Replacement of fish meal with soy protein concentrate in diet of juvenile rice field eel Monopterus albus

Aquaculture Reports 15 (2019) 100235

Contents lists available at ScienceDirect

Aquaculture Reports journal homepage: www.elsevier.com/locate/aqrep

Replacement of fish meal with soy protein concentrate in diet of juvenile rice field eel Monopterus albus

T

Junzhi Zhanga,b, Lei Zhonga, Mo Pengc, Wuying Chub, Zhuangpeng Liua, Zhenyan Daia, Yi Hua,⁎ a Collaborative Innovation Center for Efficient and Health Production of Fisheries in Hunan Province, College of Animal Science and Technology, Hunan Agriculture University, Changsha, 410128, PR China b Department of Bioengineering and Environmental Science, Changsha University, Changsha, 410003, PR China c College of Animal Science and Technology, Jiangxi Agricultural University, Nanchang 330045, PR China

A R T I C LE I N FO

A B S T R A C T

Keywords: Digestive enzyme Growth-related gene Serum biochemical indice Monopterus albus

Among plant protein sources, soy protein concentrate (SPC) has lower anti-nutritional factors and higher protein content. The aim of this study was to evaluate the effect of replacing fish meal in diet of rice field eel Monopterus albus with soy protein concentrate on growth performance, serum biochemical indices, intestinal digestive enzymes and growth-related genes expression in skeletal muscle. Six isonitrogen (45% crude protein) and isolipidic (5.5% crude lipid) diets were formulated with 0 g/kg, 8.5 g/kg, 17 g/kg, 25.5 g/kg, 34 g/kg and 42.5 g/kg SPC inclusion to replace 0%, 15%, 30%, 45%, 60% and 75% of fish meal (S0 (control), S8.5, S17, S25.5, S34, S42.5, respectively). Each diet was randomly assigned to triplicate groups of 100 fish per net cage (mean initial weight 25.56 ± 0.12 g). The fish were fed once at 18:00 per day for 56 days. Results showed that weight gain and feed intake significantly decreased in fish fed S42.5 (P < 0.05). Feed conversion rate was significantly higher in S34 and S42.5 groups compared to the other treatments (P < 0.05). No significant effects were found on hepatosomatic index and body composition among treatments. Viscerosomatic index significantly decreased with the increasing levels of SPC inclusion. Amylase and lipase activities in intestine peaked at S17 group. Dietary SPC supplementation significantly reduced the activities of intestine trypsin and serum glutamic oxalacetic transaminase and glutamate pyruvate transaminase as well as the content of serum triglyceride, total cholesterol, low density lipoprotein cholesterol and malondialdehyde, but significantly elevated the activities of catalase and total antioxidant capacity (P < 0.05). The superoxide dismutase activity had a rising trend compared to the control. High supplementation levels of dietary SPC down-regulated myogenic determination factor and myogenin mRNA expression, but up-regulated myostatin mRNA expression. These results suggested that fish meal could be partially replaced by SPC in diet of M. albus and the optimal supplementation level of SPC was 26% by using broken-line model curve. Replacing fish meal with dietary SPC has benefit in enhancing serum antioxidant capacity, improving serum lipid profile and modulating growth-related genes expression pattern in skeletal muscle of M. albus.

1. Introduction Fish meal is typically regarded as the main protein source in diets for aquaculture species (Lunger et al., 2007). As aquaculture production continues to increase over the last decades, the demand for FM industry expands constantly. Due to the stagnant supply of FM, however, prices will inevitably increase with demand (FAO, 2004). Replacement of FM

with cheaper plant protein sources would be beneficial in reducing the feed costs and has got wide interest globally. Soybean meal has been considered as one of the most promising alternative fish meal sources due to its availability and reasonable price (Ai and Xie, 2005). However, imbalanced amino acids profile and the presence of anti-nutritional factors have limited the use of soybean meal as a plant protein source in aquatic feed. To further exploit and

Abbreviations: IW, initial body weight; FW, final body weight; SR, survival rate; WG, weight gain; FCR, feed conversion rate; FI, feed intake; GOT, glutamic oxalacetic transaminase; GPT, glutamate pyruvate transaminase; TG, triglyceride; TC, total cholesterol; HDL-C, high density lipoprotein cholesterol; LDL-C, low density lipoprotein cholesterol; SOD, superoxide dismutase; CAT, catalase; MDA, malondialdehyde; T-AOC, total antioxidant capacity; MyoD, myogenic determination factor; Myog, myogenin; MSTN, myostatin ⁎ Corresponding author. E-mail address: [email protected] (Y. Hu). https://doi.org/10.1016/j.aqrep.2019.100235 Received 29 June 2019; Received in revised form 24 September 2019; Accepted 9 October 2019 2352-5134/ © 2019 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY license (http://creativecommons.org/licenses/BY/4.0/).

Aquaculture Reports 15 (2019) 100235

J. Zhang, et al.

develop the abundant potential protein source, more attention has been focused on soy protein concentrate (SPC), a product through aqueous ethanol or methanol extraction of solvent-extracted soybean meal. Compared to soybean meal, several anti-nutritional factors in SPC are almost inactivated through the extraction process, such as trypsin inhibitor (4 ∼ 8 mg/g versus 2 ∼ 3 mg/g protein), lectin (50 ∼ 200 ppm versus < 1 ppm), saponins (0.6% versus 0%), β-conglycinin (10 ∼ 40 mg/g versus < 0.1 mg/g), glycinin (40 ∼ 70 mg/g versus < 0.1 mg/ g), oligosacharides (15% versus < 3.5%) and beany flavor (Kaushik et al., 1995; Storebakken et al., 2000). Moreover, SPC contains high crude protein far more than soybean meal. Considerable success in partially or completely replacing fish meal with SPC without inhibiting fish growth performance has been reported in some fish species, such as black sea bream Acanthopagrus schlegelii (Ngandzali et al., 2011), seabream Sparus aurata L (Kissil et al., 2000) and Atlantic Cod Gadus morhua (Walker, 2010). During the development of skeletal muscle, four transcription factors, Myf5, myogenin, MRF4, and MyoD, play important roles in regulating genes responsible for commitment of proliferating myogenic precursor cells to the myogenic lineage and subsequent differentiation (Rescan, 2005). Myostatin (MSTN) functions as a negative regulator of skeletal muscle development and growth through inhibiting myoblast differentiation by down-regulating MyoD expression (Gabillard et al., 2013). In mammal, regulations of skeletal muscle growth by nutritional and environmental factors (photoperiod, temperature, genotype) are well demonstrated. However, such regulations have not been reported in fish, where comprehensive studies are still quite needed. Rice field eel Monopterus albus has been known as economically valuable carnivorous freshwater fish in China in virtue of commercial importance and delicious meat. Its annual yield rises to more than 386,137 tons (CFSY, 2017). At present, studies with M. albus were mainly focused on sex reversal (Chu et al., 2011; Ma et al., 2014; Qu et al., 2014; Zhang et al., 2013; Zhou et al., 2010). However, few reports on nutritional requirement have been published (Yang et al., 2003; Zhou et al., 2010; Ma et al., 2014). Our previous study indicated that M. albus can tolerate 18.6% extracted soybean meal with the replacement of 24% of fish meal, while additional soybean meal supplementation resulted in an inferior growth and feed utilization (Zhang et al., 2015). To our knowledge, the study on the SPC in M. albus have not been reported. Thus, the study was aimed to monitor the responses of M. albus to the diets containing graded levels of SPC in term of growth performance, antioxidant capacity, digestive ability and skeletal muscle growth by measuring the expression of transcription factors that govern the process of myocyte addition in the present study.

Table 1 Formulation and proximate chemical composition of the experimental diets (g/ kg dry diet). Ingredients

Fish meala Shrimp head mealb Soy protein concentratec Wheat middlingd α-starch Brewer yeast Fish oil Ca(H2PO4)2 Choline chloride Vitamin and Mineral premixe Ethoxyquin Mold inhibitor Total proximate analysis Crude protein Crude lipid Ash

Diet No. S0

S8.5

S17

S25.5

S34

S42.5

550.0 30.0 0.0 137.6 200.0 50.0 0.0 5.0 15.0 12.0 0.1 0.3

467.5 30.0 85.0 130.1 200.0 50.0 5.0 5.0 15.0 12.0 0.1 0.3

385.0 30.0 170.0 122.6 200.0 50.0 10.0 5.0 15.0 12.0 0.1 0.3

302.5 30.0 255.0 115.1 200.0 50.0 15.0 5.0 15.0 12.0 0.1 0.3

220.0 30.0 340.0 107.6 200.0 50.0 20.0 5.0 15.0 12.0 0.1 0.3

137.5 30.0 425.0 100.1 200.0 50.0 25.0 5.0 15.0 12.0 0.1 0.3

453.5 56.4 104.3

458.6 56.2 108.7

458.3 56.7 108.5

456.5 54.8 99.4

458.0 54.4 105.1

450.9 54.6 105.9

a Fish meal: crude protein 68.15% (dry matter), crude lipid 6.8% (dry matter). b Shrimp head meal: crude protein 35% (dry matter), crude lipid 6.4% (dry matter). c Soy protein concentrate: crude protein 67.26% (dry matter), crude lipid 1.3% (dry matter). d Wheat middling: crude protein 17.03% (dry matter), crude lipid 0.35% (dry matter). e Vitamin and Mineral premix provided by MGOTer Bio-Tech Co.Ltd (Qingdao, Shandong, China), Premix composition (mg/kg diet): KCl, 200 mg; KI (1%), 60 mg; CoCl2·6H2O (1%), 50 mg; CuSO4·5H2O, 30 mg; ZnSO4·H2O, 400 mg; MnSO4·H2O, 150 mg; Na2SeO3·5H2O (1%), 65 mg; MgSO4·H2O, 2000 mg; FeSO4·H2O, 400 mg; zeolite power, 3 645.85 mg; VB1, 12 mg; riboflavin, 12 mg; VB6, 8 mg; VB12, 0.05 mg; VK3, 8 mg; inositol, 100 mg; pantothenic acid, 40 mg; muriatic acid, 50 mg; folic acid, 5 mg; biotin, 0.8 mg; VA, 25 mg; VD3, 5 mg; VE, 50 mg; VC, 100 mg; ethoxyquin, 150 mg; wheat meal, 2 434.15 mg.

dough.

2.2. Experimental procedure The feeding experiment was carried out at Xihu fish farm in Changde, Hunan. Juvenile M. albus were purchased from a commercial farm (Xihu, Changde, Hunan) and reared in floating net cages (1.5 m * 2 m * 1 m) in pond (1.5 m deep) for 3 weeks to acclimate to the experimental condition. The depth of the water under the cages was 0.6 m. The cages were filled with Alternanthera philoxeroides (Mart.) Griseb to simulate the natural living conditions of wild M. albus. During the acclimatization, the fish were fed earthworm and fresh fish paste at a ratio of 1:1 for the first week. And then, the control diet was added and the earthworm and fresh fish paste decreased gradually until the fish could eat the experimental diet completely. Fish with similar size (mean initial weight 25.56 ± 0.12 g) were selected, weighted group and randomly assigned into 18 cages with 100 fish per cage. Each diet was randomly distributed to triplicate cages. Fish were fed to apparent satiation once daily by hand (18:00) for 56 days and uneaten feed was collected to calculate feed conversion rate and feed intake. Water quality parameters were assessed daily following standard methods (APHA, 1992). During the feeding trial, water temperature was 28–32 ℃, dissolved oxygen 6.3 ± 0.25 mg L−1, alkalinity 71.5 ± 6 mg L−1, ammonia nitrogen 0.47 ± 0.02 mg L−1 and pH 7.2 ± 0.5. The natural light rhythm was followed throughout the feeding trial. The experiments complied with ARRIVE guidelines and carried out in accordance with the National Institutes of Health guide for the care and use of Laboratory animals (NIH Publications No. 8023,

2. Materials and methods 2.1. Experimental diets In the present study, fish meal, shrimp head meal, SPC and wheat middling were used as protein source, α-starch as binder and carbohydrate source and fish oil as lipid source. Six isoprotein (45% crude protein) and isolipidic (5.5% crude lipid) experimental diets were formulated. In order to compare the efficiency of soybean meal and SPC in replacing fish meal in M. albus, the control diet (S0) was set to contain the same level of fish meal (55%) with our previous study on soybean meal (Zhang et al., 2015). Whereas in the other five diets, SPC were included at 8.5 g/kg, 17 g/kg, 25.5 g/kg, 34 g/kg, 42.5 g/kg to substitute 15%, 30%, 45%, 60% and 75% of fish meal at the expense of wheat middling, respectively, designed as S8.5, S17, S25.5, S34 and S42.5 (Table 1). All ingredients were ground into fine powder and sieved through a 320-μm mesh. The experimental diets were prepared by thoroughly blending the ingredients with fish oil by hand until homogenesis, and then kept in a sample bag and stored at -20 ℃ until used. Before feeding, tap water was added to the experimental diets to make soft 2

Aquaculture Reports 15 (2019) 100235

J. Zhang, et al.

concentrate, fish meal and experimental diets were hydrolyzed with 6 N HCl at 110 °C for 24 h and the chromatographic separation and analysis of the amino acids was performed after orthophthaldehyde (OPA: Sigma) derivation using reverse-phase high performance liquid chromatography (HPLC, HP1100, USA), which followed the modified procedure of Gardner and Miller (1980). While for methionine, the samples were oxidized with performic acid at −10 °C for 3 h to obtain methionine sulfone, then freeze-dried twice with deionized water. The freeze-dried ingredients were hydrolyzed and analyzed as the process of other amino acids. The serum was obtained according to Tan et al., 2007. At the end of feeding trial, blood of five fish per cage were collected from the caudal vein using a 1 ml syringe and pooled in a 10 ml centrifuge tube, and then clot at room temperature for 6 h prior to centrifugation at 5000 g for 10 min at 4 °C. The obtained serum was stored at −80 °C before the determination of blood indices (GOT, GPT, TG, TC, HDL-C, LDL-C, SOD, CAT, MDA, T-AOC) using commercial kits (Nanjing Jiancheng Biotechnic Institute, Nanjing, China). Intestinal tract of five fish per cage per cage were collected, cut into small pieces and pooled in 10 ml centrifuge tube, and stored at -80 ℃ for the analysis of the activities of trypsin, amylase and lipase according to the instruction of the commercial kits (Nanjing Jiancheng Biotechnic Institute, China). For gene expression pattern analysis, a portion of dorsal muscle in the same position was removed from five fish per cage at the end of feeding experiment. The obtained sample was immediately snap-frozen in liquid nitrogen and then stored at −80 °C until RNA extraction. Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Its purity and quantity were measured using a NanoDrop spectrophotometer and agarose gel electrophoresis. PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa, Japan) were using to synthesis cDNA. Real-time quantitative PCR was performed with CFX96™ Real-Time System (BIO-RAD, America). Each PCR reaction consisted of 12.5 μl SYBR Mix, 1 μl forward primer, 1 μl reverse primer and 1 μl cDNA as temple. Double distilled water was added to adjust the total volume of each reaction to 25 μl. The program was 95 °C for 30 s followed by 35 cycles of 95 °C for 5 s, 58 °C for 15 s and 72 °C for 20 s. Melting curve analysis of PCR products was performed at the end of each PCR reaction to confirm the specificity. The gene-specific primers were listed in Table 4. β-actin was used as a reference gene (sense primer: 5′ CCAC AGGTCA GGTGTCCCAC TATCA 3′, anti-sense primer: 5′ TGGATTCCA GCCGCCTTGAGT TCCT 3′) (Qu et al., 2015). A total volume of 20 μl PCR reaction consisted of 10 μl of SYBR Mix (TaKaRa, Japan), 0.5 μl of each primer and 3 μl of cDNA as temple.

Table 2 Total amino acid composition of fish meal and soy protein concentrate (mg/g dry matter). Total amino acid composition Amino acids

Fish meal

Soy protein concentrate

Arginine Histidine Isoleucine leucine Lysine Methionine Phenylalanine Threonine Tryptophan Valine Asparatic acid Glutamic Serine Proline Glycine Alanine Tyrosine Cysteine

36.5 17.8 24.9 47.8 42.5 16.3 24.7 26.8 7.8 30.8 55.8 82.7 25.2 34.4 45.4 40.8 16.4 5.4

48.9 15.6 32.8 60.5 38.2 9.6 37.5 26.2 9.4 33.5 78.6 145.5 38.9 41.3 36.7 29.6 24.6 9.8

revised 1987).

2.3. Sample collection and analysis At the end of feeding trial, fish were fasted for 24 h. Fish per cage were anesthetized with MS-222　(Shanghai Reagent Corp., Shanghai, China) and then group weighted and counted for the determination of survival and weight gain (WG). The liver and visceral weight of five fish per cage were recorded for calculating hepatosomatic index (HSI) and viscerosomatic index (VSI), respectively. Five fish per cage were sampled at random and frozen at −20 °C for whole body composition analysis. Chemical analysis of formulated diets and fish samples was conducted by standard methods (AOAC, 1995). Crude protein (N × 6.25) was determined by the Kjeldahl method and crude lipid by the ether-extraction method. Moisture was detected by oven drying the fish body at 105 °C till a constant weight, and crude ash was obtained by combusting at 550 °C. The amino acid composition of fish meal and SPC (Table 2) and six experiment diets (Table 3) was determined according to the method described by Mai et al. (2006). Briefly, for amino acids (except for methionine), the soy protein Table 3 Amino acid contents of experimental diets (g/100 g dry weight). AA profile

Essential amino acids Threonine Histdine Arginine Valine Methionine Leucine Phenylalanine Lysine Isoleucine Non-essential amino acids Alanine Glycine Proline Serine Aspartic acid Glutamic acid Tyrosine

2.4. Data statistics and analysis Data were analyzed using SPSS 19.0 software. Homogeneity of variances was tested using the Leven's test. Significant differences were evaluated by one-way analysis of variance (ANOVA) followed by Duncan’s multiple-range test. The relationship between the SPC

Diet No. S0

S8.5

S17

S25.5

S34

S42.5

1.59 1.30 2.05 1.96 0.90 2.87 1.37 2.88 1.50

1.62 1.26 2.15 1.98 0.83 2.94 1.42 2.92 1.55

1.60 1.22 2.23 1.98 0.75 2.97 1.59 2.84 1.57

1.56 1.17 2.31 1.96 0.67 2.98 1.67 2.66 1.59

1.58 1.14 2.44 1.96 0.62 3.04 1.76 2.63 1.62

1.54 1.09 2.50 1.96 0.55 3.06 1.88 2.57 1.65

2.56 2.28 1.55 1.36 3.36 5.30 0.53

2.51 2.24 1.60 1.49 3.56 5.73 0.59

2.40 2.16 1.65 1.55 3.69 6.03 0.60

2.28 2.05 1.72 1.52 3.78 6.21 0.60

2.19 1.99 1.79 1.64 3.97 6.60 0.64

2.08 1.90 1.84 1.64 4.09 6.84 0.65

Table 4 Real-time PCR primer sequences. Name

Primer sequences (5'-3')

Amplification efficiency

GenBank Number

Myog

F: GACCACAGCGTTGTCCAGTATG R: CTCCCACACAAGCCCATCAT F: GGCGGCTCAGCAAGGTCAAT R: GGCGGCTCAGCAAGGTCAAT F: AAAGCAGCAACAATAAGAGAAAGG R: AGAAGCCATCGTCTCGGTCA F: CTTTGGCTGGGACTGGATTATTG R: CATTATGATTGTCTCGGTGG F: AAAGAACGAGGGTTTGGACGA R: GACAGACGGTCCACGATGCT

99%

KM103288

99%

KM103286

102%

KM103287

100%

KM103284

101%

KM103285

MyoD1 MyoD2 MSTN Myf5

3

Aquaculture Reports 15 (2019) 100235

J. Zhang, et al.

Table 5 Growth performance of M. albus fed diets with different SPC levels. Parameters

a

IW FWb SRc WGd FCRe FIf VSIg HSIh

Diet No. S0

S8.5

S17

S25.5

S34

S42.5

25.48 ± 0.04 60.08 ± 0.51b 92.67 ± 3.35 131.86 ± 3.12b 2.08 ± 0.12a 2.38 ± 0.08b 20.36 ± 2.31d 6.74 ± 0.83ab

25.51 ± 0.16 59.37 ± 0.64b 96.11 ± 2.22 132.73 ± 2.65b 2.05 ± 0.08a 2.31 ± 0.12b 19.69 ± 0.33cd 7.09 ± 0.74b

25.67 ± 0.11 58.87 ± 0.11b 93.33 ± 1.92 129.34 ± 4.43b 2.06 ± 0.18a 2.32 ± 0.06b 17.82 ± 1.25b 7.15 ± 0.25b

25.63 ± 0.09 57.75 ± 0.66b 97.22 ± 0.55 125.31 ± 3.15b 2.11 ± 0.16a 2.36 ± 0.10b 19.68 ± 1.07cd 7.32 ± 0.52b

25.60 ± 0.10 56.49 ± 0.97ab 95.00 ± 2.89 120.66 ± 3.54ab 2.27 ± 0.20b 2.18 ± 0.12ab 16.22 ± 0.78a 6.14 ± 0.61a

25.47 ± 0.11 52.73 ± 1.11a 92.22 ± 3.09 110.96 ± 4.68a 2.35 ± 0.14b 1.90 ± 0.06a 18.42 ± 0.71bc 6.09 ± 0.72a

Note. Values are mean ± SEM. Values in the same row with the same superscript or absence of superscripts are not significant different by Duncan’s multiple−range test (P > 0.05). a IW: Initial body weight (g). b FW: Final body weight (g). c SR: Survival rate (%) = 100 × final number of fish / initial number of fish. d WG: Weight gain (%) = 100 × (final body weight - initial body weight) / initial body weight. e FCR: Feed conversion rate (%) = 100 × (feed fed / body weight gain). f FI: Feed intake = 100 × dry feed fed (g) × 2 / ((final body weight + initial body weight) × days of the experiment). g VSI: Viscerosomatic index (%) = 100 × (viscera weight) / (whole-body weight). h HSI: Hepatosomatic index (%) = 100 × (liver weight) / (whole-body weight).

caused no significantly changes in body composition (P > 0.05) (Table 6).

inclusion levels and weight gain were analyzed by the broken-line method. Statistical significance was set at P < 0.05 and the data are presented as means ± S.E.M (standard error of the mean).

3.2. Digestive activities 3. Results

Inclusion of SPC in diets to replace fish meal significantly attenuated trypsin activity in intestine even at the minimum replacement level (P < 0.05) (Table 7). Lipase and amylase activities significantly increased firstly and then decreased with the increasing fish meal replacement levels (P < 0.05) and peaked in S17 group.

3.1. Growth performance and body composition Survival rate ranged from 91.67% to 97.22% and was not significantly different among dietary treatments (P > 0.05) (Table 5). Fish fed S42.5 had significantly lower WG compared to that in the control (P < 0.05), whereas no significant difference were observed at or less 34% inclusion levels (P > 0.05). The broken-line model curves (Y = 129.57 + 1.13×(26-X), R2 = 0.96) indicated that the optimal inclusion level of SPC was 26% without inverse effects on the growth performance (Fig. 1). Fish fed S34 and S42.5 had significantly higher FCR compared to the other treatments. Feed intake decreased with the increasing fish meal replacement levels with SPC, but statistically significant difference was only observed in fish fed S42.5 compared to the control (P < 0.05). Viscerosomatic index was significantly lower in S34 and S42.5 in relative to the control (P < 0.05). Hepatosomatic index increased as the SPC inclusion levels increased from 0 to 25.5% and then decreased slightly (P > 0.05). Replacing dietary fish meal by SPC

3.3. Blood indices Total cholesterol, triglyceride and low density lipoprotein cholesterol concentrations in serum showed a decreased trend with the increasing of dietary SPC inclusion (Table 8). The content of TC, TG and LDL-C was significantly reduced relative to the control when SPC inclusion levels were equal or more than 8.5%, 17% and 25.5%, respectively (P < 0.05). No significantly difference on HDL-C was found among dietary treatments (P > 0.05). When the inclusion levels were equal and more than 17%, the catalase activity was significantly higher than the control (P < 0.05) and superoxide dismutase activity had a rising trend compared to the control. Total antioxidant capacity was significantly higher, but MDA content was significantly lower than that in the control group even at the minimum replacement level (P < 0.05). When the inclusion levels were equal to and above 8.5% or 17%, GPT or GOT activities significantly decreased, respectively (P < 0.05). 3.4. Growth-related muscle genes expression Given the growth performance of M. albus responding to the increasing SPC inclusion, four dietary treatments (control, S17, S34 and S42.5) were selected to assess the growth-related genes expression profile modulated by SPC in skeletal muscle of M. albus (Fig. 2). Dietary SPC inclusion replacing fish meal imposed a significant influence on the transcript levels of MyoD1, MyoD2, Myog and MSTN, but not Myf5 in muscle. There were no statistically significant differences regarding the expression of transcription factor Myf5. Myog mRNA level was significantly lower in S34 and S42.5 group than that in the control (P < 0.05), and no significant difference were observed between the control and S17 (P > 0.05). MyoD1 mRNA level significantly decreased with the dietary SPC inclusion levels up to 34% (P < 0.05), whereas

Fig. 1. Effect of different dietary soy protein concentrate (SPC) inclusion levels on weight gain (%) of rice field eel, M. albus. Each point represents the mean of three cages of fish with 100 fish per cage (n = 3). The optimal inclusion levels of dietary SPC from the broken-line regression model is 26%. Data are represented as the mean values ± SEM of three replicates. 4

Aquaculture Reports 15 (2019) 100235

J. Zhang, et al.

Table 6 Body composition of M. albus fed diets with different SPC levels (g/100 g wet weight). Parameters

S0

S8.5

S17

S25.5

S34

S42.5

Moisture Ash Crude Protein Crude Lipid

74.56 ± 2.12 2.65 ± 0.14 15.43 ± 0.75 6.84 ± 1.07

74.40 ± 0.68 2.82 ± 0.17 15.98 ± 0.39 6.64 ± 0.90

74.53 ± 0.39 2.47 ± 0.09 15.37 ± 0.32 6.74 ± 1.23

74.78 ± 1.31 2.89 ± 0.34 16.14 ± 0.69 6.69 ± 0.45

75.36 ± 2.74 2.93 ± 0.23 15.12 ± 0.86 6.54 ± 0.67

75.29 ± 1.32 2.53 ± 0.14 15.25 ± 0.17 6.41 ± 1.25

Note. Values are mean ± SEM. Values in the same row with the same superscript or absence of superscripts are not significant different by Duncan’s multiple−range test (P > 0.05). Table 7 Activities of digestive enzymes in the intestine of M. albus fed diets with different SPC levels. Parameters

S0

S8.5

S17

S25.5

S34

S42.5

Trypsin (U/mg prot) Lipase (U/g prot) Amylase (U/mg prot)

558.23 ± 66.03a 11.01 ± 0.45ab 2.78 ± 0.16ab

217.26 ± 66.56c 15.67 ± 0.95b 3.61 ± 0.47ab

183.86 ± 68.68c 22.87 ± 3.82c 5.49 ± 0.25c

310.79 ± 75.60b 13.19 ± 4.05ab 3.69 ± 0.65b

206.65 ± 19.37c 9.58 ± 1.79a 2.11 ± 0.07a

178.55 ± 30.73c 9.20 ± 3.64a 3.26 ± 0.57ab

Note. Values are mean ± SEM. Values in the same row with the same superscript or absence of superscripts are not significant different by Duncan’s multiple−range test (P > 0.05). Table 8 Some serum parameters of M. albus fed diets with different SPC levels. Parameters

GPT (U/L) GOT (U/L) TC (mmol/L) TG (mmol/L) HDL-C (mmol/L) LDL-C (mmol/L) SOD (U/mL) CAT (U/mL) MDA (nmol/mL) T-AOC (U/mL)

Diet No. S0

S8.5

S17

S25.5

S34

S42.5

181.91 ± 23.59a 458.44 ± 89.89a 3.12 ± 0.41c 0.27 ± 0.08b 2.00 ± 0.23 0.92 ± 0.24b 383.59 ± 11.3ab 6.2 ± 0.05a 15.48 ± 1.46c 5.58 ± 0.30a

103.56 ± 42.61b 352.49 ± 70.80ab 2.47 ± 0.34b 0.26 ± 0.07b 2.16 ± 0.13 0.72 ± 0.17ab 361.73 ± 16.24a 8.41 ± 0.43ab 10.3 ± 1.61ab 8.66 ± 0.04b

125.66 ± 26.95b 316.97 ± 42.92b 2.53 ± 0.27b 0.14 ± 0.01a 2.63 ± 0.49 0.74 ± 0.63ab 402.66 ± 18.56b 10.93 ± 1.04b 14.68 ± 1.67bc 10.35 ± 0.07c

128.75 ± 8.64b 232.79 ± 58.74b 2.51 ± 0.17b 0.14 ± 0.01a 1.91 ± 0.12 0.54 ± 0.11b 395.01 ± 1.32b 9.38 ± 0.09b 8.82 ± 1.43a 10.25 ± 0.06c

111.42 ± 25.71b 319.74 ± 97.53b 2.21 ± 0.23ab 0.11 ± 0.01a 2.04 ± 0.37 0.55 ± 0.46b 391.35 ± 18.15b 18.88 ± 0.01d 8.58 ± 1.12a 10.81 ± 0.02c

102.22 ± 24.52b 267.96 ± 66.85b 2.22 ± 0.15ab 0.11 ± 0.02a 1.86 ± 0.25 0.39 ± 0.09c 405.61 ± 18.49b 15.59 ± 1.87c 10.88 ± 1.18bc 8.38 ± 0.72b

Note. GPT, glutamate pyruvate transaminase; GOT, glutamic oxalacetic transaminase; TG, triglyceride; TC, total cholesterol; LDL-C, low density lipoprotein cholesterol; HDL-C, high density lipoprotein cholesterol; MDA, malondialdehyde; SOD, superoxide dismutase; CAT, catalase; T-AOC, total antioxidant capacity. Values are mean ± SEM. Values in the same row with the same superscript or absence of superscripts are not significant different by Duncan’s multiple−range test (P > 0.05).

Fig. 2. Effect of different dietary SPC inclusion levels on relative expression of growth-related genes in muscle of M. albus. (a) myogenin (Myog), (b) myostatin (MSTN), (c) Myogenic factor 5 (Myf5), (d) myogenic determination factor 1 (MyoD1), (e) myogenic determination factor 2 (MyoD2). The expression level of each gene was normalized to that of the gene encoding β-actin. Data are represented as the mean values ± SEM of three replicates. Values bearing the same letter are not significantly different by Duncan’s multiple-range test (P < 0.05).

5

Aquaculture Reports 15 (2019) 100235

J. Zhang, et al.

protein on lipid metabolism in liver and adipose tissue. Similarly, soybean meal inclusion in diet for M. albus showed a hypolipidemic effect manifested by reduced concentration of serum TC, TG and LDL-C. Torres et al. (2006) reported that soy protein reduced the insulin/glucagon ratio, in turn, induced down-regulated genes expression involving lipogenic enzymes, by which decreased serum TG, LDL-C and VLDL-TG. Furthermore, soy protein increases the bile acid secretion and stimulates the transcription factor SREBP-2 induced LDL receptor signal pathway, which is responsible for serum cholesterol clearance (Song et al., 2014). Higher inclusion levels of SPC enhanced the antioxidant capacity reflected by the increased antioxidative enzymes activities. It has been reported that the potential antioxidant effect of SPC might be related to the isoflavone component of the soybeans via up-regulation of antioxidant gene expression through activation of ERK1/2 and NF-kB pathway (Borras, 2006; Lee, 2006). On the contrary, Lopez et al. (2005) did not observed the positive effect of relatively high soy protein on plasma antioxidant capacity. The exact mechanism to explain this phenomenon deserves further investigation. Elevated activities of serum GOT and GPT are generally an indication of liver tissue injure (Hyder et al., 2013). In the present study, the decreased activities of two enzyme suggested the improved liver function in response to dietary SPC supplementation, in line with the observation in rat (Lee, 2006) and pig (Kim et al., 2007). This may be associated with the reduced oxidative damage in liver via the enhanced antioxidant capacity by SPC supplementation. Fish meal replacement by plant protein sources in fish species is a topic of concerted interest. However, the effect of plant protein sources on muscle growth have been poor studied mechanically. Plant protein mixtures and changes in indispensable amino acid / dispensable amino acids ratio largely influenced white muscle cellularity and abundance of MyoD gene expression in rainbow trout (Alami-Durante et al., 2010). Consistent with the observation in rainbow trout, high inclusion of dietary SPC increased the relative transcript abundance of MSTN and lowered the relative MyoD and Myog transcript abundance in M. albus. Supposedly, SPC inclusion substituting for fish meal might decrease the satellite cell activation, potentially influencing myocyte addition and skeletal muscle growth in M. albus. Despite this, the molecular mechanism by which SPC inclusion affect muscle growth can not be fully understood in the current study and need further studied. In conclusion, the present study revealed that up to 34% SPC inclusion in diet did not hamper growth and reduce feed utilization, and the optimal SPC inclusion level is 26%. The fish meal replacement with SPC improved blood lipid profile and enhanced the antioxidant status, and adjusted digestive enzymes, altered the expression pattern of muscle growth related genes.

there was no difference between S0 and S42.5 (P > 0.05). MyoD2 mRNA levels were significantly lower in S17, S34 and S42.5 compared to the control (P < 0.05). The lowest values in MyoD1, MyoD2 and Myog mRNA expression levels were found in S34. Conversely, the fish fed S34 and S42.5 showed a significantly higher MSTN mRNA level than the control and S17 (P < 0.05), the highest value of which was also observed in S34 group. 4. Discussion In this study, the weight gain of M. albus ranging from 110.96% to 132.73% was much lower than other studied fish species in the same period of time, while it conforms to the normal growth rhythm of M. albus under captive condition (Ma et al., 2014; Zhou et al., 2010). Results of growth performance demonstrated that SPC has the potential to substitute for fish meal in diet for M. albus and up to 34% SPC could be incorporated in diet to substitute 60% of fish meal without compromising the weight gain and feed utilization of M. albus. This observation is in accordance with the data reported previously in rain trout Oncorhynchus mykiss (Mambrini et al., 1999), turbot Scophthalmus maximus L. (Day and Plascencia-González, 2000) and black sea bream Spondyliosoma cantharus (Ngandzali et al., 2011), lower than that in Atlantic Cod Gadus morhua (Walker, 2010) and African Catfish Clarias gariepinus (Fagbenro and Davies, 2004) and higher than that in Japanese flounder Paralichthys olivaceus (Deng et al., 2006). The different conclusion on optimal SPC inclusion levels among various studies is closely related to the dietary composition and fish species. Further investigation, using broken-line model analysis of WG, we demonstrated that 26% SPC inclusion level replacing 48.53% of fish meal was optimal. As expected, M. albus more readily accepts SPC as a dietary protein source than soybean meal observed in our previous study (Zhang et al., 2015). When the SPC inclusion levels further increased, the growth performance was suppressed. This observation is in line with the study in african catfish (Fagbenro and Davies, 2004) and turbot (Day and Plascencia-González, 2000). It could be mainly ascribed to the decreased feed intake when fed high SPC diets. Studies with other fish species revealed that high fish meal replacement level with SPC reduced diet palatability, consequently decreasing feed intake and causing reduced growth (Kissil et al., 2000; Aragao et al., 2003). This phenomenon should be more applicable to M. albus due to the nature of poor vision and sensitivity to smell of M. albus. Besides, in the present experiment, amino acids analysis revealed that the content of methionine and lysine in SPC were significantly lower than that in fish meal and a decrease of nearly 31% in methionine and 11% in lysine occurred as the SPC inclusion levels increased from 0 to 34%. It has been demonstrated that an inadequate supply of amino acids is associated to reduction in protein synthesis. Supposedly, the deficiency of the two limiting amino acids decreased protein utilization, thus also affecting the growth of M. albus (Takagi et al., 2001; Deng et al., 2006). In this study, trypsin activity was detected to decrease with the increasing dietary SPC levels and positively correlated with growth performance of M. albus. This agrees well with results in sucker Myxocyprinus asiaticus (Yu et al., 2013), sturgeon Acipenser schrenckii (Xu et al., 2012) and seabass Lateolabrax japonicus (Li et al., 2012). SPC contains low levels of trypsin inhibitor or phytic acid, which could combine with trypsin to generate inactive compounds (Brown et al., 2008) or bind to alkali protein residue (Gatlin et al., 2007) respectively, reducing the activity of trypsin. The presence of phytic and the remaining trypsin inhibitor might be considered as another important factor partially accounting for the reduced growth performance of M. albus through negatively influencing the trypsin activity and feed utilization. Amylase and lipase activities were enhanced firstly and then decreased. These results suggested that M. albus might have the capacity to adapt their digestive physiology to changes in nutrition composition to some extent. It has been well established the beneficial effects of dietary soy

Declaration of Competing Interest None. Acknowledgments This work was supported by National Natural Science Foundation of China (Grant No. 31572626 and 31502175). References Ai, Q.H., Xie, X.J., 2005. Effects of replacement of fish meal by soybean meal and supplementation of methionine in fish meal/soybean meal-based diets on growth performance of the Southern catfish Silurus meridionalis. J. World Aquacult. Soc. 36, 498–507. Alami-Durante, H., Medale, F., Cluzeaud, M., Kaushik, S.J., 2010. Skeletal muscle growth dynamics and expression of related genes in white and red muscle of rainbow trout fed diets with graded levels of a mixture of plant protein sources as substitutes for fish meal. Aquaculture 303, 50–58. AOAC, 1995. Official Methods of Analysis, 16th ed. AOAC International Publishers, Arlington VA. APHA, 1992. Standard Methods for the Examination of Water and Wastewater, 18th ed.

6

Aquaculture Reports 15 (2019) 100235

J. Zhang, et al.

practical dietary protein to lipid levels on growth, digestive enzyme activities and body composition of juvenile rice field eel (Monopterus albus). Aquac. Int. 22, 749–760. Mai, K.S., Wan, J.L., Ai, Q.H., Xu, W., Liufu, A.G., Zhang, L., Zhang, C.X., Li, H.T., 2006. Dietary methionine requirement of large yellow croaker, Pseudosciaena crocea R. Aquaculture 253, 564–572. Mambrini, M., Roem, A.J., Cravèdi, J.P., Lallès, J.P., Kaushik, S.J., 1999. Effects of replacing fish meal with soy protein concentrate and of DL-methionine supplementation in high-energy, extruded diets on the growth and nutrient utilization of rainbow trout, Oncorhynchus mykiss. J. Anim. Sci. 77, 2990–2999. Ngandzali, B.O., Zhou, F., Xiong, W., Shao, Q.J., Xu, J.Z., 2011. Effect of dietary replacement of fish meal by soybean protein concentrate on growth performance and phosphorus discharging of juvenile black sea bream, Acanthopagrus schlegelii. Aquac. Nutr. 17, 526–535. Torres, N., Torre-Villalvazo, I., Tovar, A.R., 2006. Regulation of lipid metabolism by soy protein and its implication in diseases mediated by lipid disorders. J. Nutr. Biochem. 17, 365–373. Qu, X.C., Jiang, J.Y., Shang, H.L., Cheng, C., Feng, L., Liu, Q.G., 2014. Construction an analysis of gonad suppression subtractive hybridization libraries for the rice field Eel, Monpterus albus. Gene 540, 20–25. Qu, X.C., Jiang, J.Y., Cheng, C., Feng, L., Liu, Q.G., 2015. Cloning and transcriptional expression of a novel gene during sex inversion of the rice field eel (Monpterus albus). SpringerPlus 4, 745. Rescan, P.Y., 2005. Muscle growth patterns and regulation during fish ontogeny. Gen Comp. Endocr. 142, 111–116. Song, Z.D., Li, H.Y., Wang, J.Y., Li, P.Y., Sun, Y.Z., Zhang, L.M., 2014. Effects of fishmeal replacement with soy protein hydrolysates on growth performance, blood biochemistry, gastrointestinal digestion and muscle composition of juvenile starry flounder (Platichthys stellatus). Aquaculture 426-427, 96–104. Storebakken, T., Refstie, S., Ruyter, B., 2000. Soy products as fat and protein sources in fish feeds for intensive aquaculture. In: Drackley, J.K. (Ed.), Soy in Animal Nutrition. Fed Anim. Sci. Sco. Savoy, IL, USA, pp. 127–170. Tan, Q.S., He, R.G., Xie, S.Q., Xie, C.X., Zhang, S.P., 2007. Effect of dietary supplementation of vitamins A, D3, E, and C on yearling rice field eel, Monopterus albus: serum indices, gonad development, and metabolism of calcium and phosphorus. J. World Aquacult. Soc. 38, 146–153. Takagi, S., Shimeno, S., Hosokawa, H., Ukawa, M., 2001. Effect of lysine and methionine supplementation to a soy protein concentrate diet for red sea bream Pagrus major. Fisheries Sci. 67, 1088–1096. Walker, A.B., 2010. Partial replacement of fish meal with soy protein concentrate in diets of Atlantic Cod. N. Am. J. Aquacult. 72, 343–353. Xu, Q.Y., Wang, C.A., Zhao, Z.G., Luo, L., 2012. Effects of replacement of fish meal by soy protein isolate on the growth, digestive enzyme activity and serum biochemical parameters for juvenile Amur sturgeon (Acipenser schrenckii). Asian-Aust. J. Anim. Sci. 25, 1588–1594. Yang, D.Q., Yan, A.S., Chen, F., Ruan, G.L., Fang, C.Y., 2003. Effects of different diets on activities of digestive enzymes of Monopterus albus. J. Fish. China 5, 558–563. Yu, D.H., Gong, S.Y., Yuan, Y.C., Lin, Y.C., 2013. Effects of replacing fish meal with soybean meal on growth, body composition and digestive enzyme activities of juvenile Chinese sucker Myxocyprinus asiaticus. Aquacult. Nutr. 19, 84–90. Zhang, Y., Zhang, S., Liu, Z.X., Zhang, L.H., Zhang, W.M., 2013. Epigenetic modifications during sex change repress gonadotropin stimulation of Cyp19a1a in a teleost rice field eel (Monopterus albus). Endocrinology 154, 2881–2890. Zhang, J.Z., Lv, F., Huan, Z.L., Liu, Z.P., Hu, Y., Wang, P., Xie, J., 2015. Effects of fish meal replacement by different proportions of extruded soybean meal on growth performance, body composition, intestinal digestive enzyme activities and serum biochemical indices of rice filed eel (Monpterus albus). Anim. Nutr. 27, 3567–3576. Zhou, Q.B., Wu, H.D., Zhu, C.S., Yan, S.H., 2010. Effects of dietary lipids on tissue fatty acids profile, growth and reproductive performance of female rice field eel (Monopterus albus). Fish Physiol. Biochem. 37, 433–445.

American Public Health Association, Washington DC P. 1268. Aragao, C., Conceiccao, L.E.C., Dias, J., Marques, A.C., Gomes, E., Dinis, M.T., 2003. Soy protein concentrate as a protein source for Senegalese sole (Solea senegalensis Kaup 1858) diets: effects on growth and amino acid metabolism of postlarvae. Aquac. Res. 34, 1443–1452. Borras, C., 2006. Genistein, a soy isoflavone, up-regulates expression of antioxidant genes: involvement of estrogen receptors, ERK1/2, and NF-kB. FASEB J. 20, 1476–1481. Brown, P.B., Kaushik, S.J., Peres, H., 2008. Protein feedstuffs originating from soybeans. In: Lim, C., Webster, C.D., Lee, C.-S. (Eds.), Alternative Protein Sources in Aquaculture Diets. The Haworth Press, Taylor and Francis Group, New York, NY, pp. 205–223. Chu, Z.J., Wu, Y.X., Gong, S.Y., Zhang, G.B., Zhang, L., Yuan, Y.C., Yuan, H.W., 2011. Effects of estradiol valerate on steroid hormones and sex reversal of female rice field Eel, Monopterus albus. J. World Aquacult. Soc. 42, 96–104. CFSY (China Fishery Statistical Year Book) 2017. Agriculture press, Beijing, China. Day, O.J., Plascencia-González, H.G., 2000. Soy protein concentrate as a protein source for turbot Scophthalmus maximus L. Aquacult. Nutr. 6, 221–228. Deng, J.M., Mai, K.S., Ai, Q.H., Zhang, W.B., Wang, X.J., Xu, W., Liufu, Z.G., 2006. Effects of replacing fish meal with soy protein concentrate on feed intake and growth of juvenile Japanese flounder, Paralichthys olivaceus. Aquaculture 258, 503–513. Fagbenro, O.A., Davies, S.J., 2004. Use of high percentages of soy protein concentrate as fish meal substitute in practical diets for African catfish, Clarias gariepinus (Burchell 1822): growth, diet utilization, and digestibility. J. Appl. Aquac. 16, 113–124. FAO, 2004. State of World Fisheries and Aquaculture. FAO, Rome. Gabillard, J.C., Biga, P.R., Rescan, P.Y., Seiliez, I., 2013. Revisiting the paradigm of myostatin in vertebrates: insights from fishes. Gen Comp. Endocr. 194, 45–54. Gardner, W.S., Miller, W.H., 1980. Reverse-phase liquid chromatographic analysis of amino acids after reaction with Ophthaladehde. Anal. Biochem. 101, 61–70. Gatlin, D.M., Barrows, F.T., Brown, P., Dabrowski, K., Gaylord, T.G., Hardy, R.W., Herman, E., Hu, G., Krogdahl, A., Nelson, R., Overturf, K., Rust, M., Sealey, W., Skonberg, D., Souza, E.J., Stone, D., Wilson, R., Wurtele, E., 2007. Expanding the utilization of sustainable plant products in aquafeeds: a review. Aquac. Res. 38, 551–579. Hyder, M.A., Hasan, M., Mohieldein, A.H., 2013. Comparative levels of ALT, AST, ALP and GGT in liver associated diseases. Euro. J. Exp. Biol. 3, 80–284. Kaushik, S.J., Cravedi, J.P., Lalles, J.P., Sumpter, J., Fauconneau, B., Laroche, M., 1995. Partial or total replacement of fish meal by soybean protein on growth, protein utilization, potential estrogenic or antigenic effects, cholesterolemia and flesh quality in rainbow trout, Oncorhynch-us mykiss. Aquaculture 133, 257–274. Kim, Y.G., Shinde, P., Choi, J.Y., Kwon, M.S., Chae, B.J., 2007. Effect of feeding levels of microbial fermented soya protein on hematological status, plasma enzyme activity and immune cell populations in weaned pigs. Ann. Anim. Sci. 12, 26–31. Kissil, G.W., Lupatsch, I., Higgs, D.A., Hardy, R.W., 2000. Dietary substitution of soy and rapeseed protein concentrates for fish meal, and their effects on growth and nutrient utilization in gilthead seabream Sparus aurata L. Aquac. Res. 31, 595–601. Lee, J.S., 2006. Effects of soy protein and genistein on blood glucose, antioxidant enzyme activities, and lipid profile in streptozotocin-induced diabetic rats. Life Sci. 79, 1578–1584. Li, Y., Ai, Q.H., Mai, K.S., Xu, W., Deng, J.M., Cheng, Z.Y., 2012. Comparison of highprotein soybean meal and commercial soybean meal partly replacing fish meal on the activities of digestive enzymes and aminotransferases in juvenile Japanese seabass, Lateolabrax japonicus. Aquac. Res. 45 (1051-), 1060. Lopez, S.V., Yeum, K.J., Lecker, J.L., Ausman, L.M., Johnson, E.J., Devaraj, S., Jialal, I., Lichtenstein, A.H., 2005. Plasma antioxidant capacity in response to diets high in soy or animal protein with or without isoflavones. Am. J. Clin. Nutr. 81, 43–49. Lunger, A.N., McLean, E., Gaylord, T.G., Kuhn, D., Craig, S.R., 2007. Taurine supplementation to alternative dietary proteins used in fish meal replacement enhances growth of juvenile cobia (Rachycentron canadum). Aquaculture 271, 401–410. Ma, X., Hu, Y., Wang, X.Q., Ai, Q.H., He, Z.G., Feng, F.X., Lu, X.Y., 2014. Effects of

7