Visualizing primordial germ cell migration in embryos of rice field eel (Monopterus albus) using fluorescent protein tagged 3′ untranslated regions of nanos3, dead end and vasa

Comparative Biochemistry and Physiology, Part B 235 (2019) 62–69

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part B journal homepage: www.elsevier.com/locate/cbpb

Visualizing primordial germ cell migration in embryos of rice field eel (Monopterus albus) using fluorescent protein tagged 3′ untranslated regions of nanos3, dead end and vasa

T

⁎

Qing Xiaoa, Yiqing Suna, Xiao Lianga, Lihan Zhanga, Kommaly Onxayvienga, Zhong Lib, , ⁎ Dapeng Lia, a b

Hubei Provincial Engineering Laboratory for Pond Aquaculture, College of Fisheries, Huazhong Agricultural University, Wuhan 430070, China Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Wuhan 430223, China

A R T I C LE I N FO

A B S T R A C T

Keywords: Primordial germ cells Monopterus albus 3′ untranslated region nanos3 vasa dead end

In rice field eel (Monopterus albus), germ cell development in the developing gonad has been revealed in detail. However, it is unclear how primordial germ cells (PGCs) migrate to the somatic part of the gonad (genital ridge). This study visualized PGC migration by injecting a chimeric mRNA containing a fluorescent protein fused to the 3′ untranslated region (3′UTR) of three different genes, nanos3 of zebrafish (Danio rerio) and dead end (dnd) and vasa of rice field eel. The mRNAs were injected either alone or in pairs into embryos at the one-cell stage. The results showed that mRNAs containing nanos3 and dnd 3′UTRs labeled PGCs over a wider time frame than those containing vasa 3′UTR, suggesting that nanos3 and dnd 3′UTRs are suitable for visualizing PGCs in rice field eel. Using this direct visualization method, the normal migration route of PGCs was observed from the 50%-epiboly stage to hatching stage for the first time, and the ectopic PGCs were also visualized during this period in rice field eel. These findings extend our knowledge of germ cell development, and lay a foundation for further research on the relationship between PGCs and sex differentiation, and on incubation conditions for embryos in rice field eel.

1. Introduction In fish, the development of germ cells is different from that of somatic cells (Braat et al., 1999). Any abnormality in this developmental process affects the quantity and quality of gametes (Xu et al., 2010). Germ cells segregate from somatic cells and develop into primordial germ cells (PGCs) at an early stage of embryonic development. Subsequently, PGCs make a long journey from where PGCs are specified to the somatic part of the gonad (genital ridge), and then differentiate into sperms in males or eggs in females (Braat et al., 1999; Chen et al., 2013). If all PGCs do not migrate into the genital ridge, females of loach (Misgurnus anguillicaudatus) and goldfish (Carassius auratus) become infertile (Fujimoto et al., 2010; Goto et al., 2012), and females of zebrafish (Danio rerio), medaka (Oryzias latepis) and gibel carp (Carassius gibelio) transform into infertile males (Slanchev et al., 2005; Kurokawa et al., 2007; Dranow et al., 2013; Liu et al., 2015). Therefore, PGC migration is essential for germ cell development and sex differentiation. Rice field eel (Monopterus albus) is a protogynous hermaphrodite fish, which is initially female but transforms into male after first ⁎

spawning (Liu, 1944). To understand the mechanisms underlying ovarian determination and natural sex change in rice field eel, many researchers have investigated germ cell development in this species. PGCs give rise to eggs through oogonia and oocyte stages after incorporated into the genital ridge (Chan and Phillips, 1967; Xiao, 1993, 1995; He et al., 2014). Subsequently, female germ cells degenerate, while male germ cells develop at the same time. Finally, the male germ cells differentiate into sperms (Chan and Phillips, 1967; Xiao and Liu, 1995). While germ cell development in the developing gonad has been described in detail (Chan and Phillips, 1967; Xiao, 1993, 1995; Xiao and Liu, 1995; He et al., 2014), to our knowledge only two studies have been conducted on PGC migration in rice field eel, providing limited information (Xiao, 1993; He et al., 2014). Xiao (1993) observed that PGCs are located at the dorsal side of the yolk cell at the late neurula stage; this location was considered as the genital ridge. He et al. (2014) showed that PGCs are situated in dorsal mesentery at the hatching stage, and migrate to the genital ridge at one day post hatching (dph). Both these observations in rice field eel and the migration route reported in other fishes (Saito et al., 2006) suggest that PGCs migrate to the genital ridge via the dorsal part of the embryo and dorsal mesentery

Corresponding authors. E-mail addresses: lizhong@yfi.ac.cn (Z. Li), [email protected] (D. Li).

https://doi.org/10.1016/j.cbpb.2019.06.002 Received 31 January 2019; Received in revised form 25 May 2019; Accepted 3 June 2019 Available online 06 June 2019 1096-4959/ © 2019 Elsevier Inc. All rights reserved.

Comparative Biochemistry and Physiology, Part B 235 (2019) 62–69

Q. Xiao, et al.

in rice field eel. However, the actual route needs further verification. Moreover, all observations of PGCs in rice field eel have been achieved using histological analyses (Xiao, 1993; He et al., 2014), which can detect germ cells only in dead samples (Xu et al., 2010). Fish PGCs can be visualized in live embryos by injecting a chimeric mRNA containing green or red fluorescent protein (GFP or RFP) fused to the 3′ untranslated region (UTR) of a maternal germ cell gene. This is because the 3′UTR of germ cell genes determines PGC-specific gene expression. This method can provide useful information on PGCs more directly and conveniently than histological analyses (Xu et al., 2010). The 3′UTRs of nanos3 (Köprunner et al., 2001; Kurokawa et al., 2006), vasa (Lin et al., 2012; Ye et al., 2016) and dead end (dnd) (Yang et al., 2015; Sun et al., 2017) have been used to detect PGCs. Zebrafish nanos3 (previously named nanos1) 3′UTR fused to GFP has been used to label PGCs in many fishes, such as loach, Atlantic salmon (Salmo salar), Dabry's sturgeon (Acipenser dabryanus) and pond smelt (Hypomesus nipponensis) (Saito et al., 2006; Nagasawa et al., 2013; Ye et al., 2016; Takahashi et al., 2017). The aim of this work was to visualize PGC migration in live rice field eel embryos. To improve the reliability of PGC detection, the 3′UTRs of three genes (zebrafish nanos3, rice field eel vasa and dnd) were used. We developed a new technique to visualize the normal migration route of PGCs and to observe ectopic PGCs in rice field eel.

To synthesize GFP-dnd 3′UTR mRNA and GFP-vasa 3′UTR mRNA, plasmids pCS2 + EGFP-dnd 3′UTR and pCS2 + EGFP-vasa 3′UTR were constructed. According to dnd sequence that we had cloned and vasa sequence (GenBank accession no. DQ174775), dnd 3′UTR (220 bp) and vasa 3′UTR (319 bp) were amplified from the cDNA of gonad. Forward primers with an EcoRI site and reverse primers with a XhoI site were shown in Table 1. Then, the 720-bp EGFP CDS was amplified from pEGFP-N3 using a forward primer with a BamHI site and a reverse primer with an EcoRI site (Table 1). Next, the amplicons of dnd/vasa 3′UTR were digested with EcoRI and XhoI, and the amplicon of EGFP CDS was digested with BamHI and EcoRI. Finally, both the digested dnd/vasa 3′UTR and EGFP CDS were cloned into the BamHI/XhoI site of pCS2 + . To synthesize GFP-nanos3 3′UTR and RFP-nanos3 3′UTR mRNAs, the plasmid containing GFP-nanos3 3′UTR was gifted by Dr. Chuangju Li and Dr. Huan Ye (Ye et al., 2016). This plasmid was then transformed into a plasmid with RFP-nanos3 3′UTR as follows. First, 714-bp TaqRFP CDS was amplified from pT2AL200R150R using a forward primer with a BamHI site and a reverse primer with a XhoI site (Table 1). Next, the amplicon of TaqRFP CDS and the plasmid with GFP-nanos3 3′UTR were digested with both BamHI and XhoI. Finally, the TaqRFP CDS was cloned into the BamHI/XhoI site of the plasmid. To transcript the four chimeric mRNAs in vitro, the four plasmids were linearized by NotI. Capped RNAs were then synthesized in vitro with the mMESSAGE mMACHINE® SP6 kit (Ambion, USA).

2. Materials and methods 2.1. Cloning and sequence analysis of dnd

2.3. Manipulation of rice field eel

A local BLAST was carried out within transcriptome of rice field eel gonad (Chi et al., 2017) by using the coding sequence (CDS) of medaka dnd1 (GenBank accession no. NM_001164516) as a query. A highly similar sequence was acquired. After the total RNA of rice field eel gonad was purified using TRIzol Reagent (Ambion, USA), the acquired sequence was reexamined by 3′ and 5′ rapid amplification of cDNA ends (RACE) and RT-PCR. The RACE was performed using SMARTer™ RACE cDNA Amplification Kit (Clontech, USA). Primers used for RACE and RT-PCR are shown in Table 1. The complete cDNA sequence of dnd was deposited in GenBank. A sequence alignment among Dnd protein sequences was performed with BioEdit 7.1.3.0 (Holl, 1999). Six conserved regions were annotated according to the previous report (Li et al., 2016b). Identities between two amino acid sequences were acquired through pairwise alignment with a web tool EMBOSS Needle (EMBLEBI, UK).

Fertilized eggs were obtained by artificial spawning as described by Feng et al. (2017) with some modification from Aquatic Germplasm Resources Preservation and Varieties Breeding Center of Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, China, during the mating season (June–August). In brief, male fish without injection were used. The milt was obtained by separating testes and releasing milt. Then, the sperm quality was determined by microscopic examination. Only the milt containing enough active sperms was stored at 4 °C for insemination. On the other hand, the female fish were prepared by injecting with mixture of 3 mg/mL carp pituitary, 10 μg/ mL LHRH-A2 and 500 IU/mL HCG (Ningbo Sansheng Pharmaceutical Co., Ltd., Ningbo, China). Approximately forty hours later, eggs were gently pushed out, and were mixed with semen. After several minutes of incubation, intact one-cell stage embryos were used for microinjection. Subsequently, embryos were placed on net sheets stretched by plastic frames in water surface at water temperatures of 28–30 °C as previously described (Guan et al., 1996) with some changes. All experimental protocols in rice field eel were approved by the Ethics Committee of Huazhong Agricultural University.

2.2. Synthesis of chimeric mRNAs Four chimeric mRNAs were synthesized in all. GFP-dnd 3′UTR mRNA and GFP-vasa 3′UTR mRNA contained dnd 3′UTR and vasa 3′UTR from rice field eel, respectively. Both GFP-nanos3 3′UTR and RFP-nanos3 3′UTR mRNAs contained nanos3 3′UTR from zebrafish. Table 1 Primers used in this study. Name

Sequence (5′—3′)

Usage

3′RACE-dnd 5′RACE-dnd RT-dnd-F RT-dnd-R dnd-F dnd-R vasa-F vasa-R EGFP-F EGFP-R TaqRFP-F TaqRFP-R

TCGGTCAGCCACTGTATGAGGTGTCC GCTACAGTTGCTGAGCCGTATTTGGCA CCAATAGTCAGGTAACGCTGTGG ATGGTGATGGAAGTGGGTCC CGGAATTCGACCTCTTCAGATAAAAGGCAGC CCGCTCGAGCAAACAATTTAATTAAAACAAGGAACCACTCC CGGAATTCAGGGAATATTAGTTCTTATTCTTTTCAGGG CCGCTCGAGGTCATTGAAAGTATTTATTGTGATCTTGCTC CGGGATCCATGGTGAGCAAGGGCGAGGAG CGGAATTCTTACTTGTACAGCTCGTCCATG CGGGATCCATGGTGTCTAAGGGCGAAGAGC CCGCTCGAGTCAATTAAGTTTGTGCCCCAGTTTGC

RACE

63

RT-PCR Construction of plasmids

Comparative Biochemistry and Physiology, Part B 235 (2019) 62–69

Q. Xiao, et al.

2.4. Microinjection of mRNA and observation of fluorescence signals

mRNA injection did not affect embryonic development. GFP-labeled PGCs were observed in at least 44.2% of normal injected embryos but not in control embryos (Table 2). Together, these data indicate that PGCs can be visualized by injecting any one of the three chimeric mRNAs, although mRNAs containing 3′UTRs of nanos3 or dnd tag PGCs over a wider range of time compared with mRNA containing vasa 3′UTR.

One chimeric mRNA with a GFP tag (GFP-nanos3 3′UTR, GFP-dnd 3′UTR or GFP-vasa 3′UTR) was diluted to a concentration of 600 ng/μL in RNase-free water. Two chimeric mRNAs (RFP-nanos3 3′UTR and GFP-dnd 3′UTR, or RFP-nanos3 3′UTR and GFP-vasa 3′UTR) were mixed to a final concentration of 600 ng/μL for each mRNA. These mRNA preparations were injected into embryos at the one-cell stage using a micromanipulator (WCQ-2000-II, Nanjing NanDa instrument plant, China) and visualized using a stereomicroscope (SZ61, OLYMPUS, Japan). The GFP and RFP signals were observed and photographed using a LEICA M205 FA fluorescence stereomicroscope with a LEICA DFC365 FX digital camera (Leica, Germany) during embryogenesis.

3.3. Observation of PGC migration We carefully traced PGC migration. In embryos injected with GFPnanos3 3′UTR mRNA, PGCs were mainly located along both sides of the dorsal axis, and were scattered from the animal pole to blastoderm margin at the 50%-epiboly stage (1.3 dpf; Fig. 2A). PGCs then moved to the vegetal pole, and aligned within one-third of the body length near the blastopore at the blastopore-closed stage (2 dpf; Fig. 2B). At the heartbeat stage (3 dpf), PGCs migrated to the region below the embryonic body. The GFP signal in the embryonic body masked the PGCs; therefore, PGCs were invisible from the dorsal part, and could be observed only from the two sides after this stage. At this time, PGCs were loosely aligned from the middle of yolk extension to prospective cloacal aperture along the rostrocaudal axis, and between yolk extension and embryonic body along the dorsoventral axis (Fig. 2C). At 4 dpf, PGCs were closer to the dorsal trunk compared with PGCs at the heartbeat stage (3 dpf; Fig. 3A). At 6 dpf, the gut was formed, and PGCs were located above the gut (Fig. 3B). Visible PGCs rapidly diminished at 7 dpf (hatching stage; Fig. 3C), and no PGCs could be observed at 8 dpf. An identical PGC migration route was observed in embryos injected with GFP-dnd 3′UTR mRNA from 1.3 to 7 dpf (Fig. 2D–F, Fig. 3D–F), and in embryos injected with GFP-vasa 3′UTR mRNA from 4 to 7 dpf (Fig. 3G–I). In a few cases, PGCs could be detected only on one side of the embryonic body (Fig. 2D), possibly because of the uneven pervasion of injected mRNA. At 4 dpf, PGC numbers in this migration route were counted in embryos injected separately with the three mRNAs. In total, PGC numbers ranged from 1 to 32 (mean = 9.7). The PGC number not only changed significantly among embryos injected with different mRNAs (P < 0.01) but also varied greatly among embryos injected with the same mRNA (Table 3). Except for the usual places mentioned above, several labeled cells scattered at the head, yolk ball and other ectopic locations in some injected embryos (Fig. 4). Not only normally migrating PGCs but also ectopic PGCs have been identified with zebrafish nanos3 3′UTR in zebrafish (Hu et al., 2014; Lo et al., 2011) and with common carp (Cyprinus carpio) nanos 3′UTR in common carp and goldfish (Kawakami et al., 2011). Similarly, since we have proven that the labeled cells in normal migration route are PGCs in rice field eel, we think that the labeled cells scattered at ectopic locations are ectopic PGCs. At 4 dpf, the number of ectopic PGCs in 10 embryos was 1, 2, 2, 1, 3, 1, 4, 2, 2 and 5. These results suggest that the three mRNAs label not only normally migrating PGCs but also ectopic PGCs.

2.5. Statistical analyses of PGC numbers At 4 days post fertilization (dpf), 30 embryos with GFP-labeled PGCs at the normal region were randomly selected from embryos injected with each chimeric mRNA, and PGC numbers of them were counted. All data were analyzed using Excel 2016. Means and standard deviations (SD) of PGC numbers were calculated both within embryos injected with each mRNA and within all 90 embryos. After square root transformation, a significant difference among embryos injected with different mRNAs was tested by one-way analysis of variance. 3. Results 3.1. Cloning and characterization of dnd Before synthesizing chimeric mRNAs, we cloned the complete cDNA sequence of dnd from rice field eel (1585 bp; GenBank accession no. MH243448). The deduced 374-amino acid sequence showed moderate identity (30.4–70.8%) with Dnd amino acid sequences of other vertebrates. Moreover, all of the Dnd proteins were highly conserved in the N-terminal region and RNA recognition motif (Fig. 1). These data indicate that the cloned gene is the dnd homolog in rice field eel. The dnd 3′UTR (220 nt excluding the poly (A) tail) was then fused to GFP to synthesize GFP-dnd 3′UTR mRNA. 3.2. Visualization of PGCs by injecting a chimeric mRNA The chimeric mRNAs (GFP-nanos3 3′UTR, GFP-vasa 3′UTR and GFPdnd 3′UTR) were separately injected into the yolk of rice field eel embryos at the one-cell stage. Embryos not injected with any mRNA constructs were used as controls. The control embryos showed no GFP signal during embryogenesis. However, embryos injected with GFPnanos3 3′UTR mRNA ubiquitously expressed weak green fluorescence at the blastula stage. At the 50%-epiboly stage (1.3 dpf), several embryos expressed a slightly stronger fluorescence in blastodermal cells (bright cells) along both sides of the dorsal axis (Fig. 2A). Subsequently, the GFP signal in bright cells increased, and the bright cells changed their positions (Fig. 2B and C, Fig. 3A–C). Finally, these cells disappeared from view at 8 dpf (also 1 dph). The distribution of bright cells was similar to that of GFP-labeled PGCs reported in other fishes (Saito et al., 2006) during embryogenesis. These results suggest that the bright cells represent PGCs in rice field eel, and therefore are referred to as PGCs from hereon. A similar distribution of PGCs was observed in embryos injected with GFP-dnd 3′UTR mRNA from 1.3 to 7 dpf (Fig. 2D–F, Fig. 3D–F). In embryos injected with GFP-vasa 3′UTR mRNA, PGCs could not be detected before 4 dpf because of a strong GFP signal in the embryonic body and punctate GFP signals in the yolk cell (Fig. 2G–I). However, PGCs were visible from 4 to 7 dpf, as the GFP signal intensity in the embryonic body decreased (Fig. 3G–I). Moreover, the rate of normal embryos and GFP-labeled normal embryos was calculated at 4 dpf. The rate of normal embryos was similar between injected and control embryos (Table 2), indicating that

3.4. Comparison of PGC-labeling efficiency among the three 3′UTRs The number of labeled PGCs varied both among embryos injected with the same mRNA and among embryos injected with different mRNAs. Therefore, we asked whether the three mRNAs containing three different 3′UTRs could identify the same PGCs. To answer this question, co-injection of two chimeric mRNAs was performed. First, the EGFP in GFP-nanos3 3′UTR mRNA was replaced with TagRFP, thus synthesizing RFP-nanos3 3′UTR mRNA. Then, RFP-nanos3 3′UTR and GFP-dnd 3′UTR mRNAs were co-injected into the embryos. Although the relative intensity of fluorescence in PGCs (PGC vs soma) was low, the GFP and RFP-labeled PGCs were co-localized (Fig. 5A–B″). Additionally, RFP-nanos3 3′UTR mRNA was also co-injected with GFP-vasa 3′UTR mRNA. Because GFP-labeled PGCs were not visible before 4 dpf 64

Comparative Biochemistry and Physiology, Part B 235 (2019) 62–69

Q. Xiao, et al.

Fig. 1. Multiple sequence alignments of rice field eel Dnd and other vertebrate Dnds. An N-terminal region (NR), an RNA recognition motif (RRM) and four Cterminal regions (CR) are indicated above protein sequences. The NR and RRM are highly conserved among species. Identities between rice field eel Dnd and other vertebrate Dnds are shown behind the alignment. GenBank accession numbers of the other vertebrate Dnds are as follows: Thunnus orientalis AHB61249, Oryzias latipes NP_001157988, Gobiocypris rarus AIF74583, Danio rerio NP_997960, Acipenser sinensis AJC64506, Gallus gallus XP_015149022, Homo sapiens NP_919225, Xenopus tropicalis NP_001037899, Mus musculus NP_775559.

regulated by miR-430 and Dnd protein via the 3′UTR (Mishima et al., 2006; Kedde et al., 2007). Similarly, a 68-bp fragment of the nanos3 3′UTR, containing a putative Dnd target site and two noncanonical miR-430 binding sites, is related to PGC-specific expression of Nanos3 in olive flounder (Paralichthys olivaceus) (Li et al., 2016a). The putative Dnd target sites and a canonical miR-430 binding site have also been found in the nanos3 3′UTR of seven and two fishes, respectively (Škugor et al., 2014). These data indicate that miR-430 and Dnd target sites in nanos3 3′UTR play important roles in PGC-specific localization in most teleosts. Therefore, zebrafish nanos3 3′UTR should be used widely, as it will facilitate visualization of PGCs, especially in fishes whose germ cell marker genes have not been sequenced. In addition to zebrafish nanos3 3′UTR, we showed that rice field eel vasa and dnd 3′UTRs could also be used to identify PGCs in rice field eel. However, the vasa 3′UTR did not detect PGCs before 4 dpf because of high intensity of fluorescence in somatic cells. A similar phenomenon has been reported by Mishima et al. (2006) in zebrafish; embryos injected with GFP-vasa 3′UTR mRNA show higher GFP signal intensity in somatic cells than embryos injected with GFP-nanos3 3′UTR mRNA at 1 dpf. These two observations suggest that gene repression mediated by vasa 3′UTR is not as effective as that mediated by nanos3 and/or dnd 3′UTR in the soma of rice field eel and zebrafish. In zebrafish, miR-430 represses protein synthesis of Nanos3 but not that of Vasa (Wolke et al., 2002; Mishima et al., 2006; Kedde et al., 2007). Thus, different expression patterns likely result from diverse posttranscriptional regulatory mechanisms both in zebrafish and rice field eel. In addition, the co-localization of RFP- and GFP-labeled PGCs in embryos injected with

in embryos injected with GFP-vasa 3′UTR mRNA, comparison was only carried out from 4 to 7 dpf. During this period, PGCs labeled with GFP and RFP showed colocalization (Fig. 5C–C″). Thus, all three 3′UTRs showed equal efficiency to label PGCs when PGC numbers are considered. 4. Discussion To observe PGC migration in rice field eel embryos in vivo, chimeric mRNAs comprising GFP or RFP-labeled 3′UTRs of nanos3, dnd or vasa were injected into embryos. The 3′UTRs of all the three genes detected PGCs in rice field eel. Both normal and aberrant migration of PGCs were observed during embryonic development using this method. 4.1. Visualization of rice field eel PGCs by injecting fluorophore-labeled mRNA The zebrafish nanos3 3′UTR has been used to visualize PGCs in more than ten species of ancient and modern fish (Saito et al., 2006; Saito et al., 2011; Nagasawa et al., 2013; Linhartova et al., 2014; Saito et al., 2014; Ye et al., 2016; Sun et al., 2017; Takahashi et al., 2017). In this study, we tested whether this 3′UTR functions in rice field eel. The GFPlabeled nanos3 3′UTR tagged PGCs in rice field eel from the 50%-epiboly stage (1.3 dpf) to hatching stage (7 dpf). This result further confirms the versatility of zebrafish nanos3 3′UTR. This versatility is likely due to the high conservation of cis-regulatory elements in nanos3 3′UTR among fishes. In zebrafish, the PGC-specific expression of Nanos3 is co65

Comparative Biochemistry and Physiology, Part B 235 (2019) 62–69

Q. Xiao, et al.

Fig. 2. PGCs are labeled by GFP-nanos3 3′UTR and GFP-dnd 3′UTR mRNAs but not by GFP-vasa 3′UTR mRNA from the 50%-epiboly stage (1.3 dpf) to heartbeat stage (3 dpf). (A–C) Embryos injected with GFP-nanos3 3′UTR mRNA. (D–F) Embryos injected with GFP-dnd 3′UTR mRNA. (G–I) Embryos injected with GFP-vasa 3′UTR mRNA. (A, D and G) Dorsal views of 50%-epiboly stage embryos, animal pole upward. (B, E and H) Dorsal views of blastopore-closed stage embryos, animal pole upward. (C, F and I) Lateral views of heartbeat stage embryos. (A′, A″, B′, C′, C″, D′, D″, E′, F′ and F″) The high-magnification images of the corresponding boxed region in (A–F). Arrows indicate GFP-labeled PGCs. Scale bars in (A–I), 0.5 mm; scale bars in (A′, A″, B′, C′, C″, D′, D″, E′, F′ and F″), 0.25 mm.

two chimeric mRNAs further confirms that the fluorophore-labeled bright cells represent PGCs in rice field eel. This co-localization pattern also suggests that the three 3′UTRs label PGCs with equal efficiency, when considering the PGC number. Overall, based on the duration of PGC visualization and the number of labeled PGCs, chimeric mRNAs

containing either nanos3 or dnd 3′UTR are more appropriate than vasa 3′UTR for visualizing PGCs in rice field eel. Moreover, our findings demonstrate a more direct and simple method for monitoring dynamic changes in PGCs in rice field eel than histological analysis. Although we established a new method for PGC visualization in rice

Fig. 3. PGCs are identified by all the three mRNAs from 4 to 7 dpf (hatching stage). Lateral views of 4 (A, D and G), 6 (B, E and H) and 7 (C, F and I) dpf embryos. Embryos were injected with GFP-nanos3 3′UTR (A–C), GFP-dnd 3′UTR (D–F) or GFP-vasa 3′UTR (G–I) mRNA. The dashed boxes indicate regions containing PGCs, and the high-magnification images of the regions are shown in the lower right corner of each panel. Arrowheads in (A, D and G) indicate yolk extension, and arrows in (B, E and H) indicate gut. Scale bars, 0.5 mm. 66

Comparative Biochemistry and Physiology, Part B 235 (2019) 62–69

Q. Xiao, et al.

distinguish the blastodisc from the yolk cell in rice field eel. Although we injected an adequate volume of solution into all embryos, it was unclear if the solution was injected into the blastodisc or the yolk just under the blastodisc. In addition, the diameter of rice field eel yolk cell (3.2–3.8 mm) (Guan et al., 1996) is approximately six times longer than that of zebrafish yolk cell (0.5–0.7 mm) (Kimmel et al., 1995). Therefore, if the mRNA was injected at a distant location relative to the blastodisc, the mRNA may not have been transported into the blastodisc, where the PGCs are formed. It has been reported that mRNAs are also difficult to inject and/or transport into the blastodisc of Japanese eel and barfin flounder because of the nature of the embryos (Saito et al., 2011; Goto et al., 2015). Thus, difficulties related to the entry of mRNA in the blastodisc are a common feature of the three fishes, and this common feature is probably responsible for the low rate of embryos with labeled PGCs. To increase this rate, the injection technique needs improvement in rice field eel.

Table 2 The number of normal embryos and the number of normal embryos with labeled PGCs at 4 dpf. Injected mRNA

Group

Number of embryos

Number of normal embryos (%)

Number of normal embryos with labeled PGCs (%)

GFP-nanos3 3′UTR GFP-dnd 3′UTR

Control Injected Control Injected Control Injected

126 147 143 183 150 148

94 (74.6) 109 (74.1) 86 (60.1) 104 (56.8) 126 (84.0) 121 (81.8)

0 56 (51.4) 0 46 (44.2) 0 84 (69.4)

GFP-vasa 3′UTR

Table 3 The number of PGCs at the normal region at 4 dpf.a Injected mRNA

GFP-nanos3 3′UTR GFP-dnd 3′UTR GFP-vasa 3′UTR Total

PGC number Mean

SD

Range

7.1 10.1 12.0 9.7

4.9 5.0 7.3 6.1

1–18 3–19 3–32 1–32

4.2. Migration route of PGCs in rice field eel embryos The migration route of rice field eel PGCs was observed and recorded in this study. PGCs were observed along both sides of the dorsal axis at the 50%-epiboly stage. Then, the PGCs moved to the vegetal pole with epiboly. After the blastopore-closed stage, the tail formation was initiated, and PGCs migrated posteriorly in the region between the yolk extension and embryonic body. At 6 and 7 dpf, PGCs were situated in the upper part of the newly formed gut. He et al. (2014) have revealed that PGCs are located in dorsal mesentery on the day before PGCs reach the genital ridge. Thus, the upper part of gut and the dorsal mesentery seem to represent the same location. Additionally, the number of visible PGCs decreased at 7 dpf, resulting in zero visible PGCs at 8 dpf. This decline in the number of visible PGCs might be due to the degradation of exogenous mRNA or masking by surrounding tissues, such as the genital ridge. To explain this phenomenon, sectioning of embryos is

a In embryos injected with each mRNA, 30 embryos with labeled PGCs at normal region were randomly selected. SD, standard deviation.

field eel, the rate of embryos with labeled PGCs was low (44.2–69.4%) compared with the rates in most other fishes including medaka and zebrafish (97.7–100%) (Saito et al., 2006). However, this low efficiency is comparable with the efficiency in Japanese eel (Anguilla japonica, 33.3–71.4%) (Saito et al., 2011) and barfin flounder (Verasper moseri, 16.7–71.4%) (Goto et al., 2015). In this study, we noticed that the blastodisc is very small relative to the yolk cell; therefore, it is hard to

Fig. 4. Ectopic PGCs are marked by all the three mRNAs at 4 dpf. Lateral views of embryos injected with GFP-nanos3 3′UTR (A–B′), GFP-dnd 3′UTR (C–C″) and GFPvasa 3′UTR (D–D″) mRNA. (A–D) The dashed boxes indicate regions with ectopic PGCs. (A′, B′, C′, C″, D′ and D″) The high-magnification images of the corresponding boxed region in (A–D). Arrows indicate ectopic PGCs. The ectopic PGCs are located at the head (A′, C′), trunk (D′), yolk ball (B′, C″), and tail muscle (C″, D″). Y, yolk ball; T, tail muscle. Scale bars, 0.5 mm. 67

Comparative Biochemistry and Physiology, Part B 235 (2019) 62–69

Q. Xiao, et al.

Fig. 5. GFP-labeled and RFP-labeled PGCs are co-localized in co-injected embryos. (A–B″) Dorsal views of a blastopore-closed stage embryo (A–A″) and lateral views of a 4 dpf embryo (B–B″) co-injected with GFP-dnd 3′UTR and RFP-nanos3 3′UTR mRNAs. (C–C″) Lateral views of a 4 dpf embryo co-injected with GFP-vasa 3′UTR and RFP-nanos3 3′UTR mRNAs. Because GFP-vasa 3′UTR mRNA was unable to mark PGCs before 4 dpf, embryos were not photographed before 4 dpf. (A–C″) The dashed boxes indicate regions containing PGCs, and the high-magnification images of the regions are shown in the lower right corner of each panel. Scale bars, 0.5 mm.

needed. Nevertheless, our in vivo analysis of rice field eel embryos is sufficient to confirm our speculation that PGCs migrate through the dorsal part of the embryo and dorsal mesentery, before arriving at the genital ridge. Generally, the migration route of PGCs in rice field eel is similar to those in other fishes (Saito et al., 2006). However, during late embryogenesis, the alignment of PGCs in rice field eel is much looser than those in other fishes. To date, a similar distribution pattern has been reported only in Japanese eel (Saito et al., 2011). This loose distribution is possibly related to the elongated bodies and gonads of both fishes. The results of PGC migration improve our understanding of germ cell development in rice field eel, and provide basic information for studying the relationship between PGCs and sex differentiation in rice field eel. The injection of chimeric mRNAs helped visualize PGC migration from the 50%-epiboly stage to hatching stage. The 50%-epiboly stage is earlier than the earliest stage at which PGCs have been observed by histochemistry (Xiao, 1993). Moreover, the hatching stage is a day before the arrival of PGCs at the genital ridge (He et al., 2014). Thus, most of PGC migration can be monitored in rice field eel by injecting a chimeric mRNA. Nevertheless, the PGCs were invisible from the dorsal part after the heartbeat stage because of bright fluorescence signal in the embryonic body. Dorsal views in other fishes have shown that PGCs at both sides of the trunk eventually migrate axially and assemble under the trunk (Saito et al., 2006; Linhartova et al., 2014; Li et al., 2015; Takahashi et al., 2017). PGCs in rice field eel probably migrate in a similar manner. Details of the migration route need further confirmation using histological sections in future studies.

unfavorable environmental factors were responsible for ectopic PGCs in rice field eel. Thus, the rate of ectopic PGCs would be used to evaluate incubation conditions in rice field eel. Proper PGC migration is essential to germ cell development (Xu et al., 2010). Most ectopic PGCs are finally eliminated by apoptosis (Stallock et al., 2003; Runyan et al., 2006). Therefore, the lower rate of ectopic PGCs implies more suitable conditions for germ cell development. Appropriate incubation conditions for rice field eel embryos have been explored for more than 10 years. These conditions have been assessed primarily based on hatching rates and survival rates (Yin et al., 2004; Zhou et al., 2006; Yin and Liu, 2010). While traditional parameters focus on the number of fries, introducing the rate of ectopic PGCs may ensure the quantity and quality of gametes during aquaculture.

5. Conclusion To our knowledge, this is the first time that PGC migration in rice field eel embryos has been observed by injecting chimeric mRNAs. Both GFP-nanos3 3′UTR and GFP-dnd 3′UTR mRNAs have been proven suitable for PGC visualization in rice field eel. These results enhance our understanding of the reproductive biology of rice field eel, and facilitate further research on the development of PGCs, relationship between PGCs and sex differentiation, and incubation conditions for embryos in rice field eel.

Acknowledgments 4.3. Ectopic PGCs in rice field eel embryos

This work was supported by the National Natural Science Foundation of China [grant numbers 31772823] and the Fundamental Research Funds for the Central Universities [project numbers 2662015PY119]. We thank Dr. Chuangju Li and Dr. Huan Ye in the Yangtze River Fisheries Research Institute for gifting us the plasmid containing GFP-nanos3 3′UTR. We also thank Dr. Yu Gao for his assistance in English writing and organization of this manuscript.

We also observed several labeled PGCs at the head, yolk ball and other ectopic places in rice field eel. Previous studies have shown that some harmful environmental factors lead to ectopic PGCs but do not affect embryonic development in zebrafish. These factors include hypoxia (Lo et al., 2011) and water contaminated with nonylphenol (Willey and Krone, 2001) and 17alpha-ethinylestradiol (Hu et al., 2014). Given this information, it is reasonable to speculate that similar 68

Comparative Biochemistry and Physiology, Part B 235 (2019) 62–69

Q. Xiao, et al.

Conflict of interest

(Pagrus major). Int. J. Biol. Sci. 8, 882–890. Linhartova, Z., Saito, T., Psenicka, M., 2014. Embryogenesis, visualization and migration of primordial germ cells in tench (Tinca tinca). J. Appl. Ichthyol. 30, 29–39. Liu, C., 1944. Rudimentary hermaphroditism in the symbranchoid eel. Monopterus Javanensis. Sinensia 15, 1–8. Liu, W., Li, S., Li, Z., Wang, Y., Li, X., Zhong, J., Zhang, X., Zhang, J., Zhou, L., Gui, J., 2015. Complete depletion of primordial germ cells in an all-female fish leads to sexbiased gene expression alteration and sterile all-male occurrence. BMC Genomics 16, 1–15. Lo, K.H., Hui, M.N.Y., Yu, R.M.K., Wu, R.S.S., Cheng, S.H., 2011. Hypoxia impairs primordial germ cell migration in zebrafish (Danio rerio) embryos. PLoS One 6, e24540. Mishima, Y., Giraldez, A.J., Takeda, Y., Fujiwara, T., Sakamoto, H., Schier, A.F., Inoue, K., 2006. Differential regulation of germline mRNAs in soma and germ cells by zebrafish miR-430. Curr. Biol. 16, 2135–2142. Nagasawa, K., Fernandes, J.M.O., Yoshizaki, G., Miwa, M., Babiak, I., 2013. Identification and migration of primordial germ cells in Atlantic salmon, Salmo salar: characterization of Vasa, Dead End, and Lymphocyte antigen 75 genes. Mol. Reprod. Dev. 80, 118–131. Runyan, C., Schaible, K., Molyneaux, K., Wang, Z., Levin, L., Wylie, C., 2006. Steel factor controls midline cell death of primordial germ cells and is essential for their normal proliferation and migration. Development. 133, 4861–4869. Saito, T., Fujimoto, T., Maegawa, S., Inoue, K., Tanaka, M., Arai, K., Yamaha, E., 2006. Visualization of primordial germ cells in vivo using GFP-nos1 3′UTR mRNA. Int. J. Dev. Biol. 50, 691–700. Saito, T., Goto-Kazeto, R., Kawakami, Y., Nomura, K., Tanaka, H., Adachi, S., Arai, K., Yamaha, E., 2011. The mechanism for primordial germ-cell migration is conserved between Japanese eel and zebrafish. PLoS One 6, e24460. Saito, T., Pšenička, M., Goto, R., Adachi, S., Inoue, K., Arai, K., Yamaha, E., 2014. The origin and migration of primordial germ cells in sturgeons. PLoS One 9, e86861. Škugor, A., Slanchev, K., Torgersen, J.S., Tveiten, H., Andersen, Ø., 2014. Conserved mechanisms for germ cell-specific localization of nanos3 transcripts in teleost species with aquaculture significance. Mar. Biotechnol. 16, 256–264. Slanchev, K., Stebler, J., de la Cueva-Méndez, G., Raz, E., 2005. Development without germ cells: the role of the germ line in zebrafish sex differentiation. Proc. Natl. Acad. Sci. U. S. A. 102, 4074–4079. Stallock, J., Molyneaux, K., Schaible, K., Knudson, C.M., Wylie, C., 2003. The proapoptotic gene Bax is required for the death of ectopic primordial germ cells during their migration in the mouse embryo. Development. 130, 6589–6597. Sun, Z., Zhou, L., Li, Z., Liu, X., Li, S., Wang, Y., Gui, J., 2017. Sexual dimorphic expression of dnd in germ cells during sex reversal and its requirement for primordial germ cell survival in protogynous hermaphroditic grouper. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 208-209, 47–57. Takahashi, E., Shimizu, Y., Urushibata, H., Kawakami, Y., Arai, K., Yamaha, E., 2017. Migration behavior of PGCs and asymmetrical gonad formation in pond smelt Hypomesus nipponensis. Int. J. Dev. Biol. 61, 397–405. Willey, J.B., Krone, P.H., 2001. Effects of endosulfan and nonylphenol on the primordial germ cell population in pre-larval zebrafish embryos. Aquat. Toxicol. 54, 113–123. Wolke, U., Weidinger, G., Köprunner, M., Raz, E., 2002. Multiple levels of posttranscriptional control lead to germ line-specific gene expression in the zebrafish. Curr. Biol. 12, 289–294. Xiao, Y., 1993. Study on the reproductive biology of Monopterus albus (Zuiew) I. Early gonadogenesis and structure change in Monopterus albus. J. Nat. Sci. Hunan Norm. Univ. 16, 346–349 (in Chinese). Xiao, Y., 1995. Study on the reproductive biology of Monopterus albus (Zuiew) II. Female development of Monopterus albus. J. Nat. Sci. Hunan Norm. Univ. 18, 45–51 (in Chinese). Xiao, Y., Liu, Y., 1995. Study on the histology in sex changing from intersex to male of Monopterus albus (Zuiew). J. Fish. China 19, 297–304 (in Chinese). Xu, H., Li, M., Gui, J., Hong, Y., 2010. Fish germ cells. Sci. China Life Sci. 53, 435–446. Yang, X., Yue, H., Ye, H., Li, C., Wei, Q., 2015. Identification of a germ cell marker gene, the dead end homologue, in Chinese sturgeon Acipenser sinensis. Gene 558, 118–125. Ye, H., Yue, H., Yang, X., Li, C., Wei, Q., 2016. Identification and sexually dimorphic expression of vasa isoforms in Dabry′s sturgeon (Acipenser dabryanus), and functional analysis of vasa 3′-untranslated region. Cell Tissue Res. 366, 203–218. Yin, S., Liu, Y., 2010. Compositions and functions of the hatching froth from ricefield eel (Monopterus albus Zuiew). Fish Physiol. Biochem. 36, 195–200. Yin, S., Zhou, G., Liu, Y., 2004. Effect of different ecological factors on ricefield eel (Monopterus albus) hatching rate. Chin. J. Appl. Ecol. 15, 734–736 (in Chinese). Zhou, Q., Jin, S., Wu, X., Zhang, Y., Yang, F., Wu, F., 2006. Effects of the water depth and illumination on the hatching rate of zygote of rice field eel (Monopterus albus). Fresh Water Fish 36, 31–33 (in Chinese).

The authors declare no conflict of interests. References Braat, A.K., Speksnijder, J.E., Zivkovic, D., 1999. Germ line development in fishes. Int. J. Dev. Biol. 43, 745–760. Chan, S.T.H., Phillips, J.G., 1967. The structure of the gonad during natural sex reversal in Monopterus albus (Pisces: Teleostei). Proc. Zool. Soc. London 151, 129–141. Chen, J., Hu, W., Zhu, Z., 2013. Progress in studies of fish reproductive development regulation. Sci. Bull. 58, 7–16. Chi, W., Gao, Y., Hu, Q., Guo, W., Li, D., 2017. Genome-wide analysis of brain and gonad transcripts reveals changes of key sex reversal-related genes expression and signaling pathways in three stages of Monopterus albus. PLoS One 12, e0173974. Dranow, D.B., Tucker, R.P., Draper, B.W., 2013. Germ cells are required to maintain a stable sexual phenotype in adult zebrafish. Dev. Biol. 376, 43–50. Feng, K., Luo, H., Li, Y., Chen, J., Wang, Y., Sun, Y., Zhu, Z., Hu, W., 2017. High efficient gene targeting in rice field eel Monopterus albus by transcription activator-like effector nucleases. Sci. Bull. 62, 162–164. Fujimoto, T., Nishimura, T., Goto-Kazeto, R., Kawakami, Y., Yamaha, E., Arai, K., 2010. Sexual dimorphism of gonadal structure and gene expression in germ cell-deficient loach, a teleost fish. Proc. Natl. Acad. Sci. U. S. A. 107, 17211–17216. Goto, R., Saito, T., Takeda, T., Fujimoto, T., Takagi, M., Arai, K., Yamaha, E., 2012. Germ cells are not the primary factor for sexual fate determination in goldfish. Dev. Biol. 370, 98–109. Goto, R., Saito, T., Kawakami, Y., Kitauchi, T., Takagi, M., Todo, T., Arai, K., Yamaha, E., 2015. Visualization of primordial germ cells in the fertilized pelagic eggs of the barfin flounder Verasper moseri. Int. J. Dev. Biol. 59, 465–470. Guan, R., Zhou, L., Cui, G., Feng, X., 1996. Studies on the artificial propagation of Monopterus albus (Zuiew). Aquac. Res. 27, 587–596. He, Z., Li, Y., Wu, Y., Shi, S., Sun, C., Deng, Q., Xie, J., Wang, T., Zhang, W., Zhang, L., 2014. Differentiation and morphogenesis of the ovary and expression of gonadal development-related genes in the protogynous hermaphroditic ricefield eel Monopterus albus. J. Fish Biol. 85, 1381–1394. Holl, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98. Hu, J., Sun, S., Guo, M., Song, H., 2014. Use of antagonists and morpholinos in loss-offunction analyses: estrogen receptor ESR2a mediates the effects of 17alpha-ethinylestradiol on primordial germ cell distribution in zebrafish. Reprod. Biol. Endocrinol. 12, 40. Kawakami, Y., Saito, T., Fujimoto, T., Goto-Kazeto, R., Takahashi, E., Adachi, S., Arai, K., Yamaha, E., 2011. Visualization and motility of primordial germ cells using green fluorescent protein fused to 3′UTR of common carp nanos-related gene. Aquaculture 317, 245–250. Kedde, M., Strasser, M.J., Boldajipour, B., Vrielink, J.A.F.O., Slanchev, K., le Sage, C., Nagel, R., Voorhoeve, P.M., van Duijse, J., Ørom, U.A., Lund, Anders H., Perrakis, A., Raz, E., Agami, R., 2007. RNA-binding protein Dnd1 inhibits microRNA access to target mRNA. Cell 131, 1273–1286. Kimmel, C.B., Ballard, W.W., Kimmel, S.R., Ullmann, B., Schilling, T.F., 1995. Stages of embryonic development of the zebrafish. Dev. Dyn. 203, 253–310. Köprunner, M., Thisse, C., Thisse, B., Raz, E., 2001. A zebrafish nanos-related gene is essential for the development of primordial germ cells. Genes Dev. 15, 2877–2885. Kurokawa, H., Aoki, Y., Nakamura, S., Ebe, Y., Kobayashi, D., Tanaka, M., 2006. Timelapse analysis reveals different modes of primordial germ cell migration in the medaka Oryzias latipes. Dev., Growth Differ. 48, 209–221. Kurokawa, H., Saito, D., Nakamura, S., Katoh-Fukui, Y., Ohta, K., Baba, T., Morohashi, K.i., Tanaka, M., 2007. Germ cells are essential for sexual dimorphism in the medaka gonad. Proc. Natl. Acad. Sci. U. S. A. 104, 16958–16963. Li, M., Tan, X., Jiao, S., Wang, Q., Wu, Z., You, F., Zou, Y., 2015. A new pattern of primordial germ cell migration in olive flounder (Paralichthys olivaceus) identified using nanos3. Dev. Genes Evol. 225, 195–206. Li, M., Tan, X., Sui, Y., Jiao, S., Wu, Z., You, F., 2016a. Conserved elements in the nanos3 3′UTR of olive flounder are responsible for the selective retention of RNA in germ cells. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 198, 66–72. Li, S., Liu, W., Li, Z., Wang, Y., Zhou, L., Yi, M., Gui, J., 2016b. Molecular characterization and expression pattern of a germ cell marker gene dnd in gibel carp (Carassius gibelio). Gene 591, 183–190. Lin, F., Liu, Q., Li, M., Li, Z., Hong, N., Li, J., Hong, Y., 2012. Transient and stable GFP expression in germ cells by the vasa regulatory sequences from the red seabream

69