Heterologous protein secretion directed by a repressible acid phosphatase system of Aspergillus niger

Gene, 132 (1993) 193-198 0 1993 Elsevier Science Publishers

B.V. All rights reserved.

193

0378-l 119/93/%06.00

GENE 07297

Heterologous protein secretion directed by a repressible acid phosphatase system of Aspergillus niger (Recombinant DNA; human interferon 1x2;phosphate regulation; pH regulation; secretion; signal sequence)

W. Donald MacRae *, Frank P. Buxton *, David I. Gwynne * and R. Wayne Davies Allelix Biopharmaceuticals Inc., 6850 Goreway Drive, Mississauga, Ontario, L4V lP1, Canada Received by J.R. Kinghorn:

19 June 1992; Revised/Accepted:

16 March/28

March

1993; Received at publishers:

24 May 1993

SUMMARY

A new expression-secretion system of Aspergillus niger which directs the secretion of heterologous proteins is described. The promoter and signal peptide-encoding region of the phosphate-repressible aphA gene of A. niger, when fused to the coding region of the human interferon u.2 (hIFNa2)-encoding gene (hlFNc~2), drives the expression of this gene and the secretion of the hIFNcl2 protein. Synthesis of hIFNa2 in either A. niger or A. nidulans transformants carrying these constructs was regulated by inorganic phosphate (Pi) present in the medium, so that derepression of heterologous protein expression can be attained by lowering Pi concentration.

INTRODUCTION

The ability of industrially developed strains of certain filamentous fungi to secrete large quantities of protein, and the existence of technology for their large scale growth, continue to elicit interest in their potential for large scale heterologous protein production. A key element in any expression system is the promoter. A. niger is in widespread use in industry (Barbesgaard, 1977), yet -Correspondence to: Dr. R.W. Davies, at his present address: Robertson Institute for Biotechnology, Department of Genetics, University of Glasgow, Church St., Glasgow, Gil 5JS, UK. Tel. (44-41) 339-8855, ext. 5102; Fax (44-41) 330 4878. *Present addresses: (W.D.MacR.) Allelix Crop Technologies, 6850 Goreway Dr., Mississauga, Ontario, L4V lP1, Canada. Tel. (416) 6770830; (F.P.B.) Biotechnology Division, Ciba-Geigy, Basel, Switzerland. Tel. (41-61) 696-1661; and (D.I.G.) Cambridge Neuroscience Inc., 1 Kendall Square, Building 700, Cambridge, MA 02139, USA. Tel. (617) 225-0600. Abbreviations: A., Aspergillus; Ap, ampicillin; APase, acid phosphatase; uphA, A. niger gene encoding phosphate-repressible APase; bp, base pair(s); hIFN, human interferon; kb, kilobase or 1000 bp; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; Pi, inorganic medium, low-phosphate medium; R, resistant/resistance; tide; u, unit(s).

phosphate; - P SP, signal pep-

few expression systems have been developed using A. niger regulatory components, since the early and successful use of the glaA (glucoamylase) promoter of A. niger (Cullen et al., 1987; Gwynne et al., 1987; Ward 1991) and the subsequent use of a set of A. nidulans promoters. The availability of a variety of A. niger based expression systems is desirable, both from a commercial and a research standpoint. The repressible uphA gene encoding a secreted APase has been cloned and sequenced (MacRae et al., 1988), and has all the features required as the basis of an alternative expression system for the secretion of heterologous proteins from A. niger. Key features of this system are that the regulatory genes for both Pi and pH regulation have been identified genetically (Caddick and Arst, 1986), and that expression can be turned on by the simple and cheap procedures of either lowering the Pi concentration in the medium at low pH (4.5 to 5.5), or by lowering the pH of the medium under conditions of Pi limitation. The aim of this study was to use the regulatory elements and secretion signal of the secreted APase encoded by the repressible uphA gene of A. niger to develop a regulatable secretion system for heterologous proteins, using hIFNa2 as a model protein.

194 RESULTSANDDISCUSSION (a) Vector construction

MacRae et al. (1988) defined a short upstream region of the A. niger aphA gene which contained the c&acting regulatory elements. A DNA fragment containing this region and the region encoding the SP of the APase was fused to the hiFNct2 coding region. The detailed steps involved in the construction of the two A. niger uphAhlFNcr2 fusion vectors used in these experiments are described in the legend to Fig. 1. pACIF1 encodes a fusion protein with both the presumed SP cleavage site of the A. niger repressible acid phosphatase and that of

A

pAcrr2

C

puxT2

. .TccMcTch~

the hIFNa2 protein. A short intervening in-frame region is an artifact of the cloning procedure (Fig. IB). This intervening region and the partial SP-coding region of the hlFNct2 gene up to the SP cleavage site were removed by in vitro mutagenesis, so that the hybrid protein encoded by pACIF2 consists of the putative SP of the A. niger APase encoded by aphA fused directly to the entire mature hIFNa2 protein. No Aspergillus transcriptional termination cassette was included in these constructs, since previous experience with hZFNcr2 constructs (Gwynne et al., 1987; Davies, 1991) had shown that the hZFNa2 message contained a sequence that determined efficient termination in Aspergillus.

TQCTGCTTCTGCCCTGCTTATCGCQCTCTCC ~tLY8Ql~~8&~~~UIl~8~Us~r

ATQCTCCT

TCTCTCTTTTCTCCTGCT...

~t~~rJU8OlnIl~~t&uP~8~rCy8~ULY~~...

f

S

160 53

Fig. 1. Construction of expression vectors. The position of the SP cleavage site in the A. niger APase encoded by aphA was predicted to be Ala”‘_. Arg” by the method of von Heijne (1986). Plasmid pFB50 (MacRae et al., 1988) which contains the entire aphA gene of A. niger was digested with XbaI+ BglI. A 615-bp fragment comprising the aphA promoter and the first 19 codons of the aphA gene was ligated to a I-kb BssHII-EcoRI fragment from pGL2BIFN (Gwynne et al., 1987), which contained the human hZFNa2 gene (using a pair of oligos as a EglI/EssHII adaptor) and cloned between the XbaI and Hind111 sites of pTZ18R (Pharmacia), thereby creating pACIF0. A 2.2-kb XbaI fragment from pBB116 (Berse et al., 1983) which contains the A. nidulans argB gene was inserted at the XbaI site of pACIF0, generating pACIF1 (Fig. 1B). Oligo-directed mutagenesis was carried out on pACIF1 to remove 51 bp between the putative SP cleavage site of aphA and the region of the hlFNa2 gene encoding the mature (cleaved) hIFNa2, generating pACIF2 (Fig. IA and C). The nt sequence deleted encoded two aa from the N-terminal end of mature APase, six random aa from an in-frame construction linker, and the last nine aa of the hlFNa2 SP. (A): Linear map of pACIF2 showing the location and directions of transcription of the argB marker gene and the aphA promoter-hlFNa2 fusion gene. The boxed region is that for which nt sequence is shown in panel C. (B) and (C): nt sequences of the regions encoding the APase SP/hIFNa2 fusion junctions of pACIF1 and pACIF2, respectively. Codons derived from the A. niger uphA gene are doubly underlined, those from the hlFNa2 gene are underlined singly, and those from an intervening artifact of cloning are not underlined. Presumed SP cleavage sites are indicated under protein sequences by small black rectangles. Plasmids were propagated in E. coli JM109.

195

(b) Detection of hIFNa2 secretion in Aspergi@us transformants A. niger and A. nidulans strains (Table I, legend) were transformed with pACIF1 and pACIF2. Eight transformants selected from each transfo~ation were analysed further. Liquid cultures were grown in the presence of 50 mM KH,PO, at pH 4.5, then the aphA promoter was derepressed by shifting to - P medium (Table I, footnote e), and the levels of hIFNa2 released into the culture filtrates were determined by immunoassay after 4 h dere-

pression. The time required to reach near-maximal steady-state expression levels was established by previous time course experiments on secreted, intrinsic APase levels. Secreted APase levels increased in an essentially linear fashion until 6 to 8 h after derepression, but thereafter increased more slowly (data not shown). All transformant supernatants were assayed in triplicate 4 h after derepression. In addition, supernatants of four transformants of each species were assayed at 3 h and 5 h after derepression in separate experiments and compared to

TABLE I Secretion of hIFNa2 by A. nidulans and A. niger transformed with pACIF1 or pACIF2 A. nidulans” vectoP

A. nigef’

Transform~t’

Cnd

Secreted hIFNa2’ 3h

pACIF1

1 2

2 5 2 3 50 50 5 6

pACIF2

1 2 3 4 6

8

4h

_ 7 76

Vecto?

Transfo~ant’

Cn?

5hf

Secreted hIFNa2* 3h

0 0 0

_

6 9 120 6 7

12 90 -

24 21 4

_ _

11 160 300

_

9 14

1575 _

1800 13

1650 _

8 1 8

130 _ -

146 20 164

145 -

pACIF1

1 2 2

3 1.2 -

4

8 pACIF2

1 2 3 4 5 6 8

-

6

4 4

3

1.2 _

4h 2.5 1.4 0 1.2 1.1 0 1.0 1.2 3 4 2 1.3 12.0 3 1.7 1.2

5h’ 3 1.4 _ 4 1.4 -

“The A. nidtdans recipient strain was a biAl pabaA yA2 pyrG89 argB2 areA derivative of the Glasgow wild type. The A. niger recipient was an argB52 mutant of strain ATCC#46951 (Buxton et al., 1987). bSee Fig. 1. ‘The A. niger and A. nidulans strains were transformed as described by Buxton et al. (1985) and Yelton et al. (1984), respectively. Eight transformants with each of pACIF1 and pACIF2 were isolated from A. niger and A. nidufans, and numbered consecutively. Single spore isolates were prepared from transformed colonies prototrophic for arginine. Genomic DNA was isolated as described by Yelton et al. (1984). A Southern blot of undigested and EcoRI-digested genomic DNA was probed with the 1.05-kb EcoRI fragment of pACIF1 which had been labelled by nick translation. For the undigested DNA, only high M, DNA was observed to hybridize with the probe. A hybridizing 1.05-kb EcoRI fragment was present in all the transformants examined, indicating the presence of undisrupted versions of the fused klFNa2 gene. dCn = copy number of integrated vector constructs in each transformant. This was determined by blotting 3 ug of genomic DNA from each transformant onto Genescreen Plus (NEN) in triplicate. Duplicate filters were prepared, one was probed with the l.OS-kb EcoRI fragment of pACIF1, the other with the 1.5kb EcoRI-SafI fragment of the A. niger apkA gene (MaeRae et al., 1988) for A. niger transfo~ants, or with a 2.2-kb A. njdulans PSI genomic fragment known to be single copy for A. niduZ~nstransformants. After hyb~disation and washing, DNA dots were excised and radioactivity measured by liquid scintillation counting. The number of copies per genome of the 1.05-kb EcoRI klFNaZ-containing fragment was determined, by comparison with the amount of radioactivity of the single copy fragment bound to the filters, after correction for size of probe used and background hybridisation. ‘hIFNa2 concentrations of the culture filtrates are expressed as units/mg dry weight of mycelium. The 3 h and 5 h measurements presented for eight transformants were made in a separate experiment from the set of 4 h measurements. In order to measure secreted hIFNa2 levels, conidial suspensions were prepared from each transfo~ant and used to inoculate 10 ml of minimal medium (Cove, 1966) supplemented with 1% w/v D-glucose/20 mM tartratej50 mM KHZPO,. After overnight incubation at 37°C with rotation at 200 rpm, the mycelia were harvested by filtration through miracloth, washed with -P medium [minimal medium of Cove (1966), containing 50mM KCl, 200 uM KH,PO,, and buffered to pH 5.5 with 50 mM Na, *citrate] at ambient temperature, transferred to 10 ml of -P medium and incubated further for 4 h. Mycelia were removed by filtration through miracloth and hIFNa2 levels in the culture filtrate were determined immediately using the NK2 assay kit (Celltech). Mycelia were lyophilized and weighed. Each transformant was grown and assayed for hIFNa2 production in triplicate. ‘Time given is growth time at 37°C with 200 rpm rotation after derepression by shifting to -P medium.

that of 4 h (Table I). Under these conditions, with relatively large amounts of initial mycelium, starvation artifacts are encountered from 6 h after induction. Five of the A. nidufans pACIF1 transformants and six of the A. niger pACIF1 transformants secreted detectable levels of hIFNu2 into culture filtrates; hIFNa2 was detectable in the culture filtrates of all of the pACIF2 transfo~ants (Table I). No clear relationship between hIFNol2 levels and transgene copy number is evident from the data, although there is a tendency for low-copynumber transformants to be low producers, and most of the high producers are high-copy-number transformants. All pACIF2 transfo~ants produced higher levels of secreted hIFNa2 than pACIF1 transformants, averaging 50-fold higher for A. nidulans and three-fold higher for A. niger. These differences were statistically significant at the 95% level. The most likely interpretation of these data is that precise fusion of the coding region to be expressed to the aphA SP-encoding DNA sequence (as in pACIF2) is important for efficient processing and thus gives higher levels of secretion. Similar results were obtained for the &A promoter expression system by Gwynne et al. (1987). All A. niger transformants produced low levels of secreted hIFNcr2 as compared to A. nidulans transformants. This reflects different physiological responses of A. niger and A. nidulans to the growth conditons used, since the total concentration of hIFNa2 was very similar in transformants of the two species, and significant levels of secretion were reached by the A. niger transformants pACIF2#2 and #6 under the different growth conditions which were used in the Pi derepression experiments reported below (section c; Table II). In the experiments designed to investigate regulation (section c; Table II), the amount of intracellular hIFNa2 as well as secreted hIFNol2 was measured. The A. niduians transformants pACIFl#6 and pACIF2#4 secreted 54% and 95% respectively of synthesized hIFNa2. The A. niger transformants pACIFl#2 and pACIF2#6 had secretion efficiencies of 27% and 22%, respectively. (c) Regulation of hIFNa2 synthesis by phosphate concentration and pH The effect of Pi concentration in the medium on intracellular and culture filtrate levels of hIFNol2 was studied in two A. nidu~ans and two A. niger transformants, carrying either pACIF1 or pACIF2. Myceiia of each transformant were grown for 16 h in medium buffered to pH 5.5 with Na,*citrate and containing either 50 mM KH,P04 or 200 uM KHzPOa and 50mM KCI. The culture filtrates as well as cell free mycelial extracts were assayed for hIFNcz2 levels after 16 h of growth. Although hIFNcl2 was detected in the media of transformants

TABLE II hIFNor2 synthesis and secretion by transformants grown in P, media Host

Transforming* plasmid

Location of Amount of hIFNcr12b at: hIFNa2 High [Pi] Low [Pi]

A. nidulans pACIFI #6

secreted intracelhilar total

6 7 13

140 I20 260

A. nidulans pACIF2#4

secreted 200 intracellular 70 total 270

1800 390 1190

A. niger

pACIFI#2

secreted intra~ilular total

4 I2 16

110 300 410

A. niger

pACIF2#6

secreted intracellular total

20 80 100

400 1400 1800

“See Fig. 1 and Table I. Numbered transfo~ants correspond to the numbered isolates listed in Table I. bConidia were inoculated into triplicate 10 ml aliquots of appropriately supplemented minimal medium (Table I, legend), incubated for 18 h at 37°C with 200 rpm rotation, and then mycelia were harvested by filtration through miracloth. hIFNa2 was assayed as described in Table I, footnote e. High [Pi] =50 mM KH2P0,. Low [Pi]=200 uM KH,PO,/SO mM KCI.

grown in the presence of 50 mM phosphate, the levels of hIFNrx2 were markedly higher when the transformants were grown in -P medium (Table II). This increase varied between 6 to 25-fold in four transformants analysed (Table II). It has already been noted above that under these growth conditions the A. niger transformants secreted hIFNol2 considerably better than under the conditions used for the experiments reported in Table I. Similar effects of Pi concentration on hIFNol2 levels in cell free extracts (i.e., non-secreted hIFNol2) were also observed for each of the transformants (Table II). As an internal control, the derepression of host APase was measured simultaneously. Intrinsic APase levels in media and cell free extracts (measured using ~-nitrophenyl phosphate as substrate; Caddick and Arst, 1986) were also greater when the mycelia were grown in -P media, but the magnitude of the difference was less than for hIFNa2. This is to be expected, because of the existence of nonrepressible acid APase activity (Caddick and Arst, 1986) which adds to the basal level of overall APase activity. Total APase activities of the two A. nidulans transformants increased 1.7 (pACIFl#6) and 3.2 (pACIF2#4)fold when cultured in -P medium while the A. niger transformants showed IO.1 and 10.7-fold increases. Measurements of the levels of ~IF~~Z mRNA present in total RNA preparations from two transformants (A. nidulans pACIF2#4 and A. niger pACIF2#6; Table III)

197 TABLE III hlFNa2

mRNA

levels in transformants Transforming”

Host

hlFNu2

mRNAb

at:

plasmid

A. nidulans

pACIF2#4 pACIF2#6

A. niger

High [Pi]

Low [Pi]

1.5 0.7

8 4.5

“See Table II, footnote a. bhlFNa2 mRNA levels are given as % total RNAx10m3. RNA was isolated (Timberlake, 1986), run in MOPS-1.5% formaldehyde gels and blotted onto Genescreen Plus (NEN). The blot was probed with the 1.05-kb EcoRI fragment

of pACIF1,

labelled

with 32P by nick transla-

tion (Rigby et al., 1977). Specific hybridisation was found to a I-kb band. These bands were excised and their radioactivity determined by scintillation counting. The amount of RNA present was estimated by comparison to the standard curve obtained by hybridising to fixed amounts of the 1.05-kb EcoRI fragment of pACIF1. For [Pi], see Table II, footnote

b.

were made. The hZFNcr2 mRNA level was approximately sixfold higher under phosphate-derepressed conditions conditions both than phosphate-repressed for transformants. Thus the cis-acting Pi regulation signals in the promoter region were intact, since steady-state mRNA levels increased significantly after phosphate derepression and transformants showed phosphate regulation of hIFNa2 synthesis in the expected range. The same two A. niger and two A. nidulans transformants (carrying either pACIF1 or pACIF2) were used to study the effects of medium pH in the pH range 4.5 to 8.5 on hIFNa2 synthesis. Despite repeated experiments, we were unable to detect clear evidence of pH regulation of either hIFNa2 synthesis or intrinsic APase synthesis. The lack of regulation of intrinsic APase suggests that the growth conditions used were not suitable for observing pH regulation with these strains. (d) Levels of hIFNar2 synthesis and secretion

Levels of hIFNa2 measured in the culture medium may depend not only on the efficiency of hIFNa2 secretion to the culture medium but also on the loss of hIFNa2 due to degradation, destabilisation or non-specific absorbtion. In order to assess if such phenomena occur, 100 u of hIFNa2 (Celltech) were added to 1 ml of filtered culture medium withdrawn at different time-points after derepression, incubated for 1 h at 37°C and then assayed immunologically. No hIFNa2 was lost from control culture medium, or from medium sampled 2 h after derepression, and only 10% or 20% loss occurred in medium sampled 3 h or 4 h after derepression. Therefore, the levels of hIFNa2 measured at these time points are a reasonably good reflection of the secretion capacity of the transformants.

The highest yield of hIFNcx2 obtained using the aphA promoter was approximately 30-fold less than the highest level obtained in primary A. nidulans transformants using the alcA promoter and five-fold less than the poorest alcA transformants. However, these numbers are not comparable since minimal medium was used in the aphA experiments in order to allow Pi derepression. The measurements of hZFNcl2 mRNA levels expressed from the aphA promoter in transformants are suitable only for comparison of experimental conditions, and not for the determination of absolute mRNA levels. With this proviso, the data indicate that derepressed steady-state levels of hZFNcr2 mRNA from the aphA promoter were around 0.01% of total RNA compared with 0.05% to 0.1% for alcA. In view of all these results, the aphA promoter is not likely to be suitable for the development of high-level expression systems in A. niger without further characterisation. Future vector development using this promoter should focus on identifying the pH and phosphate regulation &-acting signals, and combining them with elements of stronger Aspergillus transcriptional start points. In this way the useful regulatory properties of the aphA gene could be harnessed to a promoter strong enough for production purposes. (e) Conclusions (I) A 5’ portion (including the putative SP and 558 bp of DNA upstream from the ATG) of the A. niger aphA

gene encoding a repressible APase is capable of directing the synthesis and secretion of fused hIFNa2 in both A. niger and A. nidulans. (2) The hIFNa2 production is regulated in transformants of both fungal species by the Pi concentration of the growth medium, and determination of steady state hlFNct2 mRNA levels supports the conclusion that phosphate regulates aphA gene expression at the transcriptional level, both in the homologous host A. niger and in the heterologous host A. nidulans. (3) The level of hIFNa2 secretion observed is 5 to 30fold lower than that observed in transformants carrying alcA promoter constructs (Gwynne et al., 1987); however, the aphA experiments were all carried out in minimal medium. (4) Vector development using this promoter should therefore focus on defining the cis-acting elements, to create a pH and phosphate regulated system based on a strong transcription start point.

ACKNOWLEDGEMENTS

We thank Dr. Derek Burke (University of East Anglia, UK) for the hZFNcx2 cDNA clone, Dr. R. Barnett and H.

198

Erfle, Allelix Biopharmaceuticals Inc. (Mississauga, Ontario, Canada), for synthetic oligos, Dr. M.X. Caddick, (University of Liverpool, UK), for providing A. nidulans strains and Dr. H.N. Arst, Jr., (Royal Postgraduate Medical School, University of London, UK) for discussions. W.D.M. was supported in part by an Industrial Research fellowship from the Natural Sciences and Engineering Council of Canada.

REFERENCES Barbesgaard, P.: Industrial enzymes produced Aspergillus. In: Smith, J.E. and Pateman, Physiology pp. 39 l-404.

of

Aspergillus.

Academic

by members of the genus J.K. (Eds.), Genetics and Press,

London,

1977,

Berse, B., Dmochowska, A., Skrzypek, M., Wegleriski, P., Bates, M.A. and Weiss, R.L.: Cloning and characterization of the ornithine carbamoyltransferase gene from Aspergihs niduhns. Gene 25 (1983) 109-117. Buxton, F.P., Gwynne, D.I. and Davies, R.W.: Transformation of Aspergillus niger using the argB gene of Aspergillus nidulans. Gene 37 (1985) 207-214. Buxton, F.P., Gwynne, D.I., Sibley, S. and Davies, R.W. Cloning and molecular analysis of the ornithine carbamoyl transferase gene of Aspergillus niger. Gene 60 (1987) 255-266. Caddick, M.X. and Arst Jr., H.N.: Structural genes for phosphatases Aspergillus nidulans. Genet. Res. Camb. 47 (1986) 83-91. Cove, D.J.: The induction

and repression

of nitrate

reductase

in

in the

fungus Aspergihs nidulans. Biochem. Biophys. Acta 113 (1966) 5 l-56. Cullen, D., Gay, G.L., Wilson L.J., Hayenga, K.J., Lamsa, M.H., Rey, M.W., Norton, S. and Berka, R.M.: Controlled expression and secretion of bovine chymosin in Aspergillus nidulans. Bio/Technology 5 (1987) 369-376. Davies, R.W. Molecular biology of a high-level recombinant protein production system in Aspergillus. In: Leong, S.A. and Berka, R.M. (Eds.), Molecular Industrial Mycology, Systems and Applications for Filamentous Fungi. Marcel Dekker, New York, 1991, pp. 45-82. Gwynne, D.I., Buxton, F.P., Williams, S.A., Garven, S. and Davies, R.W.: Genetically engineered secretion of active human interferon and a bacterial endoglucanase from Aspergihs niduhns. Bio/ Technology 5 (1987) 713-719. MacRae, W.D., Buxton, F.P., Sibley, S., Garven, S., Gwynne, D.I. and Davies, R.W.: A phosphate-repressible acid phosphatase gene from Aspergillus niger: its cloning, sequencing and transcriptional analysis. Gene 71 (1988) 339-348. Rigby, P.W.J., Dieckman, M., Rhodes, C. and Berg, P.: Labelling DNA to high specific activity in vitro by nick translation with DNA polymerase I. J. Mol. Biol. 113 (1977) 237-251. Timberlake, W.E.: Isolation of stage- and cell-specific genes from fungi. In: J.A. Bailey (Ed.), Biology and Molecular Biology of PlantPathogen Interactions. NATO AS1 Series, series H: Cell Biology, Vol. 1, Springer, Berlin, 1986, pp. 343-357. von Heijne, G.: A new method for predicting signal sequence cleavage sites. Nucleic Acids Res. 14 (1986) 4683-4690. Ward, M. Chymosin production in Aspergillus. In: Leong, S.A. and Berka, R.M. (Eds.), Molecular Industrial Mycology, Systems and Applications for Filamentous Fungi. Marcel Dekker, New York, 1991, pp. 83-106. Yelton, M., Hamer, J.E. and Timberlake, W.E.: Transformation of Aspergillus nidulans by using a trpC plasmid. Proc. Natl. Acad. Sci. USA 81 (1984) 1370-1374.