High-performance closed-tube PCR based on switchable luminescence probes

Analytica Chimica Acta 731 (2012) 88–92

Contents lists available at SciVerse ScienceDirect

Analytica Chimica Acta journal homepage: www.elsevier.com/locate/aca

High-performance closed-tube PCR based on switchable luminescence probes Ari Lehmusvuori ∗ , Ulla Karhunen, Antti-Heikki Tapio, Urpo Lamminmäki, Tero Soukka Department of Biotechnology, University of Turku, Tykistökatu 6A, 20520 Turku, Finland

a r t i c l e

i n f o

Article history: Received 24 November 2011 Received in revised form 30 March 2012 Accepted 20 April 2012 Available online 1 May 2012 Keywords: PCR Switchable sensors Lanthanide chelate Time-resolved measurement Diagnostics

a b s t r a c t We introduce a switchable lanthanide luminescence reporter technology based closed-tube PCR for the detection of specific target DNA sequence. In the switchable lanthanide chelate complementation based reporter technology hybridization of two nonfluorescent oligonucleotide probes to the adjacent positions of the complementary strand leads to the formation of a highly fluorescent lanthanide chelate complex. The complex is self-assembled from a nonfluorescent lanthanide chelate and a light-harvesting antenna ligand when the reporter molecules are brought into close proximity by the oligonucleotide probes. Outstanding signal-to-background discrimination in real-time PCR assay was achieved due to the very low background fluorescence level and high specific signal generation. High sensitivity of the reporter technology allows the detection of a lower concentration of amplified DNA in the real-time PCR, resulting in detection of the target at the earlier amplification cycle compared to commonly used methods. © 2012 Elsevier B.V. All rights reserved.

1. Introduction The polymerase chain reaction (PCR) [1] is a powerful and sensitive DNA amplification technique used in several molecular biology applications and the most important tool in DNA diagnostics. Exponential DNA amplification efficiency of PCR allows the production of large amount of DNA copies even from a single copy of target DNA in one reaction. The powerful amplification ability has been utilized increasingly for the diagnosis of pathogenic bacterial and viral infections in closed-tube assays. Early DNA diagnostic assays based on PCR required postamplification processing such as agarose gel electrophoresis, restriction enzyme analysis or heterogeneous hybridization assays for the analysis of the amplified DNA. The post-PCR steps made the assays quite cumbersome and assays were also subject to crosscontamination between amplification reactions because reaction vessels had to be opened after DNA amplification [2]. Since the introduction of 5 nuclease technology [3] utilizing fluorescence resonance energy transfer (FRET) [4] in the mid-1990s, it has been possible to follow the specific DNA amplification by PCR in realtime as a homogenous type of assay. In the 5 nuclease technology one end of the dual-labeled probe is labeled with a fluorescent donor and the other end is coupled with a quencher molecule. In the intact probe the signal of the excited donor is suppressed by the quencher. The fluorescence of the donor is increased when exonuclease activity of the DNA polymerase degrades the probe during the target DNA amplification and releases the quenching

∗ Corresponding author. Tel.: +358 505441432; fax: +358 23338050. E-mail addresses: ari.lehmusvuori@utu.fi, artule@utu.fi (A. Lehmusvuori). 0003-2670/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.aca.2012.04.027

of the donor emission. In FRET the short distance of two reporter molecules and overlapping emission spectrum of the donor and excitation spectrum of the acceptor is required for the transfer of the excitation energy from a donor fluorophore to an acceptor molecule. Nowadays there are several different commercially available FRET-based probe technologies for the detection of specific PCR product in closed tube [5–7] but still the most used method is based on 5 nuclease technology commercially known as the TaqMan [3,8]. The performance of FRET-based detection methods utilizing conventional organic fluorescent molecules is usually limited by relatively high background signal level. The main cause for the elevated background signal level is short-lived autofluorescence originating from the plastic reaction vessel and biological sample material. In addition, in the 5 nuclease technology based on quenching of the donor fluorescence, incomplete suppression of the donor emission increases the background fluorescence. Improved sensitivity in homogenous PCR assay based on FRET, lanthanide chelate labeled oligonucleotide probe and timeresolved fluorescence (TRF) measurement has been reported [9]. Lanthanide chelates elicit unique fluorescence characteristics such as long emission lifetime, large Stokes shift and narrow-banded emission fluorescence. Measuring the signal after the short-lived fluorescence by using time resolution, the background autofluorescence can efficiently be eliminated. Formation of a self-assembled fluorescent lanthanide chelate complex by the adjacent hybridization of two non-fluorescent oligonucleotide probes to a target DNA has been presented previously [10–13] and high sensitivity with broad dynamic range has been achieved in homogenous DNA detection assay [13]. Here we report for the first time a homogenous PCR based on nonFRET switchable lanthanide chelate complementation reporter

A. Lehmusvuori et al. / Analytica Chimica Acta 731 (2012) 88–92

89

Fig. 2. Molecular structures of the lanthanide ion carrier chelate 7d-DOTA-EuIII [2,2 2 -(10-(3-isothiocyanatobenzyl)-1,4,7,10-tetraazacyclododecane-1,4,7-triyl) triaceticacideuropium (III)] (A) and the light harvesting antenna ligand [4-((4-isothiocyanatophenyl)ethynyl)pyridine-2,6-dicarboxylic acid] (B) used in the PCR assays. Fig. 1. Principle of the closed-tube PCR assay based on switchable lanthanide chelate complementation reporter technology. At the measurement temperature (30 ◦ C) fluorescent complex is formed when two nonfluorescent oligonucleotide probes (the Eu-carrier probe and antenna probe) are hybridized in adjacent positions to the complementary target strand. After the measurement the temperature is raised to 72 ◦ C for the extension step of PCR and the probes unhybridize due to their low annealing temperature.

technology and time-resolved fluorescence measurement. In the lanthanide chelate complementation based binary probe method a nonfluorescent lanthanide ion (LnIII ) carrier chelate and a light absorbing antenna ligand are coupled to different oligonucleotide probes. Nonfluorescent reporter molecules together form a highly fluorescent complex by self-assembly when the probes are hybridized in adjacent positions to the PCR-amplified target DNA leading to high local concentration of the reporter moieties as illustrated in Fig. 1. Improved DNA detection sensitivity in terms of PCR cycles needed for the target detection compared to the most commonly used FRET-based 5 nuclease PCR assay technology was achieved due to the very low background signal level and high specific fluorescence generation. 2. Experimental 2.1. Preparation of the complementation probes The PCR reaction conditions such as high temperature require kinetically and thermodynamically stable lanthanide ion carrier chelate structure for binding of the LnIII . Europium has nine coordination sites [14] and previously nonadentate lanthanide chelates has been used in FRET-based closed-tube PCR assays [15,16]. A organic chelate that forms the maximum number of coordination bonds with the lanthanide ion efficiently prevents the quenching of the fluorescence caused by the energy transfer from the excited LnIII to O H oscillation of the water molecules coordinated to the LnIII [17] and stabilizes the lanthanide chelate structure, making it more tolerable to different reaction conditions such as high temperature. However, in the lanthanide chelate complementation technology a nonadentate chelate cannot be used because the tridentate light harvesting antenna ligand needs to be coordinated to the europium ion. A recently synthesized cyclic heptadentate lanthanide chelate [2,2 2 -(10-(3-isothiocyanatobenzyl)-1,4,7,10(7d-DOTA-EuIII ) tetraazacyclododecane-1,4,7-triyl)triaceticacideuropium (III)] [18] was consider to meet the criteria mentioned above and was chosen to be used as a lanthanide ion carrier chelate in the complementation probes based closed-tube PCR. A 20-mer oligonucleotide (5 -AATCGTATCTCGGGTTAATG(AmC6)-3 ) was labeled with 7d-DOTA-EuIII (Eu-carrier probe) or with a planar N1-EuIII [13,19] at the 3 -end via a six-carbon linker. The N1-EuIII was used to be able to compare the stability of two different heptadentate lanthanide chelate in the PCR reaction conditions.

In addition, the N1-EuIII was previously shown to be suitable for the lanthanide chelate complementation based DNA detection assay performed in the room temperature without DNA amplification [13]. Another 20-mer oligonucleotide (5 -T(AmC2dT)GCATGATGCTTTATCAAA-Phosphate-3 ) was coupled with a tridentate light-harvesting antenna ligand [13] (antenna probe) at an amino-modified thymine containing a two-carbon linker placed one nucleotide internal to the 5 -end. The structures of the 7d-DOTA-EuIII and the antenna ligand are shown in Fig. 2. The oligonucleotides were purchased from Thermo Fisher Scientific (MA, USA) and labeled as described in [13]. The HPLC purifications of the labeled probes were performed with Thermo Electron Corporation (MA, USA) HPLC equipments using ODS Hypersil (150 × 4.6 mm, 3 ␮m particle size, pore size ˚ columns (Thermo Fisher Scientific). The probes were 120 A) purified using a gradient from 86% of solution A (aqueous 50 mM triethylammonium acetate (TEAA; Fluka Biochemica, Buchs, Switzerland)) and 14% of solution B (50 mM TEAA in acetonitrile (J.T. Baker, NJ, USA)) to 70% of A and 30% of B in 25 min for the Eucarrier probe and in 21 min for the antenna probe with the flow rate of 0.5 mL min−1 . The collected HPLC fractions were evaporated in vacuum (Hetovac VR-1, Heto-Holten A S−1 , Allerod, Denmark) and dissolved in 10 mM Tris–HCl (pH 7.5) containing 50 mM NaCl. The HPLC fractions were characterized by measuring absorbance at 260 and 330 nm and the total EuIII concentration of the Eu-carrier probe was measured with the DELFIA system (PerkinElmer Life and Analytical Sciences, Turku, Finland). 2.2. Thermal stability of the probes Reaction mixtures containing 50 nM carrier (labeled with 7d-DOTA-EuIII or N1-EuIII ) and antenna probes and 0 or 10 nM synthetic single-stranded target DNA (5 -CATTTGATAAAG CATCATGCAACATTAACCCGAGATACGATTTG-3 (Thermo Fisher Scientific)) in assay buffer (50 mM Tris–HCl (pH 7.75), 600 mM NaCl, 0.1% (v/v) Tween 20, 0.05% (w/v) NaN3 , 30 ␮M diethylenetriaminepentaacetic acid (DTPA)) to a volume of 40 ␮L was prepared in the white 96-well PCR plate (FrameStar 96, 4titude, Surrey, UK) and sealed with Optical Caps (Applied Biosystems, CA, USA). The thermal cycling consisted of 2 min initial denaturation at 98 ◦ C followed by 30 cycles of 98 ◦ C for 5 s, 30 ◦ C for 30 s and 72 ◦ C for 5 s and was performed using PTC-200 DNA Engine (MJ Research, MA, USA). Time-resolved fluorescence of europium was measured in every cycle at 30 ◦ C after 30 s incubation with a 1420 Victor Multilabel Counter (PerkinElmer Life And Analytical Life Sciences) using a 340 nm excitation filter, 615 nm emission filter, 0.4 ms delay, and 0.4 ms measurement time. 2.3. Performance characterization of the reporter technology For the characterization of the complementation probes based reporter technology reactions containing 50 nM Eu-carrier probe

90

A. Lehmusvuori et al. / Analytica Chimica Acta 731 (2012) 88–92

(7d-DOTA-EuIII labeled), 50 nM antenna probe and single-stranded target DNA 0–100 nM in assay buffer was prepared in to the low fluorescence 96-well Maxisorp microtitration plate purchased from Nunc (Roskilde, Denmark) to a volume of 60 ␮L. After 15 min incubation Eu TRF was measured with a 1420 Victor Multilabel Counter.

2.4. Real-time and end-point PCR Amplification of 0; 100; 1000; 10,000; 100,000; 1,000,000 and 10,000,000 copies of synthetic target DNA (5 CTTCAGCGCTACACACGCTCAAATCATCGAGGAAAACCGTATGAGAAACGGATCTAAGCTTGTCATTTGATAAAGCATCATGCAACATTAACCCGAGATACGATTTGTCCATATCTTTGATACGACGCCGCAAAAGCTCTTCCCAAGCCGAGTCTACAG-3 (Thermo Fisher Scientific)) in the polymerase chain reactions was monitored in real-time using 50 nM complementation probes (Eu-carrier probe coupled with 7d-DOTA-EuIII ) or 250 nM TaqMan probe (5 (designed TGTCATTTGATAAAGCATCATGCAACATTAACCCGA-3 ) using Beacon Designer 6.0 software (Premier Biosoft, CA, USA)). The TaqMan probe was 5 -end labeled with 6-carboxyfluorescein (6-FAM) and 3 -end labeled with the Black Hole Quencher-1 (BHQ-1) and purchased from biomers.net (Ulm, Germany). In addition to the probes, the PCR reactions contained 500 nM forward (5 -CTGTAGACTCGGCTTGGGAAGAGC-3 ) and reverse (5 -CTTCAGCGCTACACACGCTCAAAT-3 ) primers purchased from Thermo Fisher Scientific and 500 ␮M dNTPs (Fermentas, Burlington, Canada). The real-time amplification reactions based on the complementation probes contained also 0.8 ␮L/reaction of Phire II Hot Start DNA Polymerase and 1X Phire Reaction Buffer from Finnzymes (Espoo, Finland) and 30 ␮M DTPA. The reactions where the TaqMan chemistry was used contained in addition to the basic PCR reagents 1.5 U of AmpliTaq Gold DNA Polymerase, 1X GeneAmp PCR Buffer and an additional 3.5 mM MgCl2 from Applied Biosystems. The reactions were performed in the white 96-well PCR plate (FrameStar 96, 4titude) sealed with Optical Caps (Applied Biosystems) at a volume of 40 ␮L. The thermal cycling of the real-time PCR containing the complementation probes consisted of 3 min initial denaturation at 98 ◦ C followed first by 9 cycles of 98 ◦ C for 5 s, 62 ◦ C for 5 s and 72 ◦ C for 8 s and then 38 cycles of 98 ◦ C for 5 s, 62 ◦ C for 5 s or 30 ◦ C for 30 s in every second cycle and 72 ◦ C for 8 s. The Eu TRF signal was measured in every second cycle after 30 s incubation at the 30 ◦ C starting at cycle 11. Settings in the Eu TRF measurement were as described previously. For the TaqMan real-time PCR the following thermal cycling protocol was used: initial denaturation 95 ◦ C for 10 min followed by 46 cycles of 95 ◦ C for 15 s and 59 ◦ C for 1 min. The fluorescence was measured in every second cycle after 1 min incubation at 59 ◦ C starting at cycle 10 using 485 nm excitation filter, 535 nm emission filter and 0.1 s measurement time (6-FAM fluorescence). Thermal cycling was performed using PTC-200 DNA Engine (MJ Research) and the measurements using a Victor X4 Multilabel Plate Reader (PerkinElmer Life and Analytical Life Sciences). Different DNA polymerase enzymes were used because the TaqMan requires DNA polymerase 5 → 3 exonuclease activity that could degrade the complementation probes and thus decrease the efficiency of the complementation reporter technology. To analyze the complementation probes and TaqMan based realtime PCR results, the threshold cycles (Ct ) were determined and plotted as a linear function of the base-10 logarithm of the initial template copy numbers. The Ct was defined as the PCR cycle at which Eu TRF and 6-FAM fluorescence signal-to-background ratios (S B−1 ) crosses the value of 1.4 and 1.1 respectively. The background fluorescence signal of both detection methods was determined as the average fluorescence (Eu TRF or 6-FAM fluorescence) of cycles 10–18 (except the background of the complementation probes

Fig. 3. Thermal stability of the complementation probes. Reactions contained the carrier probe coupled with 7d-DOTA-EuIII (circle) or with the N1-EuIII (square), the antenna probe and 10 nM (black symbols) or 0 nM (white symbols) oligonucleotide target. Temperature of the reactions was cycled between 98 ◦ C and 30 ◦ C and Eu TRF signal was measured in each cycle at 30 ◦ C.

based PCR reactions containing 1,000,000 and 10,000,000 template copies were determined from the cycles 10 to 14 and 10 to 12 respectively because of the early signal generation over the background level). In complementation probes based end-point PCR, 100,000 ssDNA copies was amplified using 30 s initial denaturation at 98 ◦ C followed by 28 cycles of 98 ◦ C for 5 s and 68 ◦ C for 8 s. After thermal cycling DNA was denatured at 98 ◦ C for 5 s and then the reaction was incubated at 30 ◦ C for 30 s, followed by Eu TRF measurement. All the PCR reagents, concentrations and measurement were as described above. For the thermal cycling, the rapid Pico thermal cycler from Finnzymes was used. 3. Results and discussion 3.1. Characterization of the complementation probes Thermostability of the complementation probes was tested by cycling the temperature of the reaction mixture containing 50 nM Eu-carrier probe, 50 nM antenna probe and complementary target oligonucleotide (0 and 10 nM) between 98 ◦ C and 30 ◦ C and measuring time-resolved fluorescence for europium at 30 ◦ C. At low temperature the probes hybridize to the target oligonucleotide, leading to the formation of the fluorescent lanthanide chelate complex. The Eu-carrier probe (labeled with 7d-DOTA-EuIII ) and antenna probe were found to be thermostable in PCR conditions. High specific europium fluorescence was observed in presence of target in each measurement point whereas the linear heptadentate carrier chelate N1-EuIII [13,19] was found to be unstable in typical PCR temperatures. The cyclic structure of the 7d-DOTA-EuIII stabilizes the lanthanide chelate compared to the linear N1-EuIII making the 7d-DOTA-EuIII more thermostable and suitable for the homogenous PCR (Fig. 3). An ideal fluorescent reporter system would be unable to fluoresce without the target and would give out a specific signal with broad dynamic range, depending on the target concentration. The performance of the complementation probes based DNA detection system was determined by measuring the Eu TRF in the hybridization reactions containing 50 nM Eu-carrier and antenna probe and 0–100 nM single-stranded target DNA. Broad dynamic

A. Lehmusvuori et al. / Analytica Chimica Acta 731 (2012) 88–92

Fig. 4. Standard curve of the complementation probe based DNA detection. Timeresolved fluorescence for europium was measured after 50 nM of the lanthanide ion Eu-carrier probe and antenna probe were hybridized with increasing concentration of the complementary oligonucleotide target forming fluorescent lanthanide chelate complex.

range (four orders of magnitude) was achieved due to the low background fluorescence and high specific signal. The maximum signal-to-background ratio of 1000 was measured and the detection limit of the assay was 15 pM when defined as the concentration of the target corresponding to 1.2 × background signal (detection limit was set to level of background signal + 20 × standard deviation because measured coefficient of variation of the background signal was less than 1%) (Fig. 4). 3.2. Complementation probes based real-time PCR and comparison to TaqMan technology A complementation probes based real-time PCR assay was developed to demonstrate the ability of the probes to detect the increasing concentration of the target DNA in closed-tube PCR. The Eu-carrier probe and antenna probe were design to bind to the target DNA in the PCR only when the temperature was decreased for the Eu TRF measurement. The performance of the complementation probes based PCR was determined in the homogenous PCR assays by monitoring the amplification of 100–10,000,000 copies of dsDNA template in real-time. For comparison, the amplification of the dsDNA template was also monitored in real-time using the TaqMan chemistry. The Eu TRF signal from the hybridized complementation probes and the 6-FAM fluorescence of the TaqMan chemistry were measured in every second PCR cycle starting after amplification cycle 10. Outstanding complementation probes based real-time PCR signal-to-background ratios of 190–300 depending of the initial template concentrations were measured. The high ratio was achieved due to the low background fluorescence (∼1500 Eu TRF signal) in the early cycles of the PCR and high specific signal generation (max ∼390,000 Eu TRF signal) when target DNA was amplified. The signal-to-background ratios of the real-time PCR assays using the TaqMan chemistry were in the level of ∼2 (background ∼140,000 6-FAM fluorescence signal and maximum ∼240,000 6-FAM fluorescence signal). The signal-to-background ratios of real-time PCR assays are shown in Fig. 5. With the complementation technology the amplification product was detected at an earlier stage in the PCR compared to the TaqMan chemistry. The threshold cycles (Ct ) were reached about 6 amplification cycles earlier while the PCR amplification efficiency of the both real-time

91

Fig. 5. Homogenous real-time monitoring of the target DNA amplification by PCR using the switchable lanthanide chelate complementation technology and the TaqMan technology. Graph shows signal-to-background ratio of the amplification and real-time detection of 100–10,000,000 dsDNA template molecules using complementation detection technology (squares) or TaqMan chemistry (circles).

PCR assays were comparable (efficiencies of the complementation probes based PCR and TaqMan based PCR were 97.2% and 93.1% respectively) (Fig. 6). The similar PCR efficiencies verifies that the smaller Ct numbers are achieved due to the more sensitive DNA detection efficiency of the complementation probes compared to the TaqMan chemistry. 3.3. Rapid end-point PCR The TaqMan technology requires enzymatic cleavage of the probe by the DNA polymerase for the signal generation which usually leads to relatively long annealing/extension step time (about 60 s) [20,21]. The complementation probes based PCR requires only polymerase activity of the DNA polymerase enzyme, thus rapid DNA polymerase lacking the nuclease activities and short incubation steps can be used for the amplification. For demonstration of the speed of the complementation probes based PCR assay a homogenous end-point PCR was performed. In two-step PCR 100,000 ssDNA template copies was amplified for 28 cycles in about 22 min following Eu TRF measurement. Eu TRF signal

Fig. 6. Comparison of the complementation probes and TaqMan based real-time PCR. The graph shows linear relationship between the threshold cycles and template copy number shown as 10-base logarithm.

92

A. Lehmusvuori et al. / Analytica Chimica Acta 731 (2012) 88–92

over five times the background (PCR reaction without the template) signal level was measured in a total assay time of less than 25 min. 4. Conclusion The results demonstrate that the switchable lanthanide chelate complementation based reporter technology is an effective method for the closed-tube detection of the PCR amplified target DNA. Extremely low background fluorescence level and high specific signal generation in the presence of the target leads to outstanding signal-to-background ratio and enables the detection of the amplified target DNA at the earlier amplification cycle in homogenous real-time PCR assay compared to the most commonly used method. The unique characteristic of the lanthanide ion to fluoresce only when excited through the organic light-harvesting ligand chelated to the ion, allowed the development of homogenous non-FRET binary probe PCR. The switchable reporter system gives out almost non-existent background signal because the probes can fluoresce only when they are hybridized to the complementary target strand and the carrier chelate is in physical contact to the antenna ligand via coordination bonds. The use of intrinsically nonfluorescent reporter molecules and time-resolved measurement in the homogenous PCR assay overcomes the problems causing relatively high background signal level in FRET-based PCR assays such as short-lived autofluorescence and incomplete quenching of the fluorescence by the quencher. Nucleic acid amplification assays are used increasingly for the diagnosis of pathogenic bacterial and viral infections. A rapid PCR assay would be valuable, for example, for the detection of lifethreatening bacterial diseases such as sepsis, where the early identification of the bacteria can lead to improved clinical outcome. For minimizing the sample-to-result time, fast and simple sample preparation can be used instead of laborious and time-consuming DNA extraction [15]. The extremely high signal-to-background ratio of our closed-tube PCR assay concept can be beneficial if biological samples and minimal sample preparation is used because impurities in the sample can interfere with the fluorescence signal.

Combining the high DNA detection performance of the complementation probes based reporter technology and rapid thermal cycling in the PCR using extremely fast DNA polymerase enzyme and device; it should be possible to create a fast point-of-care closed-tube PCR assay. Acknowledgments This work was supported by the National Doctoral Programme of Advanced Diagnostic Technologies and Applications (DIA-NET), the Instrumentarium Science Foundation and by the Academy of Finland [Grant Number 132007]. References [1] R. Saiki, S. Scharf, F. Faloona, K. Mullis, G. Horn, H. Erlich, N. Arnheim, Science 230 (1985) 1350. [2] A. Isaksson, U. Landegren, Curr. Opin. Biotechnol. 10 (1999) 11. [3] P. Holland, R. Abramson, R. Watson, D. Gelfand, Proc. Natl. Acad. Sci. USA 88 (1991) 7276. [4] T. Förster, Ann. Phys. 437 (1946) 55. [5] C. Wittwer, M. Herrmann, A. Moss, R. Rasmussen, Biotechniques 22 (1997) 130. [6] S. Tyagi, F. Kramer, Nat. Biotechnol. 14 (1996) 303. [7] I. Nazarenko, S. Bhatnagar, R. Hohman, Nucleic Acids Res. 25 (1997) 2516. [8] L. Lee, C. Connell, W. Bloch, Nucleic Acids Res. 21 (1993) 3761. [9] J. Nurmi, T. Wikman, M. Karp, T. Lövgren, Anal. Chem. 74 (2002) 3525. [10] A. Oser, V. Günther, Angew. Chem. 29 (1990) 1167. [11] G. Wang, J. Yuan, K. Matsumoto, Z. Hu, Anal. Biochem. 299 (2001) 169. [12] Y. Kitamura, T. Ihara, Y. Tsujimura, Y. Osawa, D. Sasahara, M. Yamamoto, K. Okada, M. Tazaki, A. Jyo, J. Inorg. Biochem. 102 (2008) 1921. [13] U. Karhunen, L. Jaakkola, Q. Wang, U. Lamminmäki, T. Soukka, Anal. Chem. 82 (2010) 751. [14] W.D. Horrocks Jr., D.R. Sudnick, J. Am. Chem. Soc. 101 (1979) 334. [15] A. Lehmusvuori, E. Juntunen, A. Tapio, K. Rantakokko-Jalava, T. Soukka, T. Lövgren, J. Microbiol. Methods 83 (2010) 302. [16] P. von Lode, A. Syrjälä, V. Hagren, H. Kojola, T. Soukka, T. Lövgren, J. Nurmi, Clin. Chem. 53 (2007) 2014. [17] S. Lis, J. Alloys Compd. 341 (2002) 45. [18] U. Karhunen, J. Rosenberg, U. Lamminmaki, T. Soukka, Anal. Chem. 83 (2011) 9011. [19] V. Mukkala, H. Mikola, I. Hemmilä, Anal. Biochem. 176 (1989) 319. [20] J. Brassard, M.J. Gagne, A. Houde, E. Poitras, P. Ward, J. Appl. Microbiol. 108 (2010) 2191. [21] R.L. Swayne, H.A. Ludlam, V.G. Shet, N. Woodford, M.D. Curran, Int. J. Antimicrob. Agents 388 (2011) 35.