education and Research. Conflict of interest The authors have declared that there are no conflicts of interest. Acknowledgments We sincerely thank Anita Granier de Cassagnac for her valuable help. We are grateful to the Pharmacology of Cerebral Circulation (EA4475) laboratory headed by C. Marchand for its help in developing the transient MCAo model, Philippe Bonnin for his statistical help and Melanie Cole for editing the English manuscript. References Aharoni, R., Teitelbaum, D., Sela, M., Arnon, R., 1997. Copolymer 1 induces T cells of the T helper type 2 that crossreact with myelin basic protein and suppress experimental autoimmune encephalomyelitis. Proc. Natl. Acad. Sci. 94, 10821–10826. Aharoni, R., Teitelbaum, D., Leitner, O., Meshorer, A., Sela, M., Arnon, R., 2000. Specific Th2 cells accumulate in the central nervous system of mice protected against experimental autoimmune encephalomyelitis by copolymer 1. Proc. Natl. Acad. Sci. 97, 11472–11477. Aharoni, R., Kayhan, B., Eilam, R., Sela, M., Arnon, R., 2003. Glatiramer acetate-specific T cells in the brain express T helper 2/3 cytokines and brain-derived neurotrophic factor in situ. Proc. Natl. Acad. Sci. 100, 14157–14162. Aharoni, R., Arnon, R., Eilam, R., 2005a. Neurogenesis and neuroprotection induced by peripheral immunomodulatory treatment of experimental autoimmune encephalomyelitis. J. Neurosci. 25, 8217–8228. Aharoni, R., Eilam, R., Domev, H., Labunskay, G., Sela, M., Arnon, R., 2005b. The immunomodulator glatiramer acetate augments the expression of neurotrophic factors in brains of experimental autoimmune encephalomyelitis mice. Proc. Natl. Acad. Sci. 102, 19045–19050. Barami, K., 2008. Relationship of neural stem cells with their vascular niche: implications in the malignant progression of gliomas. J. Clin. Neurosci. 15, 1193–1197. Barone, F.C., Arvin, B., White, R.F., Miller, A., Webb, C.L., Willette, R.N., Lysko, P.G., Feuerstein, G.Z., 1997. Tumor necrosis factor-alpha. A mediator of focal ischemic brain injury. Stroke 28, 1233–1244. Burger, D., Molnarfi, N., Weber, M.S., Brandt, K.J., Benkhoucha, M., Gruaz, L., Chofflon, M., Zamvil, S.S., Lalive, P.H., 2009. Glatiramer acetate increases IL-1 receptor antagonist but decreases T cell-induced IL-1beta in human monocytes and multiple sclerosis. Proc. Natl. Acad. Sci. 106, 4355–4359. Butovsky, O., Ziv, Y., Schwartz, A., Landa, G., Talpalar, A.E., Pluchino, S., Martino, G., Schwartz, M., 2006a. Microglia activated by IL-4 or IFN-gamma differentially induces neurogenesis and oligodendrogenesis from adult stem/progenitor cells. Mol. Cell. Neurosci. 31, 149–160. Butovsky, O., Landa, G., Kunis, G., Ziv, Y., Avidan, H., Greenberg, N., Schwartz, A., Smirnov, I., Pollack, A., Jung, S., Schwartz, M., 2006b. Induction and blockage of oligodendrogenesis by differently activated microglia in an animal model of multiple sclerosis. J. Clin. Invest. 116, 905–915. Butovsky, O., Koronyo-Hamaoui, M., Kunis, G., Ophir, E., Landa, G., Cohen, H., Schwartz, M., 2006c. Glatiramer acetate fights against Alzheimer's disease by inducing dendritic-like microglia expressing insulin-like growth factor 1. Proc. Natl. Acad. Sci. 103, 11784–11789. Chen, M., Valenzuela, R.M., Dhib-Jalbut, S., 2003. Glatiramer acetate-reactive T cells produce brain-derived neurotrophic factor. J. Neurol. Sci. 215, 37–44. Ekdahl, C.T., Kokaia, Z., Lindvall, O., 2009. Brain inflammation and adult neurogenesis: the dual role of microglia. Neuroscience 158, 1021–1029. Fleming, B.D., Mosser, D.M., 2011. Regulatory macrophages: setting the threshold for therapy. Eur. J. Immunol. 41, 2498–2502. Gelderblom, M., Leypoldt, F., Steinbach, K., Behrens, D., Choe, C.U., Siler, D.A., Arumugam, T.V., Orthey, E., Gerloff, C., Tolosa, E., Magnus, T., 2009. Temporal and

spatial dynamics of cerebral immune cell accumulation in stroke. Stroke 40, 1849–1857. Gorantla, S., Liu, J., Sneller, H., Dou, H., Holguin, A., Smith, L., Ikezu, T., Volsky, D.J., Poluektova, L., Gendelman, H.E., 2007. Copolymer-1 induces adaptive immune antiinflammatory glial and neuroprotective responses in a murine model of HIV-1 encephalitis. J. Immunol. 179, 4345–4356. Greenberg, D.A., 2007. Neurogenesis and stroke. CNS Neurol. Disord. Drug Targets 6, 321–325. Haddad, M., Beray-Berthat, V., Coqueran, B., Palmier, B., Szabo, C., Plotkine, M., Margaill, I., 2008. Reduction of hemorrhagic transformation by PJ34, a poly (ADP-ribose) polymerase inhibitor, after permanent focal cerebral ischemia in mice. Eur. J. Pharmacol. 588, 52–57. Hong, J., Li, N., Zhang, X., Zheng, B., Zhang, J.Z., 2005. Induction of CD4+CD25+ regulatory T cells by copolymer-I through activation of transcription factor Foxp3. Proc. Natl. Acad. Sci. 102, 6449–6454. Iadecola, C., Anrather, J., 2011. The immunology of stroke: from mechanisms to translation. Nat. Med. 17, 796–808. Ibarra, A., Avendaño, H., Cruz, Y., 2007. Copolymer-1 (Cop-1) improves neurological recovery after middle cerebral artery occlusion in rats. Neurosci. Lett. 425, 110–113. Iosif, R.E., Ahlenius, H., Ekdahl, C.T., Darsalia, V., Thored, P., Jovinge, S., Kokaia, Z., Lindvall, O., 2008. Suppression of stroke-induced progenitor proliferation in adult subventricular zone by tumor necrosis factor receptor 1. J. Cereb. Blood Flow Metab. 28, 1574–1587. Jee, Y., Liu, R., Bai, X.F., Campagnolo, D.I., Shi, F.D., Vollmer, T.L., 2006. Do Th2 cells mediate the effects of glatiramer acetate in experimental autoimmune encephalomyelitis? Int. Immunol. 18, 537–544. Leger, T., Grist, J., D'Acquisto, F., Clark, A.K., Malcangio, M., 2011. Glatiramer acetate attenuates neuropathic allodynia through modulation of adaptive immune cells. J. Neuroimmunol. 234, 19–26. Liesz, A., Suri-Payer, E., Veltkamp, C., Doerr, H., Sommer, C., Rivest, S., Giese, T., Veltkamp, R., 2009. Regulatory T cells are key cerebroprotective immunomodulators in acute experimental stroke. Nat. Med. 15, 192–199. Liu, Z., Fan, Y., Won, S.J., Neumann, M., Hu, D., Zhou, L., Weinstein, P.R., Liu, J., 2007. Chronic treatment with minocycline preserves adult new neurons and reduces functional impairment after focal cerebral ischemia. Stroke 38, 146–152. Ma, M., Ma, Y., Yi, X., Guo, R., Zhu, W., Fan, X., Xu, G., Frey, W.H., Liu, X., 2008. Intranasal delivery of transforming growth factor-beta1 in mice after stroke reduces infarct volume and increases neurogenesis in the subventricular zone. BMC Neurosci. 9, 1–10. McCoy, M.K., Tansey, M.G., 2008. TNF signaling inhibition in the CNS: implications for normal brain function and neurodegenerative disease. J. Neuroinflammation 5, 45. Minmin, Ma, Yuping, Ma, Xueming, Yi, Ruibing, Guo, Wusheng, Zhu, Xinying, Fan, Gelin, Xu, William, H., Frey ll, Xinfeng, Liu, 2008. Intranasal delivery of transforming growth factor-beta1 in mice after stroke reduces infarct volume and increases neurogenesis in the subventricular zone. BMC Neurosci. 9, 117. O'Garra, A., Vieira, P.L., Vieira, P., Goldfeld, A.E., 2004. IL-10-producing and naturally occurring CD4+ Tregs: limiting collateral damage. J. Clin. Invest. 114, 1372–1378. Ooboshi, H., Ibayashi, S., Shichita, T., Kumai, Y., Takada, J., Ago, T., Arakawa, S., Sugimori, H., Kamouchi, M., Kitazono, T., Iida, M., 2005. Postischemic gene transfer of interleukin-10 protects against both focal and global brain ischemia. Circulation 111, 913–919. Rothwell, N., Allan, S., Toulmond, S., 1997. The role of interleukin 1 in acute neurodegeneration and stroke: pathophysiological and therapeutic implications. J. Clin. Invest. 100, 2648–2652. Ruggieri, M., Pica, C., Lia, A., Zimatore, G.B., Modesto, M., Di Liddo, E., Specchio, L.M., Livrea, P., Trojano, M., Avolio, C., 2008. Combination treatment of Glatiramer Acetate and Minocycline affects phenotype expression of blood monocyte-derived dendritic cells in Multiple Sclerosis patients. J. Neuroimmunol. 197, 140–146. Thored, P., Arvidsson, A., Cacci, E., Ahlenius, H., Kallur, T., Darsalia, V., Ekdahl, C.T., Kokaia, Z., Lindvall, O., 2006. Persistent production of neurons from adult brain stem cells during recovery after stroke. Stem Cells 24, 739–747. Touzani, O., Boutin, H., LeFeuvre, R., Parker, L., Miller, A., Luheshi, G., Rothwell, N., 2002. Interleukin-1 influences ischemic brain damage in the mouse independently of the interleukin-1 type I receptor. J. Neurosci. 22, 38–43. Vieira, P.L., Heystek, H.C., Wormmeester, J., Wierenga, E.A., Kapsenberg, M.L., 2003. Glatiramer acetate (copolymer-1, Copaxone) promotes Th2 cell development and increased IL-10 production through modulation of dendritic cells. J. Immunol. 170, 4483–4488. Weber, M.S., Starck, M., Wagenpfeil, S., Meinl, E., Hohlfeld, R., Farina, C., 2004. Multiple sclerosis: glatiramer acetate inhibits monocyte reactivity in vitro and in vivo. Brain 127, 1370–1378. Xiong, X., Barreto, G.E., Xu, L., Ouyang, Y.B., Xie, X., Giffard, R.G., 2011. Increased brain injury and worsened neurological outcome in interleukin-4 knockout mice after transient focal cerebral ischemia. Stroke 42, 2026–2032. Yilmaz, G., Arumugam, T.V., Stokes, K.Y., Granger, D.N., 2006. Role of T lymphocytes and interferon-gamma in ischemic stroke. Circulation 113, 2105–2112.