human C3 chimeras transiently expressed in mammalian cells

Molecular Immunology 41 (2004) 19–28

Functional analysis of Cobra Venom Factor/human C3 chimeras transiently expressed in mammalian cells Johanna Kölln, Mark Matzas, Nathalie Jänner, Thorsten Mix, Katrin Klensang, Reinhard Bredehorst, Edzard Spillner∗ Institut für Biochemie und Lebensmittelchemie, Abteilung für Biochemie und Molekularbiologie, Universität Hamburg, Martin-Luther-King-Platz 6, 20146 Hamburg, Germany Received 17 November 2003; received in revised form 30 January 2004; accepted 5 February 2004

Abstract The complement activating venom component Cobra Venom Factor (CVF), a functional and structural homologue of the human complement component C3, forms a stable CVF-dependent C3 convertase complex, which, in contrast to C3-dependent convertase effects continuous activation of the complement and, thereby, decomplementation. In order to elucidate the mechanism underlying the enhanced activity of CVF compared to human C3, we generated two CVF/C3 chimeras and established different affinity-based assay systems for functional analysis of these constructs. To allow for convenient expression and subsequent functional characterisation, the CVF/C3 chimeras as well as CVF and C3 were transiently expressed in mammalian cells. Problems due to the low concentration of the recombinant proteins in the supernatants of transient expressions were circumvented by fusion to peptide tags enabling their efficient immobilisation onto suitable surfaces and subsequent characterisation. In an alternative approach monoclonal antibody fragments generated from a semisynthetic phage display scFv library were employed for concentrating the recombinant proteins by immunoprecipitation. Utilising both approaches all transiently expressed proteins could be characterised for their complement consumption activity. The data obtained with the CVF/C3 chimeras demonstrate that the increased stability of the CVFBb complex is independent of the domains in CVF corresponding to binding sites of factor B and H and the cleavage sites of factor I in the human C3 molecule. © 2004 Elsevier Ltd. All rights reserved. Keywords: Cobra Venom Factor; Chimeras; Phage display

1. Introduction Cobra Venom Factor (CVF) is a non-toxic protein in the venom of the cobra species Naja, Ophiophagus and Hemachatus of the Elapidae family (Muller-Eberhard and Fjellstrom, 1971). It is a 149 kDa glycoprotein composed of three disulfide-bridged chains and displays structural and functional homology to the human complement component C3 (Vogel et al., 1996). The overall sequence identity of CVF and human C3 is 50% (Fritzinger et al., 1994). CVF exhibits C3b-like activity by its ability to form the C3 conAbbreviations: hC3, human C3; CVF, Cobra Venom Factor; rCVF, recombinant CVF; nCVF, native CVF; scFv, single chain fragment variable; CHO, Chinese hamster ovary; GVBS++ , veronal buffered saline with gelantine, MgCl2 and CaCl2 ; CDR, complementary determining regions; PBS, phosphate buffered saline; PCR, polymerase chain reaction; DMEM, Dulbeccos modified eagle medium; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis ∗ Corresponding author. Tel.: +49-40-428386982; fax: +49-40-428387255. E-mail address: [email protected] (E. Spillner). 0161-5890/$ – see front matter © 2004 Elsevier Ltd. All rights reserved. doi:10.1016/j.molimm.2004.02.003

vertase complex CVFBb. This complex strongly activates the alternative pathway and escapes intrinsic regulation by factor H and factor I. Furthermore, the CVFBb complex exhibits a half-life of 7 h as compared to 1.5 min of the C3bBb complex (Medicus et al., 1976; Vogel and Muller-Eberhard, 1982). The enhanced activity of CVF results in continued complement activation and consumption of downstream complement components. Up to now the precise molecular mechanism underlying the formation and stability of the CVF-dependent C3 convertase complexes remains elusive. In the absence of detailed structural data, the construction of CVF/C3 chimeras appears to be an attractive model for the interaction analysis of C3 and factor B. The replacement of potentially relevant functional domains in the CVF molecule by corresponding domains of the human C3 molecule might provide insights in the mechanisms of convertase formation and activity. Recently, recombinant CVF was cloned and expressed in baculovirus-based systems as a fully active two-chain pro-protein (Kock, 1996). For characterisation of a broad panel of CVF/C3 chimeras, however, transient expression in

20

J. Kölln et al. / Molecular Immunology 41 (2004) 19–28

mammalian cells appears to be more suitable, since mammalian cells provide a glycosylation pattern similar to that of human C3 (Possee, 1986; Grossmann et al., 1997). On the other hand, utilising transiently expressed recombinant proteins, the low amounts in the supernatants would require difficult and time-consuming purification steps, which are in contrast to rapid characterisation of complement consumption activity. The aim of this study, therefore, was the establishment of techniques enabling the functional analyses of transiently expressed CVF/C3 chimeras. In one approach, the recombinant proteins were fused to the affinity octapeptide strep-tag II, which allowed immobilisation and functional analyses on solid supports. In a second approach, recombinant antibody fragments were generated by selection of a synthetic antibody phage display library and employed for purification by immunoprecipitation. Utilising these two approaches rCVF and two CVF/C3 chimeric proteins could be functionally analysed directly from supernatants of transient expressions. The retained activity of the chimeric proteins suggests that the formation of the stable CVFBb convertase relies on others than the expected mechanisms.

2. Materials and methods 2.1. Materials Human C3 was purchased from Calbiochem (Schwalbach, Germany) and native CVF from Naja kaouthia was purified according to established protocols (Vogel and Muller-Eberhard, 1984). Anti-C3 antibody was purchased from Cappel (Eschwege, Germany) and polyclonal anti-CVF-antibodies were raised in goat using purified native CVF. Streptactin was purchased from IBA (Göttingen, Germany). 2.2. Tissue culture CHO cells were cultivated in DMEM supplemented with 10% (v/v) heat-inactivated fetal calf serum, 100 U/ml penicillin, and 100 ␮g/ml streptomycin. Tissue culture reagents were obtained from Invitrogen Life Technologies (Karlsruhe, Germany). 2.3. Generation of expression plasmids for CVF and hC3 The full length cDNA of CVF, derived from pSPORT-CVF (Kock, 1996) was transferred into pUC18 via the KpnI and Eco105I restriction sites into KpnI and HincII restriction sites. Subsequently, the CVF cDNA was ligated into pcDNA3 (Invitrogen Life Technologies, Karlsruhe, Germany) using the KpnI and NotI restriction sites. The full length clone encoding human C3 was generated by combining the fragments from the pC3#11 and pC3#59 plasmids obtained from ATCC (59108; 59112) as described (Lao

et al., 1994). To minimise the irrelevant 5 -untranslated region a 218 bp fragment of the 5 -terminus of human C3 was amplified using the oligonucleotides S01 (CTGCTGACTAGTGCGGCCGCTATAAATATGGGACCCACCTCAGG TCC) and AS02 (TCTCACTGGACAGCACTAGTTTT) comprising restriction sites for SpeI and NotI. This fragment, restricted by SpeI, was inserted into the SpeI restriction site of C3. The newly arranged cDNA of human C3 finally was introduced into pcDNA3 by NotI and XbaI (Invitrogen Life Technologies, Karlsruhe, Germany). 2.4. Generation of the chimeras χ1 and χ2 Generation of the constructs ␹1 und ␹2 was performed on the basis of the CVF cDNA. Four different restrictions sites were inserted into the cDNA, flanking the particular domains to be substituted against corresponding domains of human C3. For generation of chimera ␹1 two fragments of CVF cDNA bearing restriction sites for XhoI and Psp5II were generated by PCR using the oligonucleotides S08 (GCACAACTACGTTAACGAGGATATTTATG), AS09 (TTTTGCTCGAGGGTCCAGTTTAACAATA), S10 (TATTGTTAAACTGGACCCTCGAGCAAAA) and AS11 (TCCATCAATTGAGTTTTCAATAATCTGAGCCACAGGGTCCCC). For generation of chimera ␹2, three fragments of CVF cDNA bearing restriction sites for SacII and NheI were generated using the oligonucleotides S12 (TCAGATTATTGAAAACTCAATTGATGGA), AS13 (GGTCCGCGGCAGCCAAAGCATAGGCTGTGAGGGC) and S14 (GCCCTCACAGCCTATGCTTTGGCTGCCGCGGACC), AS15 (CATTGTTGCTTTTCCATCACCGCTAGCTGTCAC) and S16 (GTGACAGCTAGCGGTGATGGAAAAGCAACAATG), AS17 (TATTCGAAGCAGCTTGGTTTTGTAG). After joining these fragments to two continuous cDNA fragments the obtained products were inserted via the restriction enzymes HpaI and MunI or MunI and BstBI, respectively, into the cDNA of CVF. The domains, incorporating the desired binding sites, were obtained from human C3 by amplification using the oligonucleotides S18 (GGACCTCGAGCAAAAGGAGTTGAAGGAGTGCAGAAAGAG) and AS19 (CACAGGGTCCCCTTGCAGGAGAATTCTGGTCT) for ␹1 and S47 (TGGCTGCCGCGGGCAGGCTGAAGGGGCCTCTTCT) and AS48 (TAGTGGCGATCGACACTGACACTTTGGGAGTAA) for ␹2. Employing the generated restriction sites, these fragments subsequently were introduced into the CVF cDNA. Finally the cDNA of the constructs ␹1 and ␹2 was transferred to pcDNA3 via the KpnI and NotI restriction sites. 2.5. Fusion of strep-tag II to the recombinant proteins For immobilisation of the recombinant proteins, a strep-tag II affinity-peptide and an enterokinase cleavage site were inserted into the cDNA of CVF, ␹1 and ␹2 and C3 between the signal sequence and the N-terminus of the CVF

J. Kölln et al. / Molecular Immunology 41 (2004) 19–28

␹-chain or C3 ␹-chain, respectively. Using the CVF cDNA, two DNA fragments were generated by PCR employing the oligonucleotides S23 (CGGAGGTACCATGGAGAGGATGGCTCTCTAT), AS34 (GTCTTTTTCGAACTGCGGGTGGCTCCACCCATGAGAAGACCCTGGAAA), S35 (ACCCGCAGTTCGAAAAAGACGATGACGATAAAGCTCTCTACACCCTCATCACCCC) and S26 (GATAGACACGTGGAAATTTTCATTGCCG). After joining the fragments, the resulting continuous cDNA fragment was inserted into pcDNA3CVF, pcDNA3␹1 and pcDNA3␹2 via the restriction sites of KpnI and Eco72I. Employing the cDNA of human C3, analogous fragments were generated and joined using the oligonucleotides S01 (CTGCTGACTAGTGCGGCCGCTATAAATATGGGACCCACCTCAGGTCC), AS36 (TCGAACTGCGGGTGGCTCCACCCCAGAGCCAGGGGGAGG), S37 (ACCCGCAGTTCGAAAAAGACGATGACGATAAAAGTCCCATGTACTCTATCATCACC) and AS03 (AGTACCTTCCGGCTCAGCACAACCTCC). The resulting fragment finally was inserted via restriction sites for NotI and Bpu1102I. 2.6. Transfection of CHO cells CHO cells cultured in DMEM supplemented with 10% (v/v) fetal calf serum were transfected with 2–4 ␮g of expression vector using Geneporter (Peqlab, Erlangen, Germany). For protein expression, transfected cells were grown for 3 days as adhesion culture. The proteins secreted by transfected CHO cells were obtained directly from the culture medium. 2.7. Generation of anti-CVF and anti-hC3 scFv Immunotubes (Nunc Maxisorb, Invitrogen Life Technologies, Karlsruhe, Germany) were coated with purified nCVF or hC3 (25 ␮g/ml in PBS) overnight at 4 ◦ C. The subsequent selection of the human scFv phage display library Griffin-1 essentially was performed as described (Griffiths et al., 1994). After two or three rounds of selection single colonies were randomly picked for further characterisation. 2.8. Analysis of immunoreactivity by ELISA For assessment of immunoreactivity 75 ␮l of phages (diluted 1:2 with PBS–milk powder (4%, w/v)) was applied to each well of a microtiter plate coated with nCVF or hC3 at 4 ◦ C overnight and blocked with PBS–milk powder (4%, w/v) at room temperature for 2 h. After incubation for 90 min at room temperature on a rocker platform, wells were rinsed three times each with PBS and PBS–tween 20 (0.1%, v/v), followed by adding to each well 100 ␮l anti-M13-horseradish peroxidase conjugate (Pharmacia Biotech, Freiburg, Germany) diluted 1:5000 in PBS–milk powder (2%, w/v). After incubation for 60 min at room temperature on a rocker platform, wells were rinsed again three times each with PBS and PBS–tween (0.1%, v/v),

21

and bound phages were detected by the addition of 75 ␮l of an 2,2 -azino-bis(2-ethylbenzthiazoline)-6-sufonic acid substrate solution (Sigma, Taufenstein, Germany) to each well. Absorbance was determined at 405 nm after 20 min of incubation at room temperature. 2.9. Expression and purification of monovalent scFv Selected scFv were produced in Escherichia coli HB2151 cells by infection of an exponentially growing culture with monoclonal phages coding the scFv in the phagemid vector pHEN2. Amber codons in the scFv were changed to glutamine using site specific-mutagenesis prior to infection and expression. Individual colonies were grown in 5 ml of 2YT medium (1% yeast extract, 2% peptone, 100 mM NaCl) at 37 ◦ C in a shaking incubator (250 rpm) until the culture reached OD600 of 1.0. To induce protein expression isopropyl-thiogalactoside was added to a final concentration of 1 mM. The cells were incubated for 3 h at 30 ◦ C, and then harvested at 2500 × g for 10 min. Periplasmic extracts were prepared according to established protocols and examined by SDS-PAGE and Western blotting. After dialysis against PBS soluble scFv were purified to homogeneity employing Ni-NTA-agarose (Qiagen, Hilden, Germany) according the manufacturers recommendations. 2.10. Determination of KD values Real-time monitored Biacore assays were performed using the Biacore® 3000 instrument (Biacore, Freiburg, Germany) and carboxylated dextran sensor chips (Sensor chip CM5, Biacore). Coupling of the scFv onto the sensor chip surface was performed according standard procedures recommended by the manufacturer. After activation of the sensor chips with 75 ␮l of N-hydroxy succinimide and N-ethyl-N -(dimethylaminopropyl)-carbodiimide at a flow rate of 5 ␮l/min, the antibody fragments (50 ␮g/ml in NaAc, pH 3.5) were coupled until the desired RU were reached. Afterwards the remaining activated carboxyl groups were inactivated with 50 ␮l of 1 M ethanolamine–HCl (pH 8.5). To determine the KD of the antibody fragments the particular antigens (nCVF or hC3) were diluted in Hepes-buffered saline containing 20 mM polysorbate (HBS-P, Biacore, Freiburg, Germany) and 50 ␮l containing various antigen concentrations injected at a flow rate of 10 ␮l/min. Regeneration of the senor chips was performed by injecting twice 5 ␮l of 12.5 mM NaOH. KD values were calculated using the Biaevaluation Software. 2.11. Precipitation using recombinant antibodies Ten microliters of particular antibody in PBS were incubated with Ni-NTA-agarose for 3 h at 4 ◦ C. Subsequently, the matrix was centrifuged at 700 × g for 7 min and the supernatant was discarded. Either supernatants of transient

22

J. Kölln et al. / Molecular Immunology 41 (2004) 19–28

expressions or proteins diluted in PBS were added to the matrix. After incubation overnight at 4 ◦ C and centrifugation at 700 × g for 7 min, the matrix was rinsed with 5 ml PBS and recentrifuged at 700 × g for 7 min. The matrix was resuspended in 1 ml PBS and transferred to micro-spin-columns (Biorad, Munich, Germany). Bound proteins were eluted by 300 mM imidazole in PBS and centrifugation at 80 × g for 1 min. For removal of the imidazole the eluate was dialysed overnight against PBS at 4 ◦ C in Slide-A-Lyzer Cassettes (0.5 ml, Pierce, Rockford, CA, USA). 2.12. Complement consumption assay To determine its anticomplementary activity CVF the complement consumption assay was carried out according to established protocols (Ballow and Cochrane, 1969) with slight modifications. For the generation of sensitised sheep erythrocytes whole sheep blood (Behringwerke, Mannheim, Germany) was centrifuged at 174 × g for 10 min at 4 ◦ C. The supernatant was discharged and the separated erythrocytes were rinsed three times with GVBS++ (2.5 mM Na-5,5-diethyl-barbituric acid, 143 mM NaCl, 0.75 mM MgCl2 , 0.15 mM CaCl2 , 0.1% gelatine, pH 7.4) until the supernatant remained clear. After resuspension in GVBS++ the erythrocytes were adjusted to a concentration of 5 × 108 cells/ml (30 ␮l lysed in 1 ml H2 O corresponds to an OD412 = 1.9) and incubated with anti-sheep-erythrocyte antibody (1:500, Sigma, Deisenhofen, Germany) for 1 h at 37 ◦ C. The sensitised sheep erythrocytes were rewashed three times with GVBS++ and adjusted to a concentration of 5 × 108 cells/ml. First, the amount of the human serum effecting 80% lysis of erythrocytes was determined. Serial dilutions of normal human serum in GVBS++ (40 ␮l) and control samples containing GVBS++ were incubated for 3 h at 37 ◦ C with vigorous shaking and then mixed with 100 ␮l GVBS++ and 30 ␮l sensitised sheep erythrocyte. After incubation for another 30 min at 37 ◦ C with vigorous shaking, the samples were chilled on ice, diluted with 850 ␮l ice-cold GVBS++ or water (for the water control) and centrifuged at 2000 × g for 2 min. Extinction of released hemoglobin was quantified at 405 nm. All samples were analysed in duplicates. The percentage of lysis was calculated according to the formula (sample − GVBS++ control)/(water control − GVBS++ control). The serum dilution effecting 80% lysis was applied to the subsequent complement consumption assays. To determine complement consuming activity of a CVF-containing sample (20 ␮l), the sample was mixed 20 ␮l GVBS++ containing normal human serum for 80% lysis of erythrocytes and incubated for 3 h at 37 ◦ C under vigorous shaking. After addition of 100 ␮l GVBS++ and 30 ␮l sensitised sheep erythrocytes, the samples were incubated at 37 ◦ C under vigorous shaking. Every 10 min of incubation control samples containing only GVBS++ were placed on ice, supplemented with 850 ␮l ice-cold GVBS++

or water, centrifuged at 2000 × g for 2 min, and measured until serum control reached approximately 80% of the water control. Then all samples including residual control samples were placed on ice and processed as described above. All samples were analysed as duplicates. The percentage of lysis of a particular samples was determined according to formula (CVF-containing sample − GVBS++ control)/(serum control − GVBS++ control). 2.13. Solid phase complement consumption assay of strep-tag II-derivatised proteins Streptactin (3 ␮g in 40 ␮l 0.1 M NaHCO3 , pH 9.5) was immobilised onto polystyrene supports overnight at 4 ◦ C. Thereafter, the wells were rinsed three times with 200 ␮l PBS–tween 20 (0.1%, v/v) and blocked with PBS–BSA (3%, w/v). After washing three times with PBS–tween 20 (0.1%, v/v), different volumes of the supernatants of transient expressions were applied to the wells. After incubation overnight at 4 ◦ C under agitation, the wells were rinsed three times with PBS–tween 20 (0.1%, v/v). Subsequently, 60 ␮l GVBS++ containing normal human serum for 80% lysis of sensitised erythrocytes were added and the ELISA plate was incubated for 3 h at 37 ◦ C under vigorous shaking at 150 rpm (InnovaTM , New Brunswick Scientific, Nürtingen, Germany). Subsequently, the supernatants were transferred into 2 ml reaction tubes, mixed with 100 ␮l of GVBS++ and 30 ␮l of sensitised erythrocytes, and assayed for complement consumption. 2.14. Other methods SDS-PAGE, Western blotting and ELISA as well as standard procedures in molecular biology were performed according to established protocols (Ausubel, 1996).

3. Results 3.1. Transient expression of CVF, hC3, χ1 and χ2 in mammalian cells Utilising CVF as framework, two chimeric proteins were designed, in which putative sites for binding or cleavage by regulatory proteins were substituted by corresponding hC3 domains (Fig. 1B). In the first of these two constructs, ␹1, a 33 amino acid fragment corresponding to a putative binding site of factor B in C3 was substituted (O’Keefe et al., 1988). The 144 amino acid fragment, substituted in the second construct, ␹2, is responsible for binding of factor H in hC3 and provides cleavage sites for the regulatory factor I (Davis and Harrison, 1982; Lambris et al., 1988). For expression of the recombinant CVF and human C3 constructs in CHO cells, the full length cDNA including the original leader signal were combined with regulatory elements like the

J. Kölln et al. / Molecular Immunology 41 (2004) 19–28

23

Fig. 1. Structures of CVF, hC3, and derivatives. (A) Illustrated are the cDNA structures of CVF (white), hC3 (shaded in darker grey) and the two chimeric proteins ␹1 and ␹2. The N-terminal strep-tag II is indicated in black, the 3 untranslated regions in lighter grey, and the hatched areas represent the substituted regions in ␹1 and ␹2. (B) Chain structures of nCVF, rCVF, and hC3.

cytomegalovirus promoter and the bovine growth hormone adenylation signal. After cloning of the expression plasmids and subsequent transfection of CHO cells, CVF, ␹1, and C3 were directly detectable in the culture supernatants by SDS-PAGE and Western blotting (Fig. 2). The expression levels of these constructs were found to be in the range of 1 ␮g/ml. For detection of the chimeric CVF derivative ␹2 the supernatant had to be concentrated. Under non-reducing conditions the apparent molecular masses of recombinant CVF, its derivatives ␹1 and ␹2, and hC3 were in the range of 200 kDa (Fig. 2A). SDS-PAGE analyses under reducing conditions revealed two bands for rCVF, one of them corresponding to the alpha-chain of nCVF and the other with a higher molecular mass corresponding to the gamma- and beta-chain of nCVF joined by the region homologous to C3d (Fig. 2B).

3.2. Functional analysis of immobilised proteins Due to the presence of interfering components in supernatants of transient expressions, the complement consumption activity of rCVF and the two CVF-derivatives could not be analysed without prior purification. In the first approach, rCVF, ␹1, ␹2, and hC3 were derivatised with the strep-tag II (St) octapeptide at the C-terminus of the leader sequence and an additional enterokinase cleavage site. After generation of the constructs transfection of CHO cells yielded strep-tag II-derivatised CVF, hC3 and the two chimeric proteins. The expression efficiency of these fusion proteins was comparable to that of the untagged proteins and their apparent molecular masses of approx. 200 kDa indicated an analogous processing pattern as observed with the non-tagged proteins.

Fig. 2. Gelelectrophoretic and Western blot analyses of transiently expressed proteins. (A) Native and recombinant proteins in culture supernatants of transiently transfected CHO cells were separated by SDS-PAGE (7.5%) under non-reducing conditions, transferred to a nitrocellulose-membrane and detected with goat anti-CVF antibody (nCVF, rCVF, ␹1, ␹2) or goat anti-C3 antibody (both diluted 1:1000 in PBS–milk powder (2.5%, w/v)) and anti-goat-IgG conjugated to alkaline phosphatase (diluted 1:10.000). (B) nCVF (lane 1), rCVF (lane 2), and hC3 (lane 3) were separated by SDS-PAGE (10%) under reducing conditions, transferred to a nitrocellulose-membrane and detected as described in (A).

24

J. Kölln et al. / Molecular Immunology 41 (2004) 19–28

Fig. 3. Analyses of the recombinant proteins via strep-tag II. (A) Immobilisation of transiently strep-tag II-derivatised proteins onto streptactin-coated supports was analysed by ELISA. Detection of the bound proteins was performed using anti-CVF or anti-hC3 polyclonal antibodies from goat, diluted 1:1000 in PBS–BSA (1.5%, w/v), and anti-goat HRP-conjugate, diluted 1:1000 in PBS–BSA (1.5%, w/v). Controls (open bars) were performed by omission of streptactin. (B) The complement consumption activity of the strep-tag II-derivatised proteins (St: strep-tag II) was analysed after immobilisation onto streptactin-coated supports as described in Section 2.

Strep-tag II-derivatised CVF, ␹1, and C3 present in supernatants of transient expressions could be immobilised onto streptactin-coated polystyrene supports (Fig. 3A). Using these immobilised proteins for a solid phase complement consumption assay, CVF and the chimera ␹1 exhibited hemolysis in the range of approx. 70% of control (Fig. 3B). The chimera ␹2 did not exhibit a significant complement consumption activity, most likely due to insufficient amounts immobilised onto the solid support. Human C3 was used as a negative control. Precipitation of the strep-tag II-derivatised proteins with streptactin-coated beads, however, was found to be not suitable for enrichment of the recombinant proteins. 3.3. Functional analysis of immunoprecipitated proteins In a second approach we developed monoclonal reagents for purification and immobilisation of the recombinant proteins.

The synthetic human scFv phage display library Griffin-1 was subjected to selection against native CVF and human C3 and after two or three rounds of selection a significant enrichment of the library was observed (data not shown). The reactivity of phage-displayed antibodies was confirmed by ELISA (Fig. 4). Despite the homology of hC3 and CVF, recombinant phages selected against native CVF did not show cross-reactivity with hC3 and vice versa hC3-specific phages did not bind to CVF (data not shown). The primary structure of the heavy and light chain variable regions of a panel of reactive scFv were determined by DNA sequencing and the composition of the CDR analysed according to the Kabat numbering scheme (Fig. 5) (Kabat et al., 1991). As a reflection of the synthetic nature of the library, amber codons were found in some clones. These were replaced by single base mutations encoding for glutamate, the amino acid incorporated in TG1 suppressor cells instead of initiating a translation stop. Recombinant expression into the

J. Kölln et al. / Molecular Immunology 41 (2004) 19–28

25

Fig. 4. Immunoreactivity of phage-displayed anti-CVF and anti-C3 antibodies. The immunoreactivity of selected clones against CVF (black bars) and hC3 (grey bars) was analysed by ELISA as described in Section 2. Controls (open bars) were performed by omission of antigen.

periplasm yielded soluble antibody fragments, which were purified by immobilised metal ion affinity chromatography using Ni-NTA. The scFv CVF-29 and scFv C3-22 were found to be expressed in substantial amounts. Subsequent binding studies in surface plasmon resonance-based Biacore analyses revealed dissociation constants of up to 10−8 M. For example, for scFv CVF-29 and scFv C3-22 dissociation

constants were determined to be 10−8 and 10−7 M, respectively. To assess their capacity for purification and immobilisation, the recombinant antibodies were bound to Ni-NTA-agarose beads and employed for precipitation of nCVF and hC3. Upon elution with imidazole samples containing CVF or C3 and the scFv were obtained (Fig. 6).

Fig. 5. Sequence analysis of isolated scFv. Numbering and determination of the CDR of the variable regions of heavy (vH ) and light chains (vL ) were performed according to Kabat. Analyses of the v segment usage were performed by alignment to V-Base (MRC, Cambridge).

26

J. Kölln et al. / Molecular Immunology 41 (2004) 19–28

Fig. 6. Immunoprecipitation of CVF and hC3. The purified anti-CVF scFv CVF-29 and anti-hC3 scFv hC3-22 were utilised for precipitation of CVF (lanes 1 and 2) and hC3 (lanes 3 and 4) as described in Section 2. Eluates were analysed by SDS-PAGE under non-reducing conditions, followed by staining with coomassie blue (lanes 1 and 3) or transfer to a nitrocellulose-membrane (lanes 2 and 4). After incubation overnight with anti-CVF and anti-hC3 antibodies (diluted 1:1000) the proteins were detected using anti-goat alkaline phosphatase conjugate (diluted 1:10 000).

After removal of imidazole by dialysis the eluted protein fractions, consisting of CVF and the scFv used for precipitation, were characterised for their complement consumption in comparison to nCVF. These protein fractions exhibited activity in a dose-dependent manner corresponding to the dose response curves obtained with purified nCVF in the absence of scFv. All anti-CVF antibody fragments utilised for immunoprecipitation yielded functional protein fractions. Comparison of immunoprecipitated rCVF obtained from CHO cells with nCVF demonstrated that both proteins display identical activity (Fig. 7). This precipitation procedure then was applied for the analysis of the chimeras (Fig. 8). Chimera ␹1 exhibited hemolysis in the range of approx. 70% of control as observed after immobilisation by strep-tag II. Recombinant hC3, as expected, did not demonstrate any complement consumption activity. Additionally, the chimera ␹2, which so far failed in characterisation due to its reduced concen-

Fig. 8. Complement consumption activity of the immunoprecipitated recombinant proteins. The complement consumption activity of the recombinant proteins was analysed after immunoprecipitation from supernatants of transient expressions using anti-CVF scFv CVF-29 and anti-C3 scFv hC3-1 as described in Section 2.

tration in supernatants, revealed a complement consumption activity comparable to ␹1 and CVF. Although nCVF, rCVF, and hC3 could be immobilised effectively utilising different recombinant antibodies, these fragments, however, proved to be not suitable for a solid phase complement consumption assay.

4. Discussion In this study we generated chimeras, composed of CVF and human C3, to elucidate the mechanisms conferring stability to the CVF-dependent C3 convertase. Both CVF/C3 chimeras, designed on the basis of putative binding or cleavage sites for factor B and regulatory proteins like factor H and factor I, represent a first approach to reveal structurefunction relationships of C3 and CVF and to explain the increased stability of the CVFBb convertase complex.

Fig. 7. Complement consumption activity of immunoprecipitated CVF. Immunoprecipitation of purified nCVF (panels A and B) and transiently expressed rCVF (panel C) with anti-CVF scFv CVF-29 (panels A and C) and anti-CVF scFv CVF-44 (panel B) and analysis of complement consumption activity was performed as described in Section 2. The complement consumption activity of immunoprecipitated CVF (open triangles) was compared to that of purified nCVF (filled squares). Shown are mean values and standard deviations from three independent determinations.

J. Kölln et al. / Molecular Immunology 41 (2004) 19–28

Although recombinant CVF has been expressed successfully as an active two-chain pro-protein in insect cells (Kock, 1996), we aimed for expression of CVF, hC3, and the chimeras in mammalian cells. The glycosylation patterns in mammalian cells appeared to be more appropriate, since glycosylation of CVF has been reported to be similar to that mammalian proteins (Gowda et al., 1994). Additionally, control of proper folding is tighter in mammalian cells. Export-incompetent immunoglobulin heavy chains, for example, are found to be secreted by insect cells (Kirkpatrick et al., 1995), but not by mammalian cells. In order to avoid the time consuming establishment of stably transfected cell lines for a panel of chimeras, we utilised supernatants of transient expressions for characterisation of the recombinant proteins. On the basis of SDS-PAGE analyses, CVF, human C3 and the two chimeras are proposed to be secreted in mammalian cells in identical processing state. The fact, that native C3 and rCVF obtained from insect cells as well as rCVF obtained from mammalian cells exhibit two-chain structures (Fig. 1B), suggests a similar structure of the two chimeras. Characterisation of the complement consuming activity of rCVF and the two chimeras, however, proved to be rather difficult utilising supernatants of transient expressions. Since the low concentration of the recombinant proteins as well as the presence of interfering components impede the evaluation of the recombinant molecules, we developed two different affinity-based assay procedures allowing the rapid and qualitative characterisation of rCVF, C3, and its derivatives. The first approach relies on the introduction of an affinity tag into the recombinant molecules, that allows for efficient immobilisation onto a solid support and purification from supernatants or cell lysates. Since neutral peptide tags have been employed successfully for a large number of proteins without impairment of activity (Kinoshita et al., 1998; Sardy et al., 1999; Zwicker et al., 1999; Wendt et al., 2000) we introduced one of these tags, the affinity peptide strep-tag II, into the recombinant proteins. The strep-tag II binds to streptactin, a descendant of streptavidin, with a KD value of 10−6 M (Schmidt et al., 1996). Based on the observation, that fusion of a his-tag to the C-terminus resulted in complete loss of C5 convertase activity (Kock, 1996) the strep-tag II was fused to the N-terminus of the mature protein. Using this approach the modified recombinant proteins could be immobilised efficiently onto polystyrene surfaces and analysed successfully for their complement consuming activity. The demonstration of complement consuming activity of the immobilised proteins indicates that binding of factor B and factor D as well as formation and activity of the convertase complex do not require accessibility of the N-terminus. Since the strep-tag II-derivatised chimera ␹2 could not be characterised by solid phase analysis, we established a second affinity-based procedure utilising recombinant antibodies. Employing phage display (Smith, 1985; McCafferty et al., 1990) of synthetic or semisynthetic antibody fragment (Griffiths et al., 1994; Hoogenboom et al., 1991; Barbas

27

et al., 1992), selection and bacterial expression can provide specific monoclonal antibody fragments as scFv, Fv (fragment variable) or Fab (antigen-binding fragment) (Skerra and Pluckthun, 1988; Huston et al., 1988). By selection of the human synthetic scFv phage display library Griffin-1 we generated a broad panel of specific anti-CVF and anti-C3 recombinant antibody fragments, providing a his-tag for purification and a myc-epitope for detection. The obtained antibody fragments were used for immobilisation of the recombinant proteins onto solid supports and for immunoprecipitation of the target proteins via Ni-NTA-agarose. Probably as a consequence of sterical hindrance, proteins immobilised via antibody binding did not demonstrate any functional activity. However, the protein fractions obtained by immunoprecipitation and subsequent elution from the matrix using imidazole exhibited significant complement consuming activities. Interestingly, all anti-CVF antibody fragments generated in this study provided active chimeras as well as CVF in the immunoprecipitates, indicating that the presence of the scFv in the eluates has no significant impact on the complement consumption activity. Since some of these antibodies probably bind directly or close to domains required for formation of the convertase, the restored activity is likely to be a result of continued dissociation of the complex, despite the relatively high affinity of the antibody fragments in the range of 10−8 M. This assumption is supported by the observation, that the complement consuming activity of CVF is inhibited to some extent when anti-CVF scFv are present at high molar excess. Surprisingly the two chimeras exhibited a complement consuming activity identical to CVF. The design of ␹1 was based on the observation that cleavage of human C3 by a cobra venom-specific protease generates the C3-derivative C3o, which retains the capability of binding to factor B. Since C3c is incapable to bind factor B, the amino acids 933 EGVQKEDIPP appear to be involved in binding of factor B (O’Keefe et al., 1988). The fact that insertion of this putative factor B binding site in the chimera ␹1 did not impair the complement consuming activity, suggests, that other amino acids are responsible for stabilisation of the CVF-dependent C3 convertase. Another postulated mechanism for stabilisation of the CVF-dependent C3 convertase relies on resistance against regulation by factor H and factor I (Lachmann and Halbwachs, 1975; Alper and Balavitch, 1976). Therefore, reintroduction of domains involved in binding of cofactor H and cleavage by factor I could effect destabilisation the CVF-dependent C3 convertase. Since the chimera ␹2 reveals complement consuming activity despite the introduction of domains involved in binding of cofactor H and cleavage by factor I it can be assumed, that factor H does not bind or binds in a non-functional manner. Thus, our results support the assumption, that the chimera as well as CVF escapes the cleavage by inaccessibility of the cleavage sites for factor I. To what extent the structural requirements for binding of cofactor H are fulfilled, remains to be determined.

28

J. Kölln et al. / Molecular Immunology 41 (2004) 19–28

In summary, the analyses of both chimeras demonstrate, that the substitution of two domains from C3, inserted into the CVF molecule, does not affect the formation of a stable C3 convertase. Our data suggest at least, that the corresponding domains in CVF do not play a key role in the mechanism of stabilisation. While additional chimeras are required to identify domains critical for stable binding of factor B in the CVF molecule, the methodology for such an approach has been successfully established in this study.

Acknowledgements We thank G. Winter (MRC Center, Cambridge, United Kingdom) for the semisynthetic Ab library. Gratefully acknowledged is the support of Mona Nagel and the critical reading of the manuscript by Susanne Deckers.

References Alper, C.A., Balavitch, D., 1976. Cobra venom factor: evidence for its being altered cobra C3 (the third component of complement). Science 191, 1275–1276. Ausubel, F.M., 1996. Current Protocols in Molecular Biology. Wiley Interscience, New York. Ballow, M., Cochrane, C.G., 1969. Two anticomplementary factors in cobra venom: hemolysis of guinea pig erythrocytes by one of them. J. Immunol. 103, 944–952. Barbas, C.F.3rd, Bain, J.D., Hoekstra, D.M., Lerner, R.A., 1992. Semisynthetic combinatorial antibody libraries: a chemical solution to the diversity problem. Proc. Natl. Acad. Sci. U.S.A. 89, 4457–4461. Davis, A.E.3rd, Harrison, R.A., 1982. Structural characterisation of factor I mediated cleavage of the third component of complement. Biochemistry 21, 5745–5749. Gowda, D.C., Petrella, E.C., Raj, T.T., Bredehorst, R., Vogel, C.W., 1994. Immunoreactivity and function of oligosaccharides in cobra venom factor. J. Immunol. 152, 2977–2986. Fritzinger, D.C., Bredehorst, R., Vogel, C.W., 1994. Molecular cloning and derived primary structure of cobra venom factor. Proc. Natl. Acad. Sci. U.S.A. 91, 12775–12779. Griffiths, A.D., Williams, S.C., Hartley, O., Tomlinson, I.M., Waterhouse, P., Crosby, W.L., Kontermann, R.E., Jones, P.T., Low, N.M., Allison, T.J., et al., 1994. Isolation of high affinity human antibodies directly from large synthetic repertoires. EMBO J. 13, 3245–3260. Grossmann, M., Wong, R., Teh, N.G., Tropea, J.E., East-Palmer, J., Weintraub, B.D., Szkudlinski, M.W., et al., 1997. Expression of biologically active human thyrotropin (hTSH) in a baculovirus system: effect of insect cell glycosylation on hTSH activity in vitro and in vivo. Endocrinology 138, 92–100. Hoogenboom, H.R., Griffiths, A.D., Johnson, K.S., Chiswell, D.J., Hudson, P., Winter, G., 1991. Multi-subunit proteins on the surface of filamentous phage: methodologies for displaying antibody (Fab) heavy and light chains. Nucleic Acids Res. 19, 4133–4137. Huston, J.S., Levinson, D., Mudgett-Hunter, M., Tai, M.S., Novotny, J., Margolies, M.N., Ridge, R.J., Bruccoleri, R.E., Haber, E., Crea, R., et al., 1988. Protein engineering of antibody binding sites: recovery of specific activity in an anti-digoxin single-chain Fv analogue produced in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 85, 5879–5883. Kabat, E.A., Wu, T.T., Reid-Miller, M., Perry, H.M., Gottesman, K.S., Foeller, C., 1991. Sequences of Proteins of Immunological Interest. National Institutes of Health, Washington, DC.

Kinoshita, T., Sato, H., Okada, A., Ohuchi, E., Imai, K., Okada, Y., Seiki, M., et al., 1998. TIMP-2 promotes activation of progelatinase A by membrane-type 1 matrix metalloproteinase immobilised on agarose beads. J. Biol. Chem. 273, 16098–16103. Kirkpatrick, R.B., Ganguly, S., Angelichio, M., Griego, S., Shatzman, A., Silverman, C., Rosenberg, M., et al., 1995. Heavy chain dimers as well as complete antibodies are efficiently formed and secreted from Drosophila via a BiP-mediated pathway. J. Biol. Chem. 270, 19800– 19805. Kock, M.A., 1996. Expression and characterisation of recombinant cobra venom factor. University of Hamburg, Hamburg, Wissenschaft und Technik Verlag Gross, Berlin, ISBN No. 3-89685-402-X, (US Patent No. 925442, 2001). Lachmann, P.J., Halbwachs, L., 1975. The influence of C3b inactivator (KAF) concentration on the ability of serum to support complement activation. Clin. Exp. Immunol. 21, 109–114. Lambris, J.D., Avila, D., Becherer, J.D., Muller-Eberhard, H.J., 1988. A discontinuous factor H binding site in the third component of complement as delineated by synthetic peptides. J. Biol. Chem. 263, 12147–12150. Lao, Z., Wang, Y., Mavroidis, M., Kostavasili, I., Lambris, J.D., 1994. Overexpression, purification, and characterisation of third component of complement. J. Immunol. Methods 176, 127–139. McCafferty, J., Griffiths, A.D., Winter, G., Chiswell, D.J., 1990. Phage antibodies: filamentous phage displaying antibody variable domains. Nature 348, 552–554. Medicus, R.G., Gotze, O., Muller-Eberhard, H.J., 1976. Alternative pathway of complement: recruitment of precursor properdin by the labile C3/C5 convertase and the potentiation of the pathway. J. Exp. Med. 144, 1076–1093. Muller-Eberhard, H.J., Fjellstrom, K.E., 1971. Isolation of the anticomplementary protein from cobra venom and its mode of action on C3. J. Immunol. 107, 1666–1672. O’Keefe, M.C., Caporale, L.H., Vogel, C.W., 1988. A novel cleavage product of human complement component C3 with structural and functional properties of cobra venom factor. J. Biol. Chem. 263, 12690– 12697. Possee, R.D., 1986. Cell-surface expression of influenza virus haemagglutinin in insect cells using a baculovirus vector. Virus Res. 5, 43–59. Sardy, M., Odenthal, U., Karpati, S., Paulsson, M., Smyth, N., 1999. Recombinant human tissue transglutaminase ELISA for the diagnosis of gluten-sensitive enteropathy. Clin. Chem. 45, 2142–2149. Skerra, A., Pluckthun, A., 1988. Assembly of a functional immunoglobulin Fv fragment in Escherichia coli. Science 240, 1038–1041. Schmidt, T.G., Koepke, J., Frank, R., Skerra, A., 1996. Molecular interaction between the Strep-tag affinity peptide and its cognate target, streptavidin. J. Mol. Biol. 255, 753–766. Smith, G.P., 1985. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science 228, 1315– 1317. Vogel, C.W., Muller-Eberhard, H.J., 1982. The cobra venom factor-dependent C3 convertase of human complement. A kinetic and thermodynamic analysis of a protease acting on its natural high molecular weight substrate. J. Biol. Chem. 257, 8292–8299. Vogel, C.W., Muller-Eberhard, H.J., 1984. Cobra venom factor: improved method for purification and biochemical characterisation. J. Immunol. Methods 73, 203–220. Vogel, C.W., Bredehorst, R., Fritzinger, D.C., Grunwald, T., Ziegelmuller, P., Kock, M.A., 1996. Structure and function of cobra venom factor, the complement-activating protein in cobra venom. Adv. Exp. Med. Biol. 391, 97–114. Wendt, U.K., Wenderoth, I., Tegeler, A., Von Schaewen, A., 2000. Molecular characterisation of a novel glucose-6-phosphate dehydrogenase from potato (Solanum tuberosum L.). Plant J. 23, 723–733. Zwicker, N., Adelhelm, K., Thiericke, R., Grabley, S., Hanel, F., 1999. Strep-tag II for one-step affinity purification of active bHLHzip domain of human c-Myc. Biotechniques 27, 368–375.