Growth differentiation factor 9 (Gdf9) was localized in the female as well as male germ cells in a protogynous hermaphroditic teleost fish, ricefield eel Monopterus albus

General and Comparative Endocrinology 178 (2012) 355–362

Contents lists available at SciVerse ScienceDirect

General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen

Growth differentiation factor 9 (Gdf9) was localized in the female as well as male germ cells in a protogynous hermaphroditic teleost fish, ricefield eel Monopterus albus Zhi He a, Yangsheng Wu a, Jun Xie c, Taixin Wang d, Lihong Zhang b,⇑, Weimin Zhang a,⇑ a

Institute of Aquatic Economic Animals, School of Life Sciences, Sun Yat-Sen University, Guangzhou 510275, PR China Biology Department, School of Life Sciences, Sun Yat-Sen University, Guangzhou 510275, PR China Key Laboratory of Tropical & Subtropical Fishery Resource Application & Cultivation, Ministry of Agriculture, Pearl River Fishery Research Institute, Chinese Academy of Fishery Sciences, Guangzhou 510380, PR China d Dazhong Breeding Co. Ltd., Jianyang 641400, PR China b c

a r t i c l e

i n f o

Article history: Received 26 February 2012 Revised 8 June 2012 Accepted 12 June 2012 Available online 23 June 2012 Keywords: Ricefield eel Monopterus albus Gdf9 Ovary Testis Immunoreactivity

a b s t r a c t Growth differentiation factor 9 (GDF9) is a member of the transforming growth factor beta (TGFb) superfamily. As an oocyte-derived growth factor, GDF9 plays key roles in regulating follicle development. In the present study, we identified a gdf9 homologue from the ovary of ricefield eel, and analyzed its expression both at the mRNA and protein levels. Ricefield eel Gdf9 showed high homologies with those of other teleosts, especially perciformes fish. RT-PCR analysis revealed that ricefield eel gdf9 was expressed exclusively in the ovary and testis. The mRNA levels of gdf9 in the ovary were increased significantly at the previtellogenic (PV) stage and then decreased significantly along with vitellogenesis. During the natural sex change, expression of ricefield eel gdf9 was peaked at the intersexual stages. The immunoreactivity for Gdf9 was localized exclusively in the cytoplasm of the oocytes in the ovary, particularly the oocytes at early stages, but not in the oogonia. Interestingly, strong immunoreactive signals were also detected in the degenerating oocytes in the intersexual gonad. Furthermore, the Gdf9 immunoreactivity was demonstrated for the first time to be localized in the cytoplasm of spermatogonia and spermatocytes of ricefield eel, a teleost fish. Taken together, the results of present study suggested that Gdf9 may play important roles in the folliculogenesis as well as spermatogenesis in ricefield eels. Ó 2012 Elsevier Inc. All rights reserved.

1. Introduction It is now widely recognized that in addition to the somatic cells, the oocytes are also actively involved in the developmental regulation of the ovary [8,22]. One of the oocyte-derived growth factors, growth differentiation factor 9 (GDF9), first identified from mouse in 1993 [26], has been shown to play critical roles in controlling folliculogenesis in mammals. In Gdf9 knock-out mouse or Gdf9mutant sheep, the folliculogenesis was found to be arrested at the primary follicle stage [5,12]. In agreement, in vivo treatment with GDF9 enhanced the progression of primordial and primary follicles into small prenatal follicles in ovaries of immature rats [31]. Furthermore, GDF9 was suggested to be involved in the control of ovulation rate in mammals [27]. A mutation in Gdf9 gene in sheep [12] or short term immunization against GDF9 peptide in ewes [16] resulted in an increase in ovulation rate. Regarding the cross-talk between the germ cell and somatic cell in the mamma⇑ Corresponding authors. Fax: +86 20 84113327 (W. Zhang). E-mail addresses: [email protected] (L. Zhang), [email protected] (W. Zhang). 0016-6480/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ygcen.2012.06.016

lian ovary, GDF9 was shown to stimulate granulosa cell proliferation but suppressed follicle stimulating hormone (FSH) induced granulosa cell differentiation [32]. In recent years, interestingly, studies suggested that GDF9 could potentially regulate testicular function [1,9,29]. GDF9 were shown to be expressed in the germ cell of testis, such as in the round spermatids in rat [28], and in round spermatids and pachytene spermatocytes in cat [34]. GDF9 could modulate key Sertoli cell functions by regulating the tight junctions of Sertoli cells [28,34]. In addition to mammals, Gdf9 was also identified recently in other vertebrates including chicken [15] and several teleosts [11,17,19–21]. As in mammals, chicken Gdf9 was predominantly expressed in oocytes and shown to enhance granulosa cell proliferation [15]. In teleosts, similarly, gdf9 was also primarily expressed in the ovary, with the oocyte as the exclusive or main production site [10,11,17,19,21]. The high expression levels of ovarian gdf9 were detected in the primary growth follicle of zebrafish [19], or during the pre-vitellogenic growth period in European sea bass [10,11] and rainbow trout [17], or proceeding the onset of puberty in shortfinned eels [21]. These results suggested that Gdf9 may be important in the early oogenesis. Although high expression levels

356

Z. He et al. / General and Comparative Endocrinology 178 (2012) 355–362

of gdf9 mRNA were detected in the testis of zebrafish [19] and gibel carp [20], the regulatory roles of Gdf9 in the testis of teleosts remain to be elucidated. As a variety of reproductive strategies employed in teleosts, the information on teleosts Gdf9 needs to be expanded a lot to generalize its regulatory roles. Ricefield eel, Monopterus albus, an important aquaculture species in China, is a protogynous hermaphrodite fish that changes sex from female through intersex to male phase during its life [18]. The mature female ricefield eel usually contains only about 200–300 oocytes in the ovary and this low fecundity is considered to be one of the major obstacles in the massive artificial breeding of this species. As GDF9 was implicated as a fecundity gene in sheep [30], it is very attractive for us to unravel the regulatory roles of Gdf9 during early oocyte development of ricefield eels. As a first step toward this aim, the ricefield eel gdf9 cDNA was isolated and its expression patterns were analyzed both at mRNA and protein levels. Gdf9 was demonstrated for the first time to be localized both in the female and male germ cells of ricefield eels in the present study.

Table 1 Primers used for RT-PCR analysis and expression of fusion proteins.

2. Materials and methods

F: sense primer; R: antisense primer.

2.1. The experimental fish and sampling procedure The ricefield eels used in this study were obtained from Dazhong Breeding Co. Ltd., Jianyang, Sichuan, China, and raised in our laboratory under natural photoperiod and temperature. All procedures and investigations were reviewed and approved by the respective Animal Research and Ethics Committees of Sun Yat-Sen University, and were performed in accordance with the guidelines of the committee. The phenotypic sex and gonadal developmental stages of ricefield eel were verified by histological sectioning of gonads. Ovarian development was classified as five stages in the present study, namely primary growth stage (PG, containing oocytes without cortical alveoli), pre-vitellogenic stage (PV, containing oocytes with the appearance of cortical alveoli), early vitellogenic stage (EV, containing oocytes at early vitellogenesis), mid- to late-vitellogenic stage (MLV, containing oocytes with active vitellogenesis), and mature stage (OM, containing mature oocytes). The transition of sex from female to male was classified into five sexual phases according to our previous work [33]. Fish were killed by decapitation, and tissues were dissected, frozen immediately in liquid nitrogen and stored at 70 °C until RNA extraction. The gonads were freshly fixed in Bouin’s solution for 24 h and stored in 70% ethanol until embedded in paraffin. The sections were cut serially at 5 lm thickness using a slicer (Leika, Germany).

Primer name

Sequence (5’-3’)

eGDF9F1 eGDF9R1 eGDF9F2 eGDF9R2 eGDF9R3 eGDF9R4 eGDF9F5 eGDF9R5 eGDF9F6 eGDF9R6 eGDF9F7 eGDF9R7 bactinF1 bactinR1 GapdhF GapdhR 18SqF 18SqR Hprt1F Hprt1R

CTGGGTGGAGGTKGAYSTGACCTC TGRGCAAYCATSTCYTCAWACTC CTTCTYTAYCTYAVYGACACCAG ACCATGGTGTGSAYDGGYGAVCC CAGGCTTGTCTCACCTTGTTTGCTC CCTCCTTTGCCATTGACCTGTAACC ATCTACAACACACTCCGACTGA TTGTGTCCAAATCTCTTCTCAG AGAAGGTGGAAGAGGGAATC GAAGTCATACAAGGCACAGTCA CACACCATGGGCAACTGGATGGAGGTTGACAAC CACAGGATCCTTACCTTCTCTTGTGTCCAAATCTCTT CGTACCACCGGAATTGTCA GTACCACCAGACAGCACAG TCACTGCTACCCAGAAGACCG CTCAGGAATGACCTTGCCCAC GGTTCTATTTTGTGGGTTTTCTCTCTG CTTTCGCTTTCGTCCGTCTTG TTGGACAGGACAGAGCGACT TCATTGGGATGGAGCGGT

rogen) according to the manufacturer’s instructions. PCR was performed in a 25 ll final volume containing 2.5 ll 10  Taq Buffer, 2.5 mM MgCl2, 0.2 mM dNTP, 0.4 lM of each primer, 1.25 U Taq DNA Polymerase (Fermentas), and 1 ll of ovary cDNA. After an initial 3 min denaturing step at 94 °C, 35 cycles of amplification were performed with 0.5 min at 94 °C, 0.5 min at 46 °C, and 1.0 min at 72 °C, and then followed by a final extension for 30 min at 72 °C. The amplification products were cloned into pTZ57R/T (Fermentas), and sequenced in both directions with forward and reverse universal primers using the Bigdye-Terminator kit and an ABI Prism 3730XL DNA sequencer (Perkin-Elmer Applied Biosystems, Wellesley, MA, USA). After determining the nucleotide sequence of the initial fragment of the gdf9 cDNA, 50 -RACE and 30 -RACE were carried out to obtain the full-length cDNA sequence using a BD SMART™ RACE cDNA Amplification Kit (Invitrogen). The gene-specific primers were eGDF9R3 and eGDF9R4 for 50 -RACE, and degenerate primers eGDF9F1and eGDF9F2 for 30 -RACE. These primers were listed in Table 1. The PCR conditions were the same as the above except the that annealing temperatures were 58 °C in the first round and 60 °C in the second round of amplification, respectively. The amplification products were processed as above. 2.4. Sequence analysis

Total RNA was isolated from frozen tissues using TRIzol reagent (Invitrogen) following the manufacturer’s instructions and quantified based on the absorbance at 260 and 280 nm in a UV/Visible spectrophotometer (Amersham Biosciences, England). The integrity of RNA was checked using agarose gel electrophoresis.

The deduced amino acid sequence of ricefield eel Gdf9 was subjected to PROSITE (http://www.expasy.ch/prosite/) for characterization of the functional domains. The alignment of Gdf9 amino acids sequences of the ricefield eel and other vertebrates were performed by using the ClutalX1.83 software (Plate-Forme de BioInformatique, Illkirch Cedex, France). The percentage identities were calculated using MegAlign of DNAstar software package (DNASTAR, Inc., Madison, WI, USA).

2.3. Cloning of ricefield eel gdf9 cDNA

2.5. RT-PCR analysis of tissue patterns of gdf9 mRNA expression

The initial fragments of gdf9 cDNA were amplified with nested PCR from the ovary cDNA, using degenerate primers eGDF9F1and eGDF9R1 for the first round, and primers eGDF9F2 and eGDF9R2 for the second round of amplification. These primers were listed in Table 1. The ovary cDNA were transcribed from ricefield eel ovary total RNA using BD SMART™ PCR cDNA Synthesis Kit (Invit-

Total RNA isolated from tissues was first treated with DNase I (1 U/ll) to remove any genomic DNA contamination. Then 1 lg total RNA was reverse transcribed with oligo(dT)18 primers using the RevertAidTM H Minus First Strand cDNA Synthesis Kit (Fermentas) according to the manufacturer’s instructions. The integrity of all RNA samples was verified by the successful amplification of bactin.

2.2. Isolation of total RNA

Z. He et al. / General and Comparative Endocrinology 178 (2012) 355–362

The absence of genomic DNA contamination in the DNase I-treated RNA sample was verified by the amplification of target genes from the reverse transcription reaction mixture without the addition of the reverse transcriptase (designated as RT- controls). The first-strand cDNA synthesized above (0.25 ll) was amplified for each target gene using the Biometra TGRADIENT thermal cycler. PCR was performed in a 25 ll final volume containing 2.5 ll 10  Taq buffer, 2.0 mM MgCl2, 0.2 mM dNTP, 0.4 lM of each primer, and 1.25 U Taq DNA Polymerase (Fermentas). Water was used as a negative control in the RT-PCR. The reaction mixture was heated at 94 °C for 3 min, followed by 32 cycles for gdf9, and 28 cycles for bactin. The cycling conditions were 94 °C for 0.5 min, 58 °C for 0.5 min, and 72 °C for 1 min, with a final extension at 72 °C for 7 min. The primers were eGDF9F5 and eGDF9R5 for gdf9, and bactinF1 and bactinR1 for bactin, which generated PCR products of 627 bp and 484 bp, respectively. These primers were listed in Table 1. The PCR products were separated on a 1.5% agarose gel, and stained with ethidium bromide (0.5 lg/ml). The gel image was captured on the Biorad GelDoc 2000 (BioRad), and analyzed with Quantity One (Bio-Rad). 2.6. Analysis of gdf9 mRNA levels during ovarian development and natural sex change Real-time PCR analysis was established to determine the mRNA expression levels of ricefield eel gdf9 in the gonads. The primers were eGDF9F6 and eGDF9R6 for gdf9, GapdhF and GapdhR for glyceraldehyde-3-phosphate dehydrogenase (gapdh), 18SqF and 18SqR for 18S ribosomal RNA (18S rRNA) and Hprt1F and Hprt1R for hypoxanthine phosphoribosyltransferase 1 (hprt1), which were listed in Table 1. The real-time PCR was performed on the iCycler iQ5 (Bio-Rad) in a volume of 20 ll containing 0.2 lM of each primer, 10 ll of 2X SYBR Green Master Mix (TOYOBO, Osaka, Japan), l ll of cDNA template which was transcribed from 1 lg DNase I-treated total RNA with the random hexamer primer using RevertAidTM H Minis First Strand cDNA synthesis Kit (Fermentas). The PCR cycling conditions were: 95 °C for 3 min; 40 cycles of 95 °C for 15 s, 58 °C for 15 s, 72 °C for 15 s; 82 °C for 15 s for signal collection in each cycle. Data were produced and analyzed by iQ5 software. The specificity of PCR amplification was confirmed by melt-curve analysis, agarose gel electrophoresis, and sequencing of PCR products. The quantification of the mRNA expression level was performed using a standard curve with tenfold serial of dilution of plasmid containing corresponding DNA fragments from 101 to 108 copies. The correlation coefficients and PCR efficiencies were not less than 0.95 and 85% respectively. The copy numbers of gdf9 and reference genes were calculated by iQ5 software (Bio-rad) based on the corresponding standard curves. To minimize variation due to the differences in RNA loading, each sample was normalized to the geometric mean of the expression levels of the three reference genes, and the mRNA expression levels of gdf9 were presented as the copy number ratios to the geometric means of reference genes. 2.7. Generation of polyclonal antiserum against ricefield eel Gdf9 The target sequence encoding the middle part of ricefield eel Gdf9 preprohormone (103 amino acid residues ranging from aa 194 to 296 before the mature region) was amplified using genespecific primers eGDF9F7 and eGDF9R7 (Table 1), subcloned into Nco I and BamH I sites of expression vector pET-15b, and expressed in the host E. coli BL21 (DE3) by isopropyl b-D-1-thiogalactopyranoside (IPTG) induction. The recombinant Gdf9 peptide was gelpurified and used to immunize New Zealand white rabbits as previously reported [14]. The same region of Gdf9 preprohormone as the above was also produced in host E. coli BL21 (DE3) as Gdf9-TRX

357

fusion protein using expression vector pET-32a, purifified first by His-binding Kit (Novagen) then by SDS–PAGE, which was used as a positive control in Western blot analysis. 2.8. Western blot Analysis The tissue homogenates and Gdf9-TRX fusion protein were separated on a 12% SDS–PAGE and transferred to a methanol-activated polyvinylidene difluoride (PVDF) membrane (Millipore) by electroblotting. The membrane was then blocked with 5% non-fat milk powder in 10 mM PBS buffer (137 mM NaCl, 2.7 mM KCl, 10 mM NaHPO4, 2 mM KH2PO4) at 4 °C overnight. The primary antiserum against ricefield eel Gdf9 was pre-adsorbed for 4 h at 4 °C with extracts of E. coli BL21 (DE3) bacteria which were transformed with the empty vector pET-15b and induced by IPTG. The blocked membrane was incubated with the pre-adsorbed primary antiserum at a dilution of 1:1000 in blocking solution (5% non-fat milk powder in 10 mM PBS) at room temperature for 1 h, washed with PBS for 5 min three times, and incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (1:1000 dilution, Jackson ImmunoResearch Bio) for 1 h at room temperature. After 10 min final washes with PBS three times, the membrane was exposed to a chemiluminescence substrate (ECL, Applygen Technologies) according to the manufacturer’s instructions. To confirm of the specificity of the anti-Gdf9 antiserum, Western Blot analysis was performed using the pre-absorbed antiserum with an excess of recombinant ricefield eel Gdf9 antigen. 2.9. Immunohistochemistry (IHC) The deparaffinized and hydrated sections were incubated in room temperature for 30 min in 3% hydrogen peroxide solution to quench the endogenous peroxidase activity, followed by antigen retrieval with heat in 10 mM citrate buffer (pH6.0) for 15 min. After three washes of 5 min each with PBS, the sections were then incubated at room temperature for 1 h with 1:1000 dilution of primary antiserum against ricefield eel Gdf9 raised in rabbits. After three washes of 5 min each with PBS, the sections were incubated with a second antibody (HRP-conjugated goat anti-rabbit IgG) solution. After rinsing with PBS, the sections were developed with 3,30 -diaminobenzidin (DAB), mounted, examined with a microscope, and digitally photographed (Nikon, E800). To confirm the specificity of the immunostaining, control sections were incubated with the primary antiserum (in its working dilution) pre-adsorbed with an excess of recombinant ricefield eel Gdf9 antigen. Additional negative controls included replacement of primary antiserum with PBS or pre-immune serum and the omission of secondary antibody. 2.10. Statistical analysis Data were analyzed by one-way analysis of variance (ANOVA) followed by the Tukey multiple comparison test using the SPSS17.0 software (SPSS, Inc., Chicago, IL, USA). Significance was set at P < 0.05. 3. Results 3.1. Nucleotide and deduced amino acid sequences of ricefield eel gdf9 The ricefield eel gdf9 cDNA sequence (GenBank ID: JQ283679) consisted of 2151 bp including the poly (A) tail. This sequence contained a 20 bp 50 untranslated region (UTR), an 838 bp 30 UTR, and an open reading frame (ORF) encoding a putative protein of 430

358

Z. He et al. / General and Comparative Endocrinology 178 (2012) 355–362

amino acids. A polyadenylation signal (AATAAA) was located 13 bp upstream of the poly (A) tail. The potential signal peptide cleavage site for ricefield eel Gdf9 was predicted to be between amino acids Ser32 and Ser33, and there are two potential N- glycosylation sites, NFTA (residues 182–185) and NITC (residues 220–223), respectively. In accordance with other Gdf9 orthologs, the putative propeptide cleavage site of ricefield eel Gdf9 was RWKR (residues 299–302; Fig. 1).

The overall amino acid sequence of ricefield eel Gdf9 precursor shared only about 40% identities with those of mammals and chicken, and 48–52% with those of shortfinned eel, zebrafish, and gibel carp, the non- Perciformes fish, but about 80% with that of European sea bas, the Perciformes fish. In contrast, the mature region of ricefield eel Gdf9 precursor was highly conserved when compared with those of other vertebrates, particularly at the C-terminus where six characteristic cysteine residues were fully

Fig. 1. Alignment of the amino acid sequences of ricefield eel Gdf9 precursor (AFF57870) and those of other vertebrates. The signal peptide, pro-region, and mature peptide are predicted with ExPASy tools. The potential N-glycosylation sites are marked with triangles. The putative cleavage sites for the mature Gdf9 peptides are shown with open boxes. The light-grey shading indicated identical amino acid sequences. The six conserved cysteine residues in the Gdf9 subfamily were marked by asterisks. The protein sequences of Gdf9 of the other vertebrates were downloaded from Entrez (NCBI) by following accession numbers: CAP71884 (European sea bass), AAV91155 (zebrafish), ADW20148 (gibel carp), AB074569 (shortfinned eel), AAT74587 (chicken), and AAH96229 (human).

Z. He et al. / General and Comparative Endocrinology 178 (2012) 355–362

conserved (Fig. 1). Homology analysis showed that the mature region of ricefield eel Gdf9 precursor shared about 60% identities with those of mammals and chicken, 63–70% with those of shortfinned eel, zebrafish, and gibel carp, the non- Perciformes fish, and 90% with that of European sea bas, the Perciformes fish . 3.2. Gonad-specific expression of ricefield eel gdf9 The tissue patterns of gdf9 mRNA expression were analyzed in both the female and male ricefield eels using RT-PCR. The ricefield eel gdf9 mRNA was detected exclusively in the gonads of both sexes (Fig. 2A and B), but not in other somatic tissues, including the brain, pituitary, liver, heart, muscle and kidney. Western Blot analysis was performed on tissue homogenates from the brain, liver, ovary and testis, and specific bands of about 45.8 kDa (approximating the theoretical molecular weight of ricefield eel Gdf9 prohormone) were detected in the ovary and testis, but not in the brain or liver (Fig. 2C). As a control, a specific band of about 34.0 kDa was detected in the bacteria lysate of E. coli BL21(DE3) transformed with Gdf9-TRX fusion protein expression vector (Fig. 2C). When the primary antiserum was pre-absorbed with an excess of recombinant ricefield eel Gdf9 antigen, the above-detected specific bands disappeared (Fig. S1). 3.3. mRNA levels of ricefield eel gdf9 during ovarian development and natural sex change Real-time quantitative RT-PCR analysis showed that during the ovarian development, the relative mRNA levels of gdf9 were significantly increased at the pre-vitellogenic (PV) stage, then decreased from early vitellogenic (EV) stage and thereafter (Fig. 3A). During the natural sex change, the relative mRNA levels of gdf9 were increased significantly from the female (at the mature stage) to the intersexual phases, but then decreased significantly at the male stage (Fig. 3B).

359

3.4. Localization of Gdf9 immunoreactive signals in the gonads of ricefield eels Immunohistochemical staining detected Gdf9 signals both in the ovary and testis of ricefield eels (Fig. 4A, C, D, E and G). In the ovary, Gdf9 immunoreactive signals, which were dot-like, were primarily present in the cytoplasm of oocytes both at primary growth and vitellogenic stage, but not the presumptive oogonia (Fig. 4A). The Gdf9 signals seemed to be stronger in the cytoplasm of oocytes at the earlier stage (primary growth stage) than those at later stages (pre-vitellogenic and mid-to-late vitellogenic stages) (Fig. 4C and D). Interestingly, Gdf9 signals were detected predominantly around the nuclear membrane of the oocytes at the primary growth stage, while dispersed throughout the cytoplasm of the enlarged and further developed oocytes (Fig. 4C and D). Strong Gdf9 immunoreactive signals were also detected in the cytoplasm of the degenerating oocytes in the intersexual gonad (Fig. 4E). In the testis or the male tissue of the intersexual gonad of ricefield eels, Gdf9 immunoreactive signals were localized to the male germ cells (Fig. 4E and G). Particularly, the Gdf9 signals were detected in the cytoplasm of the spermatogonia and spermatocytes, and possibly at a much lower level in the cytoplasm of spermatids as well. No positive signals were observed in the negative control when the primary antiserum was adsorbed with excessive antigen (Fig. 4F and H).

4. Discussion In the present study, the full-length cDNA encoding ricefield eel Gdf9 was isolated from the ovary cDNA. The deduced amino acid sequence of ricefield eel Gdf9 possessed the typical structures of TGF b superfamily, including the conserved cysteine residues in TGF b domain [4,13], and the basic furin RXXR cleavage site [2]. Homology analysis indicated that ricefield eel Gdf9 is closely related with that of European sea bass, a Perciformes fish, which conforms to their lineage relationship. Although three potential propeptide cleavage sites, namely RVQR, RRRR, and RWKR

Fig. 2. Tissue distribution of gdf9 mRNA in the female (A) and male (B) ricefield eels as analyzed by RT-PCR. Ob: olfactory bulb; Te: telencephalon; Hy: hypothalamus; Ot: optic tectum-thalamus; Ce: cerebellum; Mo: medulla oblongata; Pi: pituitary; Mu: muscle; Ov: ovary; Ts: testis; Sp: spleen; He: heart; Li: liver; Ki: kidney; In: intestines; Bl: blood; Ey: eyes; RT-: RT without reverse transcriptase from the ovary or testis RNA sample; NC: negative control. The bottom panel C: Western Blot analysis of Gdf9 immunoreactivity in the gonad (ovary or testis), brain, and liver of ricefield eels. The tissue homogenates were separated on a 12% SDS–PAGE gel, transferred to a polyvinylidenefluoride membrane, and then immunoreacted with the anti-Gdf9 antiserum. The Gdf9-TRX fusion protein was included as a positive control.

360

Z. He et al. / General and Comparative Endocrinology 178 (2012) 355–362

Fig. 3. Relative mRNA levels of gdf9 in the gonad of ricefield eel during ovarian development (A) and natural sex change (B) as analyzed by real-time quantitative RT-PCR. The gonadal stages of all individual samples were histologically examined (data not shown). PG: primary growth stage; PV: pre-vitellogenic stage; EV: early vitellogenic stage; MLV: mid- to late-vitellogenic stage; OM: oocyte at mature stage; F: the female stage (oocyte at mature stage); IE: the early intersexual stage; IM: the middle intersexual stage; IL: the late intersexual stage; M: the male stage. The results are presented as the means ± SEM (n = 3–5). Means marked with different letters are significantly different (P < 0.05).

respectively, were predicted in ricefield eel Gdf9 with ExPASy tools, the sequence alignment with those of European sea bass [11] and shortfinned eel [21] suggested that the putative propeptide cleavage site of ricefield eel Gdf9 was probably RWKR, which would yield a mature C-terminal peptide of 131 amino acids with a calculated MW of 15.2 kDa. In rat, mouse, and human, a single putative N-glycosylation site was identified in the mature protein of GDF9, and three or four (rat) conserved N-glycosylation sites in the pro-region [13]. In agreement, recombinant rat GDF9 produced by mammalian cells were likely glycosylated in both pro- and mature regions, and capable of stimulating early follicle development [13]. However, in ricefield eels, as in other teleosts like zebrafish [19], European sea bass [11], and shortfinned eel [21], putative N-glycosylation sites were only identified in the pro-regions of Gdf9 but not in the mature proteins. Although a possible O-glycosylation site was identified in the mature region of shortfinned eel Gdf9, Western blot analysis of glycosidase-treated ovarian proteins did not detect a shift in molecular weight, suggesting that shortfinned eel Gdf9 is not glycosylated [21]. These lines of evidence suggested that Gdf9 mature proteins in teleosts, unlike those in mammals, might not be glycosylated, and it may be of interest to look at the actions of Gdf9 and the underlying signalling pathways in teleosts. In mammals, Gdf9 mRNA was expressed in the ovary as well as nonovarian tissues including the hypothalamus, pituitary, and testis [6,9]. In some teleosts, such as European sea bass [11] and gible carp [20], gdf9 mRNA was detected in the gonads and extra-gonadal tissues, including the liver, muscle, brain, and heart. However, in rainbow trout [17] and zebrafish [19], gdf9 mRNA was only expressed in the gonads. Similarly, ricefield eel gdf9 mRNA was also only detected in the ovary and testis. Furthermore, using an antiserum against ricefield eel Gdf9 pro-region, Western Blot analysis detected a single band only in the ovary and testis of ricefield eels. These results suggested that Gdf9 may have conserved functions in the gonads across vertebrates, but species-specific functions in extra-gonadal tissues, and that ricefield eel Gdf9 may be primarily involved in the gonadal development and functions. It is notable that the size of the protein band detected by Western Blot in the present study was about 45.8 kDa, approximating the predicted molecular weight of Gdf9 propeptide (46.5 kDa). Presumably, the pro-region of ricefield eel Gdf9, with calculated molecular weight of 30.7 kDa, could also be detected with the antiserum if the precursors of ricefield eel Gdf9 were properly processed. However, the gel image of Western Blot analysis did not reveal such bands either in the homogenates of the ovary or testis. These results further supported the notion that the pre-propeptide precursor of

Gdf9 are the predominant forms in fish ovaries, and the mature form of Gdf9 does not seem to be produced in a regular manner [10]. In the ovary of ricefield eels, immunohistochemical analysis using the homologous antiserum generated in the present study indicated that the expression of Gdf9 was primarily in the oocyte. Similar cellular localization of GDF9 (or Gdf9) was also reported in mammals [3,7,23], chicken [15], and other teleosts including European sea bass [10] at the protein levels, and zebrafish at the mRNA level [19]. The most intense Gdf9 signals were observed in the cytoplasm of the oocytes at the primary growth stage in ricefield eels, which is in agreement with the previous reports in European sea bass [11] and zebrafish [19]. Similar to the expression profiles of gdf9 in teleosts like European sea bass [11], rainbow trout [17], and shortfinned eel [21], the expression levels of ricefield eel gdf9 mRNA in the ovary were highest at the pre-vitellogenic stage, but decreased following the further development of the ovary. The high level of gdf9 mRNA in the ovary at the pre-vitellogenic stage could probably be attributed to the strong Gdf9 immunostaining in the oocytes at both the primary growth stage and pre-vitellogenic stage, which were the two main oocytes in the pre-vitellogenic ovary. These lines of evidence suggested that ricefield eel Gdf9 may be related to the early folliculogenesis. In addition to the ovary, Gdf9 mRNA was shown to be expressed in pachytene primary spermatocytes and round spermatids of mouse testis [9]. To support this notion, GDF9 proteins were localized in the cytoplasm of round spermatids and pachytene spermatocytes of the cat seminiferous epithelium [34], and principally in round spermatids of rat testis [28]. These results suggested that GDF9 may potentially have functions at defined points of spermatogenesis in mammals [28]. In agreement, our present study also detected Gdf9 immunoreactive signals, for the first time, in the male germ cells of ricefield eel testis and intersexual gonad. The Gdf9 staining in the testis of ricefield eels was predominantly localized in the cytoplasm of spermatogonia and spermatocytes, and possibly in the cytoplasm of spermatids at a much lower level, suggesting a possible role of Gdf9 in the spermatogenesis in ricefield eels. It is interesting to note that strong Gdf9 immunoreactive signals were also detected in the degenerating oocytes in the intersexual gonad of ricefield eels. Furthermore, real-time PCR revealed high levels of gdf9 mRNA in the transitional gonads of ricefield eels, particularly at the early intersexual phase, which is probably attributed to the abundant expression of gdf9 both in the degenerating oocytes and germinating male germ cells. In the ovine, GDF9 protein was shown to be present in degenerating oocytes under

Z. He et al. / General and Comparative Endocrinology 178 (2012) 355–362

361

Fig. 4. Localization of Gdf9 immunoreactive signals in the gonads of ricefield eels. The sections of the ovary at the primary growth stage (A), the pre-vitellogenic stage (C), and the mid- to late-vitellogenic stage (D), and of the intersexual gonad (E) were immunostained with anti-Gdf9 antiserum. Panel B: HE-stained sections adjacent to those shown in panel A. Panel F: the ovary section immunostained with pre-adsorbed anti-Gdf9 antiserum which is adjacent to the one shown in panel D. Panel G: immunohistochemistry of testis section counterstained with hematoxylin. The inset in panel G: the magnified image of the boxed area. Panel H: the testis section immunostained with pre-adsorbed anti-Gdf9 antiserum which is adjacent to the one shown in panel G. OG: oogonia, PG: primary growth stage oocyte; PV: pre-vitellogenic stage oocyte; MLV: mid- to latevitellogenic stage oocyte; DO: degenerating oocyte; SG: spermatogonia; SC: spermatocyte; ST: spermatid; SE: Sertoli cell. Scale bar is 100 lm except the specifically designated.

in vitro conditions, and even in highly disorganized follicular structures [24,25]. However, the physiological relevance of high Gdf9 levels in degenerating follicles of ricefield eels during the transitional period remains to be elucidated. In summary, the full-length cDNA sequence encoding ricefield eel Gdf9 was isolated and characterized. RT-PCR analysis showed that ricefield eel gdf9 was expressed only in the ovary and testis. The levels of gdf9 mRNA in the ovary of ricefield eels were peaked at the pre-vitellogenic stage. Immunocytochemical studies showed that ricefield eel Gdf9 was localized in the cytoplasm of both fe-

male and male germ cells, particularly the oocytes at the primary growth stage in the ovary and spermatogonia and spermatocytes in the testis. These results suggested that ricefield eel Gdf9 may also be related to the folliculogenesis as well as spermatogenesis as in other vertebrates. Acknowledgments We thank Yixue Li and Shiying Han for their assistance in the preparation of tissue samples. This work was supported by the

362

Z. He et al. / General and Comparative Endocrinology 178 (2012) 355–362

Natural Science Foundation of China (30970359, 31072197, 31172088), and the Modern Agro-industry Technology Research System (NYCYTX-49-13). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.ygcen.2012. 06.016. References [1] J. Aaltonen, M.P. Laitinen, K. Vuojolainen, R. Jaatinen, N. Horelli-Kuitunen, L. Seppa, H. Louhio, T. Tuuri, J. Sjoberg, R. Butzow, O. Hovata, L. Dale, O. Ritvos, Human growth differentiation factor 9 (GDF-9) and its novel homolog GDF-9B are expressed in oocytes during early folliculogenesis, J. Clin. Endocrinol. Metab. 84 (1999) 2744–2750. [2] R. Benoit, N. Ling, F. Esch, A new prosomatostatin-derived peptide reveals a pattern for prohormone cleavage at monobasic sites, Science 238 (1987) 1126– 1129. [3] K.J. Bodensteiner, C.M. Clay, C.L. Moeller, H.R. Sawyer, Molecular cloning of the ovine Growth/Differentiation factor-9 gene and expression of growth/ differentiation factor-9 in ovine and bovine ovaries, Biol. Reprod. 60 (1999) 381–386. [4] S. Daopin, K.A. Piez, Y. Ogawa, D.R. Davies, Crystal structure of transforming growth factor-beta 2: an unusual fold for the superfamily, Science 257 (1992) 369–373. [5] J. Dong, D.F. Albertini, K. Nishimori, T.R. Kumar, N. Lu, M.M. Matzuk, Growth differentiation factor-9 is required during early ovarian folliculogenesis, Nature 383 (1996) 531–535. [6] D.C. Eckery, L.J. Whale, S.B. Lawrence, K.A. Wylde, K.P. McNatty, J.L. Juengel, Expression of mRNA encoding growth differentiation factor 9 and bone morphogenetic protein 15 during follicular formation and growth in a marsupial, the brushtail possum (Trichosurus vulpecula), Mol. Cell. Endocrinol. 192 (2002) 115–126. [7] J.A. Elvin, A.T. Clark, P. Wang, N.M. Wolfman, M.M. Matzuk, Paracrine actions of growth differentiation factor-9 in the mammalian ovary, Mol. Endocrinol. 13 (1999) 1035–1048. [8] J.J. Eppig, K. Wigglesworth, F.L. Pendola, The mammalian oocyte orchestrates the rate of ovarian follicular development, Proc. Nat. Acad. Sci. U.S.A. 99 (2002) 2890–2894. [9] S.L. Fitzpatrick, D.M. Sindoni, P.J. Shughrue, M.V. Lane, I.J. Merchenthaler, D.E. Frail, Expression of growth differentiation factor-9 messenger ribonucleic acid in ovarian and nonovarian rodent and human tissues, Endocrinology 139 (1998) 2571–2578. [10] A. Garcia-Lopez, M.I. Sanchez-Amaya, S. Halm, A. Astola, F. Prat, Bone morphogenetic protein 15 and growth differentiation factor 9 expression in the ovary of European sea bass (Dicentrarchus labrax): cellular localization, developmental profiles, and response to unilateral ovariectomy, Gen. Comp. Endocrinol. 174 (2011) 326–334. [11] S. Halm, A.J. Ibanez, C.R. Tyler, F. Prat, Molecular characterisation of growth differentiation factor 9 (gdf9) and bone morphogenetic protein 15 (bmp15) and their patterns of gene expression during the ovarian reproductive cycle in the European sea bass, Mol. Cell. Endocrinol. 291 (2008) 95–103. [12] J.P. Hanrahan, S.M. Gregan, P. Mulsant, M. Mullen, G.H. Davis, R. Powell, S.M. Galloway, Mutations in the genes for oocyte-derived growth factors GDF9 and BMP15 are associated with both increased ovulation rate and sterility in Cambridge and Belclare sheep (Ovis aries), Biol. Reprod. 70 (2004) 900–909. [13] M. Hayashi, E.A. McGee, G. Min, C. Klein, U.M. Rose, M. van Duin, A.J. Hsueh, Recombinant growth differentiation factor-9 (GDF-9) enhances growth and differentiation of cultured early ovarian follicles, Endocrinology 140 (1999) 1236–1244.

[14] Y.X. Hu, J.Y. Guo, L. Shen, Y. Chen, Z.C. Zhang, Y.L. Zhang, Get effective polyclonal antisera in one month, Cell Res. 12 (2002) 157–160. [15] P.A. Johnson, M.J. Dickens, T.R. Kent, J.R. Giles, Expression and function of growth differentiation factor-9 in an oviparous species, Gallus domesticus, Biol. Reprod. 72 (2005) 1095–1100. [16] J.L. Juengel, N.L. Hudson, L. Whiting, K.P. McNatty, Effects of immunization against bone morphogenetic protein 15 and growth differentiation factor 9 on ovulation rate, fertilization, and pregnancy in ewes, Biol. Reprod. 70 (2004) 557–561. [17] S.E. Lankford, G.M. Weber, Temporal mRNA expression of transforming growth factor-beta superfamily members and inhibitors in the developing rainbow trout ovary, Gen. Comp. Endocrinol. 166 (2010) 250–258. [18] C.K. Liu, Rudimentary hermaphroditism in the symbranchoid eel Monopterus javanensis, Sinensia 15 (1944) 1–8. [19] L. Liu, W. Ge, Growth differentiation factor 9 and its spatiotemporal expression and regulation in the zebrafish ovary, Biol. Reprod. 76 (2007) 294–302. [20] Z. Liu, A. Chen, Z. Yang, H. Wei, X. Leng, Molecular characterization of growth differentiation factor 9 and its spatio-temporal expression pattern in gibel carp (Carassius auratus gibelio), Mol. Biol. Rep. (2011), http://dx.doi.org/10.1007/ s11033-11011-11165-11038. [21] P.M. Lokman, Y. Kazeto, Y. Ozaki, S. Ijiri, R. Tosaka, M. Kohara, S.L. Divers, H. Matsubara, L.G. Moore, S. Adachi, Effects of reproductive stage, GH, and 11ketotestosterone on expression of growth differentiation factor-9 in the ovary of the eel Anguilla australis, Reproduction 139 (2010) 71–83. [22] M.M. Matzuk, K.H. Burns, M.M. Viveiros, J.J. Eppig, Intercellular communication in the mammalian ovary: oocytes carry the conversation, Science 296 (2002) 2178–2180. [23] S.A. McGrath, A.F. Esquela, S.J. Lee, Oocyte-specific expression of growth/ differentiation factor-9, Mol. Endocrinol. 9 (1995) 131–136. [24] K.P. McNatty, L.G. Moore, N.L. Hudson, L.D. Quirke, S.B. Lawrence, K. Reader, J.P. Hanrahan, P. Smith, N.P. Groome, M. Laitinen, O. Ritvos, J.L. Juengel, The oocyte and its role in regulating ovulation rate: a new paradigm in reproductive biology, Reproduction 128 (2004) 379–386. [25] K.P. McNatty, P. Smith, L.G. Moore, K. Reader, S. Lun, J.P. Hanrahan, N.P. Groome, M. Laitinen, O. Ritvos, J.L. Juengel, Oocyte-expressed genes affecting ovulation rate, Mol. Cell. Endocrinol. 234 (2005) 57–66. [26] A.C. McPherron, S.J. Lee, GDF-3 and GDF-9: two new members of the transforming growth factor-beta superfamily containing a novel pattern of cysteines, J. Biol. Chem. 268 (1993) 3444–3449. [27] R.K. Moore, G.F. Erickson, S. Shimasaki, Are BMP-15 and GDF-9 primary determinants of ovulation quota in mammals, Trends Endocrinol. Metab. 15 (2004) 356–361. [28] P.K. Nicholls, C.A. Harrison, R.B. Gilchrist, P.G. Farnworth, P.G. Stanton, Growth differentiation factor 9 is a germ cell regulator of Sertoli cell function, Endocrinology 150 (2009) 2481–2490. [29] S. Pennetier, S. Uzbekova, C. Perreau, P. Papillier, P. Mermillod, R. Dalbies-Tran, Spatio-temporal expression of the germ cell marker genes MATER, ZAR1, GDF9, BMP15, andVASA in adult bovine tissues, oocytes, and preimplantation embryos, Biol. Reprod. 71 (2004) 1359–1366. [30] J. Roy, S. Polley, S. De, A. Mukherjee, S. Batabyal, S. Pan, B. Brahma, T.K. Datta, S.L. Goswami, Polymorphism of fecundity genes (FecB, FecX, and FecG) in the Indian Bonpala sheep, Anim. Biotechnol. 22 (2011) 151–162. [31] U.A. Vitt, E.A. McGee, M. Hayashi, A.J. Hsueh, In vivo treatment with GDF-9 stimulates primordial and primary follicle progression and theca cell marker CYP17 in ovaries of immature rats, Endocrinology 141 (2000) 3814–3820. [32] U.A. Vitt, M. Hayashi, C. Klein, A.J. Hsueh, Growth differentiation factor-9 stimulates proliferation but suppresses the follicle-stimulating hormoneinduced differentiation of cultured granulosa cells from small antral and preovulatory rat follicles, Biol. Reprod. 62 (2000) 370–377. [33] Y. Zhang, W. Zhang, H. Yang, W. Zhou, C. Hu, L. Zhang, Two cytochrome P450 aromatase genes in the hermaphrodite ricefield eel Monopterus albus: mRNA expression during ovarian development and sex change, J. Endocrinol. 199 (2008) 317–331. [34] L. Zhao, J. He, Q. Guo, X. Wen, X. Zhang, C. Dong, Expression of growth differentiation factor 9 (GDF9) and its receptor in adult cat testis, Acta Histochem. 113 (2011) 771–776.