Identification and functional characterization of heat shock transcription factor1 in Litopenaeus vannamei

Fish & Shellfish Immunology 37 (2014) 184e192

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Identification and functional characterization of heat shock transcription factor1 in Litopenaeus vannamei Hui Yan a, Shuang Zhang a, Xiao-Yun Li a, Feng-Hua Yuan a, Wei Qiu a, Yong-Gui Chen b, Shao-Ping Weng a, Jian-Guo He a, b, *, Yi-Hong Chen b, * a

MOE Key Laboratory of Aquatic Product Safety, State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-sen University, 135 Xingang Road West, Guangzhou 510275, People’s Republic of China MOE Key Laboratory of Aquatic Product Safety, State Key Laboratory of Biocontrol, School of Marine Sciences, Sun Yat-sen University, 135 Xingang Road West, Guangzhou 510275, People’s Republic of China b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 16 December 2013 Received in revised form 24 January 2014 Accepted 24 January 2014 Available online 5 February 2014

Heat shock transcription factors belong to the heat shock factor (HSF) protein family, which are involved in heat shock protein (HSP) gene regulation. They are critical for cell survival upon exposure to harmful conditions. In this study, we identified and characterized a HSF1 (LvHSF1) gene in Litopenaeus vannamei, with a full-length cDNA of 2841 bp and an open reading frame encoding a putative protein of 632 amino acids. Through multiple sequence alignment and phylogenetic analysis, it was revealed that LvHSF1 was closed to insect HSF family, which contained a highly conserved DNA-binding domain, oligomerization domains with HR-A/B, and a nuclear localization signal. Tissues distribution showed that LvHSF1 was widely expressed in all tissues tested. And it was upregulated in hemocytes and gills after Vibrio alginolyticus or Staphylococcus aureus infection. Dual-luciferase reporter assays indicated that LvHSF1 activated the promoters of L. vannamei HSP70 (LvHSP70) and L. vannamei Cactus (LvCactus), while inhibited the expressions of Drosophila antimicrobial peptide (AMP) Atta, Mtk, and L. vannamei AMP PEN4 through NF-kB signal transduction pathway modification. Knocked-down expression of LvHSF1 by dsRNA resulted in downregulations of LvHSP70 and LvCactus, as well as cumulative mortality decreasing under V. alginolyticus or S. aureus infection in L. vannamei. Taken together, our data strongly suggest that LvHSF1 is involved in LvHSP70 regulation, therefore plays a great role in stress resistance. And it also takes part in LvCactus/LvDorsal feedback regulatory pathway modification of L. vannamei, which is in favor of V. alginolyticus or S. aureus infection. Ó 2014 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/3.0/).

Keywords: Litopenaeus vannamei Heat shock factor1 Cactus Nuclear factor-kappa B Antimicrobial peptide genes

1. Introduction Heat shock response was characterized by the induction of numerous heat shock proteins (HSPs) [1]. This response was mostly regulated at the transcription level by heat shock transcription factors (HSFs), which could specifically bind to heat shock element

* Corresponding authors. MOE Key Laboratory of Aquatic Product Safety, State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-sen University, 135 Xingang Road West, Guangzhou 510275, People’s Republic of China. Tel.: þ86 20 39332988; fax: þ86 20 39332849. E-mail addresses: [email protected], [email protected] (J.-G. He), [email protected] (Y.-H. Chen).

(HSE) in the promoters of heat shock genes [2]. HSE was composed of at least three inverted repeats of the consensus sequence nGAAn [3]. HSFs were first isolated from Saccharomyces cerevisiae [4,5] and Drosophila melanogaster [6], in which four HSFs (HSF1 to HSF4) were identified in vertebrates. HSFs had critical functions in developmental processes, in the maintenance of sensory organs and ciliated tissues, and in immune response [7e9]. HSFs also had major roles in lifespan and in the progression and maintenance of cancer [10,11]. They maintained protein homeostasis in these physiological and pathological processes by regulating the constitutive expressions of HSPs. Besides, they also involved in cell growth and differentiation by regulating the expression levels of genes, such as IL-6, FGFs, LIF, and p35 [7,9,12]. As reported, HSF1 had important functions in Caenorhabditis elegans immunity against Gram negative and Gram

http://dx.doi.org/10.1016/j.fsi.2014.01.020 1050-4648/Ó 2014 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/3.0/).

H. Yan et al. / Fish & Shellfish Immunology 37 (2014) 184e192

positive pathogens. The innate immunity of C. elegans could be activated by enhancing HSF-1 activity or by inducing the expression of HSF-1 [13]. Compared with HSFs, nuclear factor-kappa B (NF-kB) is better known in the invertebrate innate immunity. Studies had shown that the innate immunity against bacteria and fungi was governed largely by the NF-kB signal transduction pathways in invertebrates [14e18]. In D. melanogaster, Dorsal and Dif, which were presented in the cytosol and belonged to the class II NF-kB family, formed a complex with the homolog of the mammalian IkB protein Cactus [19]. Cactus masked the nuclear location signals of Dorsal and Dif, and prevented their migrations into the nucleus [14]. When activated by the Toll pathway in response to fungal or bacterial infections, Cactus was degraded, then Dorsal and Dif translocated into the nucleus to regulate the transcriptions of antimicrobial peptide (AMP) genes, such as Drs, Mtk, and Def [20]. The Pacific white shrimp Litopenaeus vannamei, a primarily farmed shrimp species, was the most important economic penaeid shrimp worldwide [21]. And L. vannamei was significantly challenged by shrimp diseases induced by bacterial or viral infections, resulted in a high mortality and devastating economic losses [22e24]. Interestingly, more than 10 HSF binding sites existed within the promoter regions of Fenneropenaeus chinensis Cactus (FcCactus), as well as L. vannamei Cactus (LvCactus) [25]. In present study, we cloned an LvHSF1 gene and investigated its functions. Our results showed that LvHSF1 was involved in stress resistance by inducing the expression of LvHSP70, and engaged in NF-kB signal transduction pathway by upregulating the expression of LvCactus, which made L. vannamei more susceptible to Vibrio alginolyticus or Staphylococcus aureus infection.

185

Table 1 Summary of primers used in this study. Name For cDNA cloning DPHSF1-Fa DPHSF1-Ra LvHSF1-50 RACE1 LvHSF1-50 RACE2 LvHSF1-30 RACE1 LvHSF1-30 RACE2 For real-time RT-PCR LvHSF1-F LvHSF1-R LvEF-1a-F LvEF-1a-R For protein expressionb pAcB-LvHSF1-F pAcB-LvHSF1-R For RNAi dsRNA-LvHSF1-F dsRNA-LvHSF1-F dsRNA-LvHSF1-T7-F dsRNA-LvHSF1-T7-R a b

Primer sequences (50 -30 ) MGNCARYTIAAYATGTAYGG TTIACDATYTGYTGYTGYTT CACAGAAGGGCAAAAATAAGTCC CAGTTTCAACAGCCACAGCAG CCAGTGGCAGCAATGGTGTG ACGCACCACTCAGTCCAGAAC TGCTGAACTCAAAGGGCTACAC AGTGGACGGTTGGATAACATTTC GTATTGGAACAGTGCCCGTG ACCAGGGACAGCCTCAGTAAG CGGGGTACCATGGCAAGCTTTGTGAGACAGC TTGCGGCCGCGCCATCTAGCTCTTTCTTTATG ACGGACTACGAGGGCAACG GAAACCCGTTCAAGTTGGATATG GGATCCTAATACGACTCACTATAGGACGG ACTACGAGGGCAACG GGATCCTAATACGACTCACTATAGGGAAACCC GTTCAAGTTGGATATG

I ¼ Inosine; M ¼ A or C; N ¼ A, C, G or T; R ¼ A or G; Y ¼ C or T; D ¼ A, G or T. Nucleotides in bold indicate restriction sites introduced for cloning.

2. Materials and methods 2.1. Microorganisms Gram-negative V. alginolyticus was cultured in a thiosulfatecitrate-bile salts-sucrose (TCBS) agar culture medium at 30  C for 18 h. Gram-positive S. aureus was cultured in a nutrient broth agar

Fig. 1. Nucleotide and deduced amino acid sequence of LvHSF1 from Litopenaeus vannamei. The nucleotide (lower row) and deduced amino acid (upper row) sequences are shown and numbered on the left. The initiation codon (ATG) and stop codon (TGA) are in boldface. The putative conserved domains of DBD are shaded, whereas the HR-A/B domains are in blue. The putative NLS is in red. The ploly(A) signals (aataaa) are boxed, and the 30 -UTR instability motifs (attta) are underlined. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

186

H. Yan et al. / Fish & Shellfish Immunology 37 (2014) 184e192

Fig. 2. Phylogenetic tree construction and multiple sequence alignment of HSF proteins from various species. (A) Phylogenetic tree analysis of the full-length amino acid sequences of HSF proteins was constructed by the neighbor-joining method and was bootstrapped 1000 times using the MEGA 5.0 software. LvHSF1 is boxed. (B) Multiple sequence alignment (using the Clustal X 2.0 programme) of the conserved domains of HSF proteins with the identical amino acid residues are shaded in black, and the similar residues are shaded in gray. Proteins analyzed list below: LvHSF1, L. vannamei HSF1 (Accession No. KC782836); Bthsf1, Bos taurus heat shock factor prtein 1 (Accession No. NP_001070277); BgHsf1, Bos grunniens mutus Heat shock factor protein 1 (Accession No. ELR54887); Rehsf1, Rucervus eldi heat shock transcription factor1 (Accession No. ACJ06400); Chhsf1, Capra hircus heat

H. Yan et al. / Fish & Shellfish Immunology 37 (2014) 184e192

at 37  C for 24 h. The V. alginolyticus and S. aureus cells were centrifuged at 5000 g for 10 min at 4  C, washed with 1  PBS (8 g NaCl, 0.2 g KCl, 1.44 g Na2HPO4, and 0.24 g K2HPO4, diluted with dH2O to 1 L with the pH adjusted to 7.3), and then resuspended in 1  PBS. The bacterial concentration was quantified as the microbial colony-forming units per milliliter (CFU/ml) and the bacterial solution adjusted to 106 CFU/ml. 2.2. Total RNA isolation and cDNA synthesis Healthy L. vannamei approximately 7 ge8 g were collected from a shrimp farm in Zhuhai, Guangdong Province, China. Total RNA was extracted from the tissue samples using an RNeasy Mini Kit (Qiagen, Germany). Residual genomic DNA was digested by RNasefree DNase _ (Qiagen, Germany). The total RNA was then reversetranscribed into first-strand cDNA using a PrimeScriptÔ First Strand cDNA Synthesis Kit (TaKaRa, China) for gene cloning. The cDNA samples were prepared for real-time RT-PCR analysis using a PrimeScriptÔ RT Reagent Kit (TaKaRa, China). The cDNA template was prepared using a SMARTerÔ RACE cDNA Amplification Kit (Clontech, USA) for the rapid amplification of cDNA ends (RACE)PCR. 2.3. Cloning of LvHSF1 from L. vannamei A 741 bp cDNA fragment of LvHSF1 was obtained by PCR using the cDNA templates and degenerate primers DPHSF1-F and DPHSF1-R (Table 1). The full-length cDNA of LvHSF1 was obtained by RACE based on the cDNA fragment. The primers LvHSF1 50 RACE1 and LvHSF1 30 RACE1 (Table 1) were used for the first round of 50 and 30 -end RACE-PCR with a thermal cycler under the following conditions: denaturation at 94  C for 3 min; 7 cycles of 94  C for 30 s, 62  C for 30 s (decreased by 1  C per cycle), and 72  C for 2 min; 32 cycles of 94  C for 30 s, 57  C for 30 s, and 72  C for 2 min; and a final extension at 72  C for 3 min. The conditions for the second round of 50 - and 30 -end PCR using LvHSF1 50 RACE2 and LvHSF1 30 RACE2 (Table 1) were the same as those for the first round. The PCR products were cloned into the pMD19-T vector (TaKaRa, China) and then sequenced. 2.4. Sequence and bioinformatics analysis Sequences were analyzed by BLAST program at the National Center for Biotechnology Information (NCBI) server. Clustal X 2.0 program was used to perform multiple sequence alignments. The deduced amino acid sequence of LvHSF1 was analyzed using the simple modular architecture research tool (http://smart.emblheidelberg.de). A neighbor-joining phylogenic tree was constructed by MEGA 4.0 software (http://www.megasoftware.net/ index.html) based on the deduced amino acid sequences of the related genes in typical species. Bootstrap sampling was reiterated 1000 times. 2.5. Immune challenges and real-time RT-PCR analysis Fifteen L. vannamei were sacrificed to obtain the eyestalks, gills, hemocyte, hearts, hepatopancreases, stomachs, intestines, nerves,

187

muscles, pyloric caecums, seminal vesicle, and epitheliums for tissue expression analysis. For immune challenge experiments, healthy L. vannamei was intramuscularly injected at the third abdominal segment with 50 mL of V. alginolyticus (7.0  106 CFU/g), 50 mL of S. aureus (4.5  106 CFU/g), and 50 mL of phosphate-buffered saline (PBS; control), respectively. The hemocytes and gills of the challenged L. vannamei were sampled at 0, 4, 8, 12, 24, 36, 48, and 72 h post injection (hpi), and three shrimps from each group were randomly selected. Real-time RT-PCR assays were carried out with a Roche LightCycler480 thermal cycler (Roche Applied Science, Germany). The fold changes in gene expression were calculated using the relative standard curve method [26]. Three replicate qPCRs were performed per sample. LvEF-1a (GenBank Accession No. GU136229) was used as internal control. The primer sequences are listed in Table 1. 2.6. Plasmid construction For protein expressions in Drosophila Schneider 2 (S2) cells, pAc5.1/V5-His B (Invitrogen, USA) and the PCR products amplified with pAcLvHSF1F and pAcLvHSF1R were digested with the same restriction enzymes Kpn_ and Not_ (Takara, China) and then purified. The mixture was ligated at 4  C overnight and then transformed into DH5a-competent cells. Positive clones were confirmed by colony PCR and sequenced. In previous studies [14,15,17,18,27], the expression vectors of pAC5.1-eGFP, pAC5.1-LvCactus and pAC5.1-LvDorsal were constructed. In this study, five luciferase reporter vectors were also constructed using the promoter sequences of the following genes: the Drosophila AMP Attacin (Atta, Accession No. CAA86995), Metchnikowin (Mtk, Accession No. AAF58139), the L. vannamei AMP penaeidin-4 (PEN4, Accession No. AF390147), HSP70 (Accession No.AAT46566), and Cactus (Accession No. JX014314). Luciferase reporter genes, including pGL3-Atta, pGL3-Mtk, pGL3-PEN4, and pGL3-LvCactus are regulated through NF-kB signal transduction activation [16e18,27e29]. 2.7. Dual luciferase reporter assays No permanent shrimp cell line was available. Hence, Drosophila hemocyte-derived S2 cells were used to perform functional analysis of LvHSF1 [16,20,27,30]. S2 cells were maintained at 27  C in Drosophila serum-free medium (Invitrogen, USA) supplemented with 10% fetal bovine serum (Invitrogen, USA). S2 cells were seeded overnight before transfection, and the plasmids were transfected with Cellfectin II reagent (Invitrogen, USA) following the manufacturer’s instructions. S2 cells in 96-well plates (TTP, Switzerland) were co-transfected using 0.3 mg of expression plasmids, 0.2 mg of reporter gene plasmids and 0.02 mg of pRL-TK renilla luciferase plasmid (Promega, USA) per well. The pRL-TK renilla luciferase vector was transfected as an internal control. After 48 h, the cells were harvested and lysed to examine the protein expression. The firefly and renilla luciferase activities were measured using the Dual-luciferase Reporter Assay System (Promega, USA) according to the manufacturer’s instructions. All assays were performed in three independent transfections.

shock transcription factor1 (Accession No. AFN69446); Sshsf1, Sus scrofa heat shock transcription factor1 (Accession No. NP_001230748); Pthsf1, Pan troglodytes heat shock factor protein 1 (Accession No. BAK63583); HgHsf1, Heterocephalus glaber Heat shock factor protein 1 (Accession No. EHB16894); Mmhsf1, Mus musculus heat shock factor1 (Accession No. EDL29570); Rnhsf1, Rattus norvegicus heat shock transcription factor1 (Accession No. NP_077369); Xlhsf, Xenopus laevis heat shock factor protein (Accession No. NP_001084036); DrHsf1, Danio rerio Hsf1 protein (Accession No. AAI34899); HaHSF, Haliotis asinina HSF (Accession No. ABR15461); CfHsf, Camponotus floridanus Heat shock factor protein (Accession No. EFN73771); Dphsf, Danaus plexippus heat shock transcription factor (Accession No. EHJ73660); Mbhsf, Mamestra brassicae heat shock transcription factor (Accession No. BAG07219); Pvhsf, Polypedilum vanderplanki heat shock factor (Accession No. ADM13379); DyHsf, Drosophila yakuba Hsf (Accession No. XP_002091977); Dmhsf, Drosophila melanogaster heat shock factorLRRFIP2 (Accession No. NP_476575).

188

H. Yan et al. / Fish & Shellfish Immunology 37 (2014) 184e192

2.8. Synthesis of double-stranded RNAs The DNA templates of LvHSF1 dsRNA (designated as dsLvHSF1) were prepared by PCR with the primer pairs of dsLvHSF1-T7-F/ dsLvHSF1-R and dsLvHSF1-F/dsLvHSF1-T7-R (Table 1). The products with T7 promoter were confirmed by sequencing, used as templates for sense and antisense strands of RNAs, and then subjected to in vitro transcription with the RiboMAXÔ Large Scale RNA production System-T7 (Promega, USA) following the manufacturer’s protocols. After the reaction, the DNA templates were incubated at 37  C with RNase-Free DNase (1 U/1 g) for 15 min. The in vitro-transcribed RNA products were subjected to phenol/chloroform extraction, followed by isopropanol precipitation. An equal amount of sense and antisense RNAs were annealed to each other to obtain dsRNA in a reaction containing 1  annealing buffer [20 mM potassium acetate, 6 mM HEPESeKOH (pH 7.4), 6 mM MgOAc] at 90  C for 2 min. The temperature was gradually decreased to 37  C, held for 1 h, and then placed at room temperature for another 1 h. The leftover single-stranded RNA template and the single-stranded overhang were degraded by incubating the annealed product with 0.1 mg of RNaseA at 37  C for 10 min, followed by phenol/chloroform extraction and isopropanol precipitation. DsLvHSF1 was 430 bp long, whereas the EGFP dsRNA (designated as dsEGFP) templates prepared by PCR with the primer pairs dsEGFP-T7-F/dsEGFP-R and dsEGFP-F/dsEGFP-T7-R (Table 1) were 504 bp long [31]. 2.9. Bioassay of bacterial challenge tests in LvHSF1 knocked-down L. vannamei by RNA interference (RNAi) The shrimps treated with dsLvHSF1 or dsEGFP were sacrificed after dsRNA injections and their hemocytes were collected to investigate the efficiency of RNAi in this study. The untreated shrimps were also collected as control samples. A total of 450 L. vannamei weighing 4e5 g were divided into three groups (150 specimens per group) for the V. alginolyticus (7.0  106 CFU/g), S. aureus (4.5  106 CFU/g), and PBS challenges, respectively. Each group was further subdivided into three subgroups (50 specimens per group) for the different dsRNA silencing treatments, in other words, injection with dsLvHSF1, dsEGFP, or PBS. L. vannamei was challenged with V. alginolyticus, S. aureus, or PBS at 2 d after dsRNA injection. The cumulative mortality was recorded every 8 h. SemiPCR assays were performed using LvEF1a as the internal reference. The primers sequences were listed in Table 1. 2.10. Expressions of LvHSP70 and LvCactus in LvHSF1 knockeddown L. vannamei The specific primers (Table 1) of LvHSP70 and LvCactus were designed based on the published L. vannamei cDNA sequences of HSP70 (Accession No. EF495128) and Cactus (Accession No. JX014314). The expression levels of the two genes at the detected time points after PBS, dsEGFP and dsLvHSF1 injections were measured using real-time RT-PCR.

indicated that HSFs from different species were highly conserved with a DNA-binding domain (DBD) and HR-A/B domains during evolution [32]. Phylogenetic analysis showed that LvHSF1 contained a highly conserved DNA-binding domain at its N-terminus. The oligomerization domains with HR-A/B were also found in LvHSF1. Furthermore, a cluster of basic amino acids served as a nuclear localization signal (NLS) were at the C-terminus of LvHSF1 (Fig. 1). 3.2. Phylogenetic analysis and multiple alignment of LvHSF1 Multiple sequence alignment was performed, and a phylogenetic tree generated using the neighbor-joining method was constructed to investigate the relationship between LvHSF1 and other known HSFs (Fig. 2). The phylogenetic tree illustrated that these HSF proteins could be divided into two classes. Class 1 contained the vertebrate HSFs: Bthsf1 (Bos taurus), BgHsf1 (Bos grunniens), Rehsf1 (Rucervus eldi), Chhsf1 (Capra hircus), Sshsf1 (Sus scrofa), Pthsf1 (Pan troglodytes), HgHsf1 (Heterocephalus glaber), Mmhsf1 (Mus musculus), Rnhsf1 (Rattus norvegicus), Xlhsf (Xenopus laevis), and DrHsf1 (Danio rerio). Class 2 contained the invertebrate HSFs: LvHSF1, HaHSF (Haliotis asinina), CfHsf (Camponotus floridanus), Dphsf (Danaus plexippus), Mbhsf (Mamestra brassicae), Pvhsf (Polypedilum vanderplanki), DyHsf (Drosophila yakuba), and Dmhsf (D. melanogaster). Among these, LvHSF1 was mostly closed to the insect HSF proteins (Fig. 2(A)). The amino acids identity between LvHSF1 and CfHsf was 53%, between LvHSF1 and Dmhsf was 52% (Fig. 2(B)). 3.3. Tissue distribution of LvHSF1 in healthy L. vannamei LvHSF1 was detected in all the tissues examined (Fig. 3), and its relative expression levels in other tissues were normalized to that in the seminal vesicle. The results showed that LvHSF1 was lowly expressed in seminal vesicle, hepatopancreas, and epithelium, while highly expressed in heart, intestines and gills, with levels of w27.9, w17.7, and w13.2-fold greater than in the seminal vesicle respectively (Fig. 3). 3.4. Expressions of LvHSF1 in hemocytes and gills in V. alginolyticus or S. aureus challenged L. vannamei Expressions of LvHSF1 in hemocytes and gills of L. vannamei that infected with V. alginolyticus or S. aureus were investigated at 0, 4, 8, 12, 24, 36, 48, and 72 h post infection (hpi). The expression level at 0 h was used as the baseline, and the corresponding expression in the PBS group was used as the control group. The expressions of LvHSF1 in V. alginolyticus challenged L. vannamei reached the peak

3. Results and discussion 3.1. Cloning and sequence analysis of LvHSF1 The full-length cDNA of LvHSF1 was 2842 bp long, including a 97 bp 50 -untranslated region (UTR) and an 846 bp 30 -UTR with a poly (A) tail (Fig. 1). The open reading frame (ORF) of LvHSF1 was 1899 bp long, encoding a putative protein of 632 amino acids with a calculated molecular weight of 69.04 kDa. The cDNA was submitted to NCBI GenBank under Accession No. KC782836. It has been

Fig. 3. Tissue distributions of LvHSF1 in healthy L. vannamei. Ten shrimps were used for tissue sampling. LvEF1a was used as the internal control; the relative expression of LvHSF1 in various tissues was compared against that in seminal vesicle.

H. Yan et al. / Fish & Shellfish Immunology 37 (2014) 184e192

values at 36 hpi in hemocytes and 12 hpi in gills, with a 2.95-fold and 1.69-fold higher than that of the control, respectively (Fig. 4(A)). While in S. aureus challenged L. vannamei, the expression of LvHSF1 increased 3.3-fold at 48 hpi in hemocytes, and 1.8fold in gills at 24 hpi, respectively (Fig. 4(B)). All these suggested that in hemocytes and gills, V. alginolyticus and S. aureus infections both upregulated the expression of LvHSF1. 3.5. LvHSF1 regulated the expressions of LvHSP70, as well as Atta, Mtk, PEN4 in S2 cells A previous study on F. chinensis showed that the promoter of FcCactus contains various transcription factor binding sites, such as HSF binding sites and AP-1 binding site [25]. HSF binding sites also exist in the promoter region of LvCactus and LvHSP70. Through dual luciferase reporter assays, we found that LvHSF1 increased the promoter activities of LvHSP70 and LvCactus by w46.3- and w35.5-fold, respectively (Fig. 5(A)). Meanwhile, LvDorsal overexpression upregulated the expression levels of Atta, Mtk, and PEN4 by w11.2-, w13.7-, and w25.2-fold, respectively. LvHSF1 but not eGFP significantly offset the LvDorsaldependented upregulations of Atta, Mtk, and PEN4 (Fig. 5(B)). In addition, LvHSF1 overexpression reduced the expression levels of Atta, Mtk, and PEN4 (Fig. 5(B)). These results suggested that LvHSF1 might be likely involved in the NF-kB signal transduction pathway by upregulating the expression of LvCactus. The overexpression of the IkB homolog LvCactus in L. vannamei could down regulate the expressions of shrimp AMPs [33]. In this study, reporter gene assay analysis showed that LvHSF1 could up regulate the expression of LvCactus. And we also found that overexpression of LvCactus down regulated the activities of Atta, Mtk and PEN4 by w0.44-, w0.38-, and w0.42-fold, respectively (Fig. 5(C)). Moreover, LvHSF1 intensified the downregualtions of LvCactu on Atta, Mtk and PEN4 by w1.83-, w1.32-, and w2.81-fold, respectively.

189

3.6. Downregulation of LvHSF1 expression leaded to LvHSP70 and LvCactus expressions decreasing, and reduced the cumulative mortalities of V. alginolyticus or S. aureus infected L. vannamei In LvHSF knocked-down L. vannamei, relative expressions of LvHSP70 and LvCactus were both decreased at all detected time points (Fig. 6). This revealed that the downregulation of LvHSF1 also decreased the expressions of LvHSP70 and LvCactus, confirmed the role of LvHSF1 in regulating the LvHSP70 in L. vannamei. DsLvHSF1 injection dramatically reduced the expression of LvHSF1 in the hemocytes at 2 d after injection, while dsEGFP injection did not induce the downregulation of LvHSF1 expression in the hemocytes (Fig. 7(A)). In V. alginolyticus or S. aureus challenge tests, cumulative mortality reached 100% within 136 hpi for nodsRNA treatment group. DsEGFP injection failed to protect shrimp from V. alginolyticus or S. aureus infection, and the cumulative mortalities were similar with the no-dsRNA treatment groups. In the V. alginolyticus challenge test, shrimp treated with dsLvHSF1 had a lower cumulative mortality, especially at 128 hpi and 136 hpi (Fig. 7(B)). The final mortality rates were 66.7%, 86.0%, and 97.7% for the dsLvHSF1, dsEGFP, and PBS groups, respectively (Fig. 7(B)). And in the S. aureus challenge test, shrimp treated with dsLvHSF1 had a lower cumulative mortality, especially during 56 hpi to 72 hpi (Fig. 7(C)). These results supported the assumption that LvHSF1 might be in favor of V. alginolyticus or S. aureus infection. 4. Discussion We previously identified L. vannamei p38 (Lvp38) and analyzed its function. Similar to D. melanogaster p38, Lvp38 can activate the expressions of Drosophila and shrimp AMP genes, and can knockdown Lvp38 by RNAi, making L. vannamei more susceptible to bacterial infections. These results suggest that Lvp38 may be involved in anti-bacterial infections through the NF-kB pathway. A previous study reported that HSF activation by p38 is an important

Fig. 4. Temporal expression of LvHSF1 in immune challenged L. vannamei. The relative expression of LvHSF1 in the groups treated with Vibrio alginolyticus in hemocytes (A(a)) and gills (A(b)), and Staphylococcus aureus in hemocytes (B(a)) and gills (B(b)) were compared with that in the control group. The relative expression level of the target genes was normalized to LvEF1a. The results are based on three independent experiments and expressed as mean values  S.D. Statistical significance was calculated using Student’s t-test (* indicates p < 0.05 and ** indicates p < 0.01 compared with the control).

190

H. Yan et al. / Fish & Shellfish Immunology 37 (2014) 184e192

Fig. 5. Dual luciferase reporter assays on Drosophila S2 cells. (A) Effects of LvHSF1 on the promoter activities of LvHSP70 and LvCactus in Drosophila S2 cells. (B) Effects of LvHSF1 on the promoter activities of Drosophila AMP genes (Atta and Mtk) and L. vannamei AMP gene (PEN4) in Drosophila S2 cells. (C) Intensify of LvHSF1 on LvCactusrepression Atta, Mtk and PEN4. The pRL-TK Renilla luciferase plasmid served as an internal control. All data are representative of three independent experiments. The bars indicate the mean  S.D. of the luciferase activity (n ¼ 3). The statistical significance was calculated using Student’s t-test (* indicates p < 0.05 and ** indicates p < 0.01 compared with the control).

part of antimicrobial reactions in flies [34]. In L. vannamei, LvHSF1 downregulated the expression levels of Atta, Mtk, and PEN4 by upregulating the expression of LvCactus. The transcription factor LvHSF1 can upregulate the expression of LvHSP70 and may be involved in L. vannamei stress remission. Moreover, the cumulative mortality of L. vannamei was lower in the dsLvHSF1 treatment group than in the control group in the bacteria challenge experiments. LvHSF1 also modified the L. vannamei LvCactus/LvDorsal feedback regulatory pathway by upregulating the expression of LvCactus, which was propitious to V. alginolyticus or S. aureus infection. HSF1 was a multifunctional protein, not only played a role in NF-kB signal transduction pathway regulation, but also took part in environmental stress responding [35]. In tissue distribution assays, the tissues with low expression of LvHSF1, such as seminal vesicle, hepatopancreas and epithelium, were always exposure to pathogens or their toxic productions, and suggested a high activity of NF-

Fig. 6. Expressions of LvHSP70 and LvCactus in hemocytes with LvHSF1 knocked-down. The relative expressions of LvHSP70 (A) and LvCactus (B) were compared against the PBS and dsEGFP injection groups. The mRNAs were collected at various time points (0 h, 12 h, 1 d, 2 d, 3 d, or 5 d) after injection with the indicated dsRNA. The expression level of LvHSF1 was measured by real-time RT-PCR. Relative expression levels were normalized to LvEF-1a. The results are based on three independent experiments and expressed as the mean values  S.D. The statistical significance was calculated by the Student’s t-test (* indicates p < 0.05 and ** indicates p < 0.01 compared with the control).

kB signal transduction pathway in these tissues. And LvHSF1 was highly expressed in intestine and gills, this might because LvHSF1 was much more sensitive to environmental stress among these tissues, although these tissues often exposure to pathogens too. Nowadays, HSF1 has also been found to be engaged in tumorigenesis, autophagy and so on [36,37]. The reasons why LvHSF1 was highly expressed in heart of L. vannamei needed a further investigation. HSPs, known as stress proteins and molecular chaperones, are a suit of highly conserved, broadly distributed proteins in nature [38,39]. In living organisms, the expression of HSPs increases in response to a wide range of stresses, such as heat, heavy metals, anti-inflammatory drugs, and bacterial and viral infections [38e 41]. HSPs in eukaryotes are categorized into six major families according to their molecular weights: small HSPs, HSP60, HSP70, HSP90, HSP100, and HSP110 [42,43]. LvHSP70 had a dominant function under heat shock, pH variations, and iron or zinc exposures [44]. It had been showed that 1 h of heat exposure could significantly induce the expression of HSP70 in the hepatopancreas of Penaeus monodon [45]. In another study, heat shock treatment dramatically induced the expression of FcHSP70 [46]. These studies emphasized that shrimp HSP70s had important functions in coping with stress resistance. In the present study, LvHSP70 was upregulated by LvHSF1 overexpression. This result suggested that LvHSF1

H. Yan et al. / Fish & Shellfish Immunology 37 (2014) 184e192

191

S. aureus upregulated the expression of LvHSF1 in the hemocytes. Considering that LvCactus was upregulated by LvHSF1, we speculate that V. alginolyticus and S. aureus infections also downregulate some AMPs, making the host more susceptible to the infections. We knocked-down the expression of LvHSF1 effectively by dsRNA injection. The results showed that cumulative mortality was decreased in the LvHSF1 knocked-down shrimp infected with V. alginolyticus or S. aureus. These results supported the assumption that LvHSF1 may be favor for V. alginolyticus or S. aureus infection. Above all, our study revealed that LvHSF1 could up regulate the expression of LvHSP70; LvHSF1 also modified LvCactus/LvDorsal feedback pathway in L. vannamei by upregulating the expression of LvCactus, which was propitious to V. alginolyticus or S. aureus infection. Acknowledgments This research was supported by the National High Technology Research and Development Program of China (973 Program) 2012CB114401, the National Natural Science Foundation of China under Grant No.31202017, Fundamental Research Funds for the Higher Learning Schools of Youth Teacher Education Program of Sun Yat-Sen University in 2013 under grant No.13lgpy04, the National Natural Science Foundation of China under Grant No.U1131002, the National Key Technology R&D program (2011BAD13B10, 2012BAD17B03), the China Agriculture Research System CARS-47, the Foundation of Administration of Ocean and Fisheries of Guangdong Province A201101B02, and the Open Project of the State Key Laboratory of Biocontrol (SKLBC09K04), National Technology system for shrimp (nycytx-46). Fig. 7. Knock-down expression of LvHSF1 decreased cumulative mortalities in L. vannamei after bacterial infections. (A) Semi-quantitative PCR analysis of LvHSF1 gene expression with LvEF1a as internal control. Shrimps (n ¼ 50) were intramuscularly injected with dsLvHSF1, dsEGFP, or PBS (control). At approximately 48 h after the initial injection, shrimps were infected with V. alginolyticus (B), S. aureus (C), or PBS (control). Cumulative mortality was recorded every 8 h after challenged.

might be involved in stress relieving in L. vannamei by activating the promoter activity of LvHSP70. Besides, it had been reported that LvHSP70 suppressed WSSV replication at high temperature [47]. Therefore, LvHSF1 might be engaged in WSSV inhibition at such situation, while it required more evidences to support this conclusion. The promoter regions of FcCactus and LvCactus contain several HSF binding sites [25]. In another published work, the overexpression of the IkB homolog LvCactus in L. vannamei can downregulate the activities of shrimp antimicrobial peptide promoters [33]. NF-kB signal transduction pathway in Drosophila is essential for anti-bacterial response by regulating the expressions of immune related genes, including AMPs [48e50]. In the present study, Expressions of Atta, Mtk, and PEN4 could be upregulated by LvDorsal; on the contrary, overexpression of LvCactus could inhibit the promoters activities of shrimp AMPs [33,51]. These results suggest that LvHSF1 may be involved in the NF-kB signal transduction pathway by upregulating the expression of LvCactus. AMPs in Drosophila and shrimp were principally controlled by the NF-kB signal transduction pathway [15]. And there were evidences showed that in human, HSF1 took part in the inhibition of NF-kB signal transduction pathway during the lung protection response to heat shock stimulation [52]. Our results showed that LvHSF1 enhanced the role of LvCactus on AMPs regulation, confirmed that LvHSF1 regulated AMPs through NF-kB signal transduction pathway. Real-time RT-PCR analyses showed that stimulation with gramnegative bacterial V. alginolyticus and gram-positive bacterial

References [1] Balch WE, Morimoto RI, Dillin A, Kelly JW. Adapting proteostasis for disease intervention. Science 2008;319:916e9. [2] Morimoto RI. Regulation of the heat shock transcriptional response: cross talk between a family of heat shock factors, molecular chaperones, and negative regulators. Genes Dev 1998;12:3788e96. [3] Fernandes M, Xiao H, Lis JT. Fine structure analyses of the Drosophila and Saccharomyces heat shock factoreheat shock element interactions. Nucleic Acids Res 1994;22:167e73. [4] Sorger PK, Pelham HR. Yeast heat shock factor is an essential DNA-binding protein that exhibits temperature-dependent phosphorylation. Cell 1988;54: 855e64. [5] Wiederrecht G, Seto D, Parker CS. Isolation of the gene encoding the S. cerevisiae heat shock transcription factor. Cell 1988;54:841e53. [6] Clos J, Westwood JT, Becker PB, Wilson S, Lambert K, Wu C. Molecular cloning and expression of a hexameric Drosophila heat shock factor subject to negative regulation. Cell 1990;63:1085e97. [7] Chang Y, Ostling P, Akerfelt M, Trouillet D, Rallu M, Gitton Y, et al. Role of heatshock factor 2 in cerebral cortex formation and as a regulator of p35 expression. Genes Dev 2006;20:836e47. [8] Takaki E, Fujimoto M, Nakahari T, Yonemura S, Miyata Y, Hayashida N, et al. Heat shock transcription factor 1 is required for maintenance of ciliary beating in mice. J Biol Chem 2007;282:37285e92. [9] Takaki E, Fujimoto M, Sugahara K, Nakahari T, Yonemura S, Tanaka Y, et al. Maintenance of olfactory neurogenesis requires HSF1, a major heat shock transcription factor in mice. J Biol Chem 2006;281:4931e7. [10] Morley JF, Morimoto RI. Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular chaperones. Mol Biol Cell 2004;15:657e64. [11] Dai C, Whitesell L, Rogers AB, Lindquist S. Heat shock factor 1 is a powerful multifaceted modifier of carcinogenesis. Cell 2007;130:1005e18. [12] Inouye S, Fujimoto M, Nakamura T, Takaki E, Hayashida N, Hai T, et al. Heat shock transcription factor 1 opens chromatin structure of interleukin-6 promoter to facilitate binding of an activator or a repressor. J Biol Chem 2007;282:33210e7. [13] Singh V, Aballay A. Heat shock and genetic activation of HSF-1 enhance immunity to bacteria. Cell Cycle 2006;5:2443e6. [14] Huang XD, Yin ZX, Liao JX, Wang PH, Yang LS, Ai HS, et al. Identification and functional study of a shrimp Relish homologue. Fish Shellfish Immunol 2009;27:230e8. [15] Huang XD, Zhao L, Zhang HQ, Xu XP, Jia XT, Chen YH, et al. Shrimp NF-kappaB binds to the immediate-early gene ie1 promoter of white spot syndrome virus and upregulates its activity. Virology 2010;406:176e80.

192

H. Yan et al. / Fish & Shellfish Immunology 37 (2014) 184e192

[16] Wang PH, Gu ZH, Huang XD, Liu BD, Deng XX, Ai HS, et al. An immune deficiency homolog from the white shrimp, Litopenaeus vannamei, activates antimicrobial peptide genes. Mol Immunol 2009;46:1897e904. [17] Wang PH, Gu ZH, Wan DH, Zhang MY, Weng SP, Yu XQ, et al. The shrimp NFkappaB pathway is activated by white spot syndrome virus (WSSV) 449 to facilitate the expression of WSSV069 (ie1), WSSV303 and WSSV371. PLoS One 2011;6:e24773. [18] Wang PH, Liang JP, Gu ZH, Wan DH, Weng SP, Yu XQ, et al. Molecular cloning, characterization and expression analysis of two novel Tolls (LvToll2 and LvToll3) and three putative Spatzle-like Toll ligands (LvSpz1-3) from Litopenaeus vannamei. Dev Comp Immunol 2012;36:359e71. [19] Steward R. Dorsal, an embryonic polarity gene in Drosophila, is homologous to the vertebrate proto-oncogene, c-rel. Science 1987;238:692e4. [20] Lemaitre B, Hoffmann J. The host defense of Drosophila melanogaster. Annu Rev Immunol 2007;25:697e743. [21] Chang Y-S, Peng S-E, Yu H-T, Liu F-C, Wang C-H, Lo C-F, et al. Genetic and phenotypic variations of isolates of shrimp Taura syndrome virus found in Penaeus monodon and Metapenaeus ensis in Taiwan. J General Virol 2004;85: 2963e8. [22] Bachère E. Shrimp immunity and disease control. Aquaculture 2000;191:3e11. [23] Lightner DV, Poulos BT, Tang-Nelson KF, Pantoja CR, Nunan LM, Navarro SA, et al. Application of molecular diagnostic methods to penaeid shrimp diseases: advances of the past 10 years for control of viral diseases in farmed shrimp. Dev Biol (Basel) 2006;126:117e22. discussion 325e6. [24] Lightner D, Redman R. Opportunities for training in shrimp diseases. Dev Biol (Basel) 2007;129:137e46. [25] Wang D, Li F, Li S, Chi Y, Wen R, Feng N, et al. An IkappaB homologue (FcCactus) in Chinese shrimp Fenneropenaeus chinensis. Dev Comp Immunol 2013;39:352e62. [26] Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001;29:e45. [27] Wang PH, Wan DH, Gu ZH, Deng XX, Weng SP, Yu XQ, et al. Litopenaeus vannamei tumor necrosis factor receptor-associated factor 6 (TRAF6) responds to Vibrio alginolyticus and white spot syndrome virus (WSSV) infection and activates antimicrobial peptide genes. Dev Comp Immunol 2011;35:105e14. [28] Ho SH, Song YL. Cloning of penaeidin gene promoter in tiger shrimp (Penaeus monodon). Fish Shellfish Immunol 2009;27:73e7. [29] O’Leary NA, Gross PS. Genomic structure and transcriptional regulation of the penaeidin gene family from Litopenaeus vannamei. Gene 2006;371:75e83. [30] Valanne S, Wang JH, Ramet M. The Drosophila toll signaling pathway. J Immunol 2011;186:649e56. [31] Chen YH, Zhao L, Jia XT, Li XY, Li CZ, Yan H, et al. Isolation and characterization of cDNAs encoding Ars2 and Pasha homologues, two components of the RNA interference pathway in Litopenaeus vannamei. Fish Shellfish Immunol 2012;32:373e80. [32] Westerheide SD, Raynes R, Powell C, Xue B, Uversky VN. HSF transcription factor family, heat shock response, and protein intrinsic disorder. Curr Protein Pept Sci 2012;13:86e103. [33] Li C, Chen YX, Zhang S, Lu L, Chen YH, Chai J, et al. Identification, characterization, and function analysis of the Cactus gene from Litopenaeus vannamei. PLoS One 2012;7:e49711. [34] Chen J, Xie C, Tian L, Hong L, Wu X, Han J. Participation of the p38 pathway in Drosophila host defense against pathogenic bacteria and fungi. Proc Natl Acad Sci U S A 2010;107:20774e9.

[35] Zou J, Guo Y, Guettouche T, Smith DF, Voellmy R. Repression of heat shock transcription factor HSF1 activation by HSP90 (HSP90 complex) that forms a stress-sensitive complex with HSF1. Cell 1998;94:471e80. [36] Xi C, Hu Y, Buckhaults P, Moskophidis D, Mivechi NF. Heat shock factor Hsf1 cooperates with ErbB2 (Her2/Neu) protein to promote mammary tumorigenesis and metastasis. J Biol Chem 2012;287:35646e57. [37] Desai S, Liu Z, Yao J, Patel N, Chen J, Wu Y, et al. Heat shock factor 1 (HSF1) controls chemoresistance and autophagy through transcriptional regulation of autophagy-related protein 7 (ATG7). J Biol Chem 2013;288:9165e76. [38] Asea A. Heat shock proteins and toll-like receptors. Handb Exp Pharmacol; 2008:111e27. [39] Multhoff G. Heat shock proteins in immunity. Handb Exp Pharmacol; 2006: 279e304. [40] Fuller KJ, Issels RD, Slosman DO, Guillet JG, Soussi T, Polla BS. Cancer and the heat shock response. Eur J Cancer 1994;30A:1884e91. [41] Gehrmann M, Brunner M, Pfister K, Reichle A, Kremmer E, Multhoff G. Differential up-regulation of cytosolic and membrane-bound heat shock protein 70 in tumor cells by anti-inflammatory drugs. Clin Cancer Res 2004;10:3354e 64. [42] Parsell D, Lindquist S. The function of heat-shock proteins in stress tolerance: degradation and reactivation of damaged proteins. Annu Rev Genet 1993;27: 437e96. [43] Feder ME, Hofmann GE. Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annu Rev Physiol 1999;61:243e82. [44] Qian Z, Liu X, Wang L, Wang X, Li Y, Xiang J, et al. Gene expression profiles of four heat shock proteins in response to different acute stresses in shrimp, Litopenaeus vannamei. Comp Biochem Physiol Part C e Toxicol Pharmacol; 2012:211e20. [45] Rungrassamee W, Leelatanawit R, Jiravanichpaisal P, Klinbunga S, Karoonuthaisiri N. Expression and distribution of three heat shock protein genes under heat shock stress and under exposure to Vibrio harveyi in Penaeus monodon. Dev Comp Immunol 2010;34:1082e9. [46] Li F, Li M, Ke W, Ji Y, Bian X, Yan X. Identification of the immediate-early genes of white spot syndrome virus. Virology 2009;385:267e74. [47] Lin Y-R, Hung H-C, Leu J-H, Wang H-C, Kou G-H, Lo C-F. The role of aldehyde dehydrogenase and hsp70 in suppression of white spot syndrome virus replication at high temperature. J Virol 2011;85:3517e25. [48] Xu Y, Tao X, Shen B, Horng T, Medzhitov R, Manley JL, et al. Structural basis for signal transduction by the Toll/interleukin-1 receptor domains. Nature 2000;408:111e5. [49] Wang XW, Tan NS, Ho B, Ding JL. Evidence for the ancient origin of the NFkappaB/IkappaB cascade: its archaic role in pathogen infection and immunity. Proc Natl Acad Sci U S A 2006;103:4204e9. [50] Fan ZH, Wang XW, Lu J, Ho B, Ding JL. Elucidating the function of an ancient NF-kappaB p100 homologue, CrRelish, in antibacterial defense. Infect Immun 2008;76:664e70. [51] Tauszig-Delamasure S, Bilak H, Capovilla M, Hoffmann JA, Imler J-L. Drosophila MyD88 is required for the response to fungal and Gram-positive bacterial infections. Nat Immunol 2001;3:91e7. [52] Wirth D, Bureau F, Melotte D, Christians E, Gustin P. Evidence for a role of heat shock factor 1 in inhibition of NF-kappaB pathway during heat shock response-mediated lung protection. Am J Physiol Lung Cell Mol Physiol 2004;287:L953e61.