Identification of interacting proteins with aryl hydrocarbon receptor in scallop Chlamys farreri by yeast two hybrid screening

Ecotoxicology and Environmental Safety 133 (2016) 381–389

Contents lists available at ScienceDirect

Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv

Identification of interacting proteins with aryl hydrocarbon receptor in scallop Chlamys farreri by yeast two hybrid screening Yuefeng Cai, Luqing Pan n, Jingjing Miao, Tong Liu Key Laboratory of Mariculture, Ministry of Education, Ocean University of China, Qingdao 266003, PR China

art ic l e i nf o

a b s t r a c t

Article history: Received 25 April 2016 Received in revised form 8 July 2016 Accepted 11 July 2016 Available online 4 August 2016

The aryl hydrocarbon receptor (AhR) belongs to the basic-helix-loop helix (bHLH) Per-Arnt-Sim (PAS) family of transcription factors. AhR has been known primarily for its role in the regulation of several drug and xenobiotic metabolizing enzymes, as well as the mediation of the toxicity of certain xenobiotics, including 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Although the AhR is well-studied as a mediator of the toxicity of certain xenobiotics in marine bivalves, the normal physiological function remains unknown. In order to explore the function of the AhR, the bait protein expression plasmid pGBKT7-CfAhR and the cDNA library of gill from Chlamys farreri were constructed. By yeast two hybrid system, after multiple screening with the high screening rate medium, rotary verification, sequencing and bioinformatics analysis, the interactions of the CfAhR with receptor for activated protein kinase C 1 (RACK1), thyroid peroxidase-like protein (TPO), Toll-like receptor 4(TLR 4), androglobin-like, store-operated Ca2 þ entry (SocE), ADP/ATP carrier protein, cytochrome b, thioesterase, actin, ferritin subunit 1, poly-ubiquitin, short-chain collagen C4-like and one hypothetical protein in gill cells were identified. This study suggests that the CfAhR played fundamental roles in immune system homeostasis, oxidative stress response, and in grow and development of C. farreri. The elucidation of these protein interactions is of much importance both in understanding the normal physiological function of AhR, and as potential targets for further research on protein function in AhR interactions. & 2016 Elsevier Inc. All rights reserved.

Keywords: Chlamys farreri AhR Protein interaction Receptor for activated protein kinase C 1 (RACK1) Toll-like receptor (TLR) Thyroid peroxidase-like protein (TPO)

1. Introduction Initial studies of the aryl hydrocarbon receptor (AhR) focused on its roles in regulating the induction of cytochrome P450, family 1 (CYP1) enzymes (Nebert et al., 2004) and mediating toxicity of dioxin like chemicals (Okey et al., 2005). This receptor belongs to the basic-helix-loop-helix (bHLH)/PAS (Period [Per]-Aryl hydrocarbon receptor nuclear translocator [ARNT]-Single minded [Sim]) family of heterodimeric transcriptional regulators (Barouki et al., 2007). bHLH/PAS proteins are involved in the control of diverse physiological processes such as circadian rhythms, organ development, neurogenesis, metabolism and in the stress response to hypoxia (Crews, 1998; Gonzalez and Fernandez-Salguero, 1998; Whitlock Jr., 1999). Nevertheless, increasing experimental evidence suggests physiological roles for the AhR in cell proliferation and differentiation, in liver and immune system homeostasis and in tumor development (Fernandez-Salguero et al., 1995; Lahvis and Bradfield, 1998; Bunger et al., 2003; Walisser et al., 2004a,b; Li n Correspondence to: Fisheries College, Ocean University of China, Yushan Road 5, Qingdao 266003, PR China. E-mail address: [email protected] (L. Pan).

et al., 2011). Ma and Whitlock examined differences in the growth rates of wild-type (Hepa1) and AhR-defective mouse cell lines and determined that the AhR influences G1 cell cycle progression (Ma and Whitlock, 1996). Animal studies have yielded increasing evidence that AhR possesses strong immunomodulation potential by controlling the differentiation of T lymphocytes and dendritic cells (Quintana et al., 2008; Esser et al., 2009; Nguyen et al., 2013). In fish, Carlson et al. have demonstrated that immune cells in fish possess all the machinery responsible for PAHs metabolism (Carlson et al., 2004). Moreover, AhR has been identified in spleen of fish suggesting a possible implication of this receptor in xenobiotic induced immunotoxicity (Merson et al., 2006). Besides, the characterization of AhR heterologous in invertebrates has provided evidence for the involvement of such proteins in development, regardless the fact that they are unable to bind xenobiotics (Crews and Brenman, 2006; Puga et al., 2005). In our earlier researches, the characterization of CfAhR in scallop Chlamys farreri has been identified and reported (Cai et al., 2016). The complete sequence of CfAhR homologue cDNA is 2890 bp (Accession number: FJ588640), encodes a polypeptide of 821 amino acids with the predicted molecular mass of 93.0 kDa. CfAhR homologue transcripts are expressed in all tissues of scallop and gill consistently showed the highest levels in each individual compared to other tissues.

http://dx.doi.org/10.1016/j.ecoenv.2016.07.013 0147-6513/& 2016 Elsevier Inc. All rights reserved.

Please cite this article as: Cai, Y., et al., Identification of interacting proteins with aryl hydrocarbon receptor in scallop Chlamys farreri by yeast two hybrid screening. Ecotoxicol. Environ. Saf. (2016), http://dx.doi.org/10.1016/j.ecoenv.2016.07.013i

382

Y. Cai et al. / Ecotoxicology and Environmental Safety 133 (2016) 381–389

Spineless is a bHLH-PAS Drosophila melanogaster protein considered to be an AhR ortholog. It plays a central role in defining the distal regions of both antennae and leg. Loss-of function alleles of Spineless cause several developmental defects: transformation of distal antenna into leg, deletion of distal leg (tarsal) structures, and reduction in size of most bristles (Duncan et al., 1998). Although AhR signal plays an important role, effect of physiology and homeostasis mechanism also is ambiguous however. On the other hand, to date, no evidence supported a typical AhR/ARNT signaling pathway in invertebrates that responds to xenobiotic substances and no results support such signaling, but many studies about function of this pathway on CYP450-mediated detoxification indicated that it is not to be neglected that there is a way related to AhR for xenobiotics detoxification in bivalves. Bivalve is one of the most important marine commercial species in China. Due to their sessile nature, filter-feeding habits, and pollutant bioconcentration, bivalves are widely used as marine pollution sentinels (Goldberg et al., 1978). In this study, the bait protein expression plasmid of CfAhR and yeast two hybrid cDNA library of gill cells from C. farreri were constructed and the yeast two-hybrid system was used to screen the interaction of CfAhR in C. farreri. The goal of the present investigation is to identify any interaction protein from the gill of scallop by using the yeast twohybrid screen. This study is aimed at discovering the interaction of CfAhR in C. farreri and laying the foundation to explore the function of CfAhR.

2. Materials and methods 2.1. Scallops and total RNA extraction Adult C. farreri with shell length of 7.25 7 0.5 cm, obtained from Pacific Corner (Yellow Sea, Qingdao, China). All the scallops acclimated to laboratory condition in aquarium (1 l water per scallop) for one week before formal experiments. They were randomly distributed and cultured under filtered seawater at a salinity of 30‰ with a temperature of 17 7 1 °C and a pH of 8.1 in 30  40  50 cm3 tanks. Each replicate contained 30–40 scallops (three replicates were performed). Water was renewed completely and the scallops were fed with dried powder of Spirulina platensis (30 mg for each individually) daily. Six scallops for each replicates were sampled after fostered. Gill tissue was collected immediately frozen in liquid nitrogen and then stored at  80 °C until use. Trizol Reagent was used to isolate total RNA from tissues according to the manufacturer's instructions (Invitrogen, USA). RNA degradation and contamination was assessed on 1% agarose gels. RNA concentration was measured using Qubit RNA Assay Kit in a Qubit 2.0 Fluorometer (Life Technologies, CA, USA). 2.2. Construction of the bait protein expression plasmid pGBKT7CfAhR We have acquired the sequence of the CfAhR gene in C. farreri and submitted it to GenBank (GenBank accession number: FJ588640). According to the sequence, the primers with restriction enzyme cutting sites were designed. The designed primers used to amplify the CfAhR ORF were CfAhR-F (5′GAGGACCTGCATATGATGGTGGAAGACTGGGTGAT′3, the underlined is restriction sites Nde I), CfAhR-R (5′GATGGGCGGGAATTCTCACTGGATCGTCACTTTGG′3, the underlined is restriction sites EcoR I). Those primers were synthesized in Sangon Biotech (Shanghai, China). The composition of the PCR system (25 μl) includes 16 μl ddH2O, 2 μl dNTP (each is 0.02 μM) (Takara, Dalian, China), 10 pmol/l primer for 1 μl each (0.4 pM), 10  Ex Taq buffer for

2.5 μl, pMD19-T-CfAhR DNA for 2 μl, and Ex Taq polymerase for 0.5 μl (5 U/μl) (Takara, Dalian, China). The PCR cycling conditions were an initial denaturation at 95 °C for 3 min followed by 30 cycles consisting of 94 °C for 30 s, 57 °C for 30 s, and 72 °C for 120 s, and a final extension step of 10 min at 72 °C. The aimed genes were purified using Gel Extraction Kit (Takara, Dalian, China) from agarose gel. The purified products and pGBKT7 vector were digested by the endonuclease Nde I and EcoR I at 37 °C for 4 h and connection systems (20 μl) includes 11.4 μl or 11.8 μl nuclease free H2O, 3.3 μl linearized vector pGBKT7 (about 150 ng), 1.3 μl CfAhR (150 ng) insert DNA, and 5  MasterMix for 4 μl (Takara, Dalian, China). Mixed completely and incubated for 30 min in ice bath. Then transformed to DH5α E. coli. The recombined plasmid was verified by sequencing. 2.3. Auto-activation and toxicity detection of the bait proteins expression plasmid pGBKT7-CfAhR According to the instructions of Yeastmaker™ Yeast Transformation System 2 (Clontech), auto-activation and toxicity detection of the bait plasmid pGBKT7-CfAhR was done. The correctly constructed plasmid pGBKT7-CfAhR was transformed into the yeast strain Y2HGold, then coated 100 μl of a 1/10 dilution and a 1/100 dilution per plate on the three selective mediums SD/-Trp, SD/-Trp/ X-α-Gal, and SD/-Trp/AbA /X-α-Gal to detect the auto-activation. The vector pGBKT7 and the bait plasmid pGBKT7-CfAhR were, respectively, transformed into the yeast strain Y2HGold, and then respectively coated on the selective medium SD/-Trp. The toxicity of the bait protein expression plasmid pGBKT7-CfAhR was detected based on growth situation of the colonies on plates. 2.4. Construction of the cDNA library The total RNA populations were first used to synthesize the first-strand as directed as the manufacturer using the kit of Make Your Own ‘Mate & Plate™’ Library System (Clontech, USA) with a thermal cycler (Bio-Rad, USA), and then the resultant ss cDNAs serving as template were exponentially amplified by LD-PCR kit (Clontech, Advantage 2 PCR Kit, Cat. No. 639206) with the nested primers (5′ PCR primer and 3′ PCR primer) of SMART III™ (all primer sequences were provided in Table 1). The PCR products (4200 bp) were excised from 1% low melting Agarose gel and purified using CHROMA SPIN-400 columns (Clontech, USA). The purified ds DNAs, together with linearized pGADT7-Rec AD cloning vector (Clontech, Cat. No. 630304), were co-transformed into yeast competent cell Y187, where yeast repair enzymes restore the linearized plasmid to its circular form by recombining homologous sequences at the end of the ds cDNA and pGADT7-Rec. This reaction was performed using Yeastmaker™ Yeast Transformation System 2 (Clontech, Cat. No. 630439). In addition to culturing on SD/-Leu plates to select the transformants, a series of dilution of the transformed mixture also were spread on SD/Leu media to calculate the transformation efficiency and independent colonies. After culturing at 30 °C for 5 days, the positive transformants were harvested to form an Y2H library. Hemacytometer was used to measure the cell density of the Y2H library to make sure the cell density Z2  107 cells/ml, which is essential for a high efficiency of the Y2H library screens. The constructed cDNA libraries were evaluated for number of independent clones and transformation efficiency from 10  2 dilution SD/-Leu plates. The harvested and pooled libraries were also plated on SD/-Leu plates at 10  2, 10  3, 10  4, and 10  5 dilutions to calculate cell density, library titer and library quantity. To exhibit the insert sizes of the ready Y2H library, 48 colonies were randomly picked out and as templates they were used to amplify cloned inserts.

Please cite this article as: Cai, Y., et al., Identification of interacting proteins with aryl hydrocarbon receptor in scallop Chlamys farreri by yeast two hybrid screening. Ecotoxicol. Environ. Saf. (2016), http://dx.doi.org/10.1016/j.ecoenv.2016.07.013i

Y. Cai et al. / Ecotoxicology and Environmental Safety 133 (2016) 381–389

3. Results

Table 1 Primers used in study. Name of primer

383

Primer sequences used for qRT-PCR (5′-3′)

Primers used to amplify the CfAhR ORF CfAhR-F GAGGACCTGCATATGATGGTGGAAGACTGGGTGAT CfAhR-R GATGGGCGGGAATTCTCACTGGATCGTCACTTTGG Primers used to construct the cDNA library SMART III Oligo AAGCAGTGGTATCAACGCAGAGTGGCCATTATGGCCGGG CDS III Primer ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)30VN 5′ PCR Primer TTCCACCCAAGCAGTGGTATCAACGCAGAGTGG 3′ PCR Primer GTATCGATGCCCACCCTCTAGAGGCCGAGGCGGCCGACA Universal sequencing primers 3′AD AGATGGTGCACGATGCACAG T7 TAATACGACTCACTATAGGG T7 ter TGCTAGTTATTGCTCAGCGG

2.5. Screening the interaction of the protein AhR and bioinformatics analysis The bait yeast strain Y2HGold with the plasmid pGBKT7-CfAhR was inoculated into 50 ml liquid medium SD/-Trp/Kan to OD600 ¼0.8 at 30 °C and 280 r/min. The supernatant was discarded after centrifuging for 5 min at 1000g. The bait bacteria liquid was prepared with 4 ml liquid medium SD/-Trp/Kan to resuspend the sedimentation (The cell concentration was more than 1.0  108 cell/ml). 1 ml library strain Y187, rechecked the titer (42.0  107 cfu/ml), and 4–5 ml bait strain Y2HGold were fused in a 2 l sterile flask, then 45 ml liquid medium 2  YPDA was added and incubated for 20 h at 30 °C at 50 rpm. Taking a drop of the culture, the fusion situation was observed in phase contrast microscope. When the binders were formed, the culture was centrifugated for 10 min at 1000g, then 50 ml liquid medium 0.5  YPDA (with 50 μg/ml Kan) was added to resuspend the precipitation. After centrifugating for 10 min, 10 ml liquid medium 0.5  YPDA (with 50 μg/ml Kan) was added to resuspend the precipitation and the total volume was determined. The fusion culture (diluted by 10  gradient) was coated on the selective medium SD/-Trp, SD/Leu, and SD/-Trp-Leu 100 μl per plate and cultured invertedly for 5 d at 30 °C. Then, the binding rate was determined after calculating the number of the yeast colonies. The remaining fusion culture was coated on the selective medium SD/-Trp/-Leu/X-α-Gal/ AbA/Kan (DDO/X/A) 200 μl per plate and cultured for 5 d at 30 °C. Blue yeast colonies on this selective medium were coated on higher stringency SD/-Trp/-Leu/-Ade/-His/X-α-Gal/AbA/Kan (QDO/ X/A) agar plates. Growth of blue yeast colonies on this selective medium was scored as potential positive interactions. These screening for interactions were carried out independently at least twice. The blue yeast colonies on the medium QDO/X/A were picked and transferred to the high screening rate medium QDO/X/ A by screening repeatedly to identify the positive interactions. The positive interactions acquired by multiple screening were identified by the yeast colony PCR. The inserted fragments of the identified positive interactions were sequenced in Sangon Biotech (Shanghai, China). The library plasmid of the positive interactions was transformed to E. coli DH5α to amplify the plasmid. The amplified library plasmids and plasmid pGBKT7-CfAhR was cotransfected pairwise into the yeast cell Y2HGold to validate protein interactions. cDNA sequences of positive interactions verified by rotary validation were carried out BLASTx program in GenBank. The homology on the homologous sequences of the positive interactions was analyzed. The interaction of the protein AhR was predicted in NCBI protein databases (http://www.ncbi.nlm.nih. gov/) by bioinformatics.

3.1. Construction of the bait protein expression plasmid pGBKT7CfAhR After recombinant expression of AhR, the plasmid pMD19-TCfAhR (unpublished) was used as templates to amplify AhR of C. farreri. The PCR products and pGBKT7 were digested and connected to construct the bait protein expression plasmid pGBKT7CfAhR. The bait plasmid pGBKT7-CfAhR was constructed successfully, identified by the yeast colony PCR (Fig. 1) and sequencing. 3.2. Auto-activation and toxicity detection of the bait protein expression plasmid pGBKT7-CfAhR After the plasmid pGBKT7-CfAhR was successfully transformed into the yeast cell Y2HGold, the yeast strain Y2HGold (with pGBKT7-CfAhR) grew the milky white colonies on the medium SD/-Trp, very pale blue colonies on the medium SD/-Trp/X-α-Gal, and no colony on the medium SD/-Trp/AbA/X-α-Gal. The control group, the yeast strain Y2HGold (with pGBKT7), grew the milky white colonies on the medium SD/-Trp and SD/-Trp/X-α-Gal, no colony on the medium SD/-Trp/AbA/X-α-Gal (Fig. 2). Growth situation of colonies on the selective medium indicated that the fusion protein expressed by the bait yeast strain Y2HGold (with pGBKT7-CfAhR) activated the reporter gene MEL1, no AUR1-C. The bait yeast strain Y2HGold (with pGBKT7-CfAhR) and the negative control yeast strain Y2HGold (with pGBKT7) with the same dilution grew the milky white colonies with the same size. The fusion protein expressed in Y2HGold (with pGBKT7-CfAhR) was no toxic effect to the yeast strain Y2HGold. 3.3. Construction and testing of the Cf-S cDNA library The A260/280 ratio and the average concentration of the isolated total RNA were found to be 1.98 and 569 ng/μl respectively.

Fig. 1. Identification results of the CfAhR-ORF by the yeast colony PCR. M, DL5000 DNA Marker; 1, the CfAhR amplified by the yeast colony PCR.

Please cite this article as: Cai, Y., et al., Identification of interacting proteins with aryl hydrocarbon receptor in scallop Chlamys farreri by yeast two hybrid screening. Ecotoxicol. Environ. Saf. (2016), http://dx.doi.org/10.1016/j.ecoenv.2016.07.013i

384

Y. Cai et al. / Ecotoxicology and Environmental Safety 133 (2016) 381–389

Fig. 2. Auto-activation and toxicity detection of the bait protein expression plasmids pGBKT7-CfAhR-ORF. (For interpretation of the references to color in this figure, the reader is referred to the web version of this article.)

The gel electrophoresis revealed bands of 28S and 18S rRNAs and the intensity of 28S band was twice as that of the 18S rRNA (Fig. 3A). Fig. 3B displays that the length of the ss cDNA (i) and ds cDNA (ii) fragments, sourced from Cf-S, were  0.1–0.75 kb, and this long distributed smear of ds cDNA indicated that the ds cDNA were successfully synthesized according to LD-PCR technique. The transformation efficiency, library titer and library quantity of Cf-S cDNA library were calculated according to the following formulas: transformation efficiency ¼the colonies/plating volume  dilution factor  mixture volume/quality of pGADT7-Rec, the library titer¼ the colonies (CFU)/volume of plating  dilution factor, and the library quantity ¼the library titer  volume of library. Thus, the transformation efficiency of Cf-S library was about 1.0  104 CFU/ μg of GADT7-rec vector, the titer of the primary cDNA library was 1.26  108 CFU/ml (Table 2). In order to identify the length of the inserts and the recombination rate of the cDNA library, 48 randomly picked individual clones were amplified by PCR using the AD vector universal primers. Fig. 3C shown the identification of the inserts size in Cf-S cDNA library, all of the fragments were more than 200 bp except for sample 12 and 24, which did not have the insert. 30 samples were less 0.35 kb, 18 samples were between 0.5 and 1.0 kb, 2 samples were between 1–2.0 kb, and the insert ranged from 0.208 to 1.50 kb. 3.4. Screening the interaction of the protein AhR During the mating experiments, the structure, formed by the fusion of the haploid yeast library cell with the haploid yeast bait cell, was the clover type indicating the formation of the zygote (Fig. 4A). The numbers of colonies on the selective medium SD/Leu, SD/-Trp, and SD/-Trp/-Leu were, respectively, 5.75  106, 4.01  107, and 2.3  105 cfu/ml. The fusion rate was 4.00%, calculated by statistics of those numbers and conformed to the experimental requirement of the 2–5% integration efficiency. Fusion yeast cells were repeatedly screened by the high screening rate medium (Fig. 4B), and the proteins interaction were verified by rotary verification. Based on the difference of the X-α-Gal staining, 125 colonies were selected for further analysis. These clones were sequenced, resulting in 12 different genes (Table 3) and most of isolated clones appeared at least twice in the screen (Table 3). Among them, a receptor for activated protein kinase C 1 (RACK1), Toll-like receptor (TLR) 4, thyroid peroxidase-like protein (TPO), androglobin-like, store-operated Ca2 þ entry (SocE), ADP/ATP

carrier protein, cytochrome b, thioesterase, actin, ferritin subunit 1, poly-ubiquitin, short-chain collagen C4-like and one hypothetical protein were found.

4. Discussion Y2H screening is the most widely used, high-throughput and low-cost approach for studying protein-protein interactions (White and Howley, 2013; Stynen et al., 2012). It is an in-vivo screening approach with the ability to identify even low affinity, transient interactions (Yang et al., 1995). A high-quality expression cDNA library can provide molecular resources for analyzing the genes involved in related aspects and studying their protein functions and interactions which facilitate the constructing of the protein network stemming from a known protein. Y2H cDNA libraries have been constructed in many plants, animals and microorganisms, while few reports have been published concerning the construction of a cDNA library in C. farreri. To study the AhRrelated protein interaction, a full length cDNA library from the gill cell of C. farreri and applied it to Y2H technology. The transformation efficiency of the library was about 1.0  104 CFU/μg DNA. As the library was derived from 3 μg of cDNA, this result suggests that the library contain more than 3.0  104 independent colonies. This provided the first indication for a successful preparation of the Y2H libraries. cDNA library allowed the efficient screening of all represented cDNA clones for proteins interacting with the bait protein (manufacturer's information, Clontech, USA). Studies on mammals showed that the unliganded AhR existed as a complex including two molecules of a 90 kDa heat shock protein (HSP90) and hepatitis B virus X-associated protein 2 (XAP2) (Meyer et al., 2000). Binding of ligand to AhR leaded to dissociation of the HSP90 complex. Transformation to the DNAbinding form required association of the ligand-bound AhR with ARNT (Hoffman et al., 1991; Reyes et al., 1992). Activation of genes transcription by transformed AhR complexes occurred through interaction with xenobiotic responsive enhancers located in the promoter of xenobiotic-responsive genes. In the C. farreri's gill Y2H library, interacting proteins involved in cytoskeleton architecture, respiration and apoptosis, such as short chain collagen C4-like, actin, store-operated Ca2 þ entry (SocE), androglobin and ATP-ADP carrier protein appeared to be potentially interacted with AhR. However, only four proteins, polyubiquitin, cytochrome b, ferritin

Please cite this article as: Cai, Y., et al., Identification of interacting proteins with aryl hydrocarbon receptor in scallop Chlamys farreri by yeast two hybrid screening. Ecotoxicol. Environ. Saf. (2016), http://dx.doi.org/10.1016/j.ecoenv.2016.07.013i

Y. Cai et al. / Ecotoxicology and Environmental Safety 133 (2016) 381–389

385

Fig. 3. Construction and testing of the Cf-S cDNA library. A, The gel electrophoresis of the isolated Cf-S total RNA. M1, DL5000 DNA Marker; 1–2, Cf-S total RNA. B, The detection of the ss cDNA fragments size and ds cDNA fragments size from the LD-PCR of Cf-S. (i) M2, DL2000 DNA Marker; 3, Cf-S ss DNA fragments; (ii) M3, DL5000 DNA Marker; 4, Cf-S ds DNA fragments. C, The identification of the inserts size in Cf-S cDNA library. M, DNA Marker 5000 bp. Lines 1–48 were 48 recombinant individual colonies, which were randomly picked and amplified by performing PCR with the AD vector universal primers. All of the fragments were more than 200 bp except for sample 12 and 24, which did not have the insert. 30 samples were less 0.35 kb, 18 samples were between 0.5–1.0 kb, 2 samples were between 1 and 2.0 kb, and the insert ranged from 0.208 to 1.50 kb. NC (negative control): templates of PCR application were water.

Please cite this article as: Cai, Y., et al., Identification of interacting proteins with aryl hydrocarbon receptor in scallop Chlamys farreri by yeast two hybrid screening. Ecotoxicol. Environ. Saf. (2016), http://dx.doi.org/10.1016/j.ecoenv.2016.07.013i

386

Y. Cai et al. / Ecotoxicology and Environmental Safety 133 (2016) 381–389

Table 2 The Cf-S Y2H cDNA library transformation efficiency, insert size and the quality of library. Cf-S cDNA library The transformation efficiency Insert size (kb) Minimum Maximum Average % of positive recombinant clones Cell density of frozen library (cells/ml) cDNA library titer (CFU/ ml) The primary cDNA library The amplified cDNA library The cDNA library quantity The amplified cDNA library

Expected

Z 1  106 transfor3.0  104 transformants/3ug pGADT7-Rec mants/3ug pGADT7-Rec 208 bp 1500 bp 420 bp 46/48

1

4.38  109 cells/ml

Z 2  107 cells/ml

1.26  108 CFU/ml 4.38  109 CFU/ml

Z 1  107 cells/ml

4.38  109

and thioesterase in our library were identified as related to known detoxification mechanisms. Two studies have independently shown that AhR degradation was dependent on the ubiquitin proteasome pathway (Roberts and Whitelaw, 1999; Ma and Baldwin, 2007). A yeast two-hybrid screen of a mouse embryonic day 11 library for AhR-interacting proteins revealed Nedd8, a Ubiquitin-like protein, as a candidate in our result, so we agreed with their hypothesis that this interaction enhanced the transcriptional activity of the receptor, perhaps involving increased nuclear accumulation or retention (Antenos et al., 2002). Unfortunately, the results of this study did not include ARNT, HSP90, XAP2 and other xenobiotic-responsive genes. Here, we analyzed some relevant reasons in order to attach importance to the problem. Studies of Yamaguchi and Kuo had demonstrated that the N-terminal half of AhR was capable of interacting with ARNT in yeast, but a fusion protein containing the GAL4 DNA binding domain (DB) linked to the full-length AhR was not capable of activating expression of a reporter gene containing the GAL4 DNA binding site, suggesting that ligand-free AhR alone had no transactivating properties in yeast (Yamaguchi and Kuo, 1995). AhR was known to associate with HSP90 and XAP2 (Carver, et al., 1994; McGuire, et al., 1994). These two proteins were bound to the PAS domain of AhR in the absence of ligand, and were dissociated in the liganded AhR. The failure to detect HSP90 and XAP2 in the two-hybrid library screening may be due to the same reasons as mentioned by Yamaguchi and Kuo (1995). Their results suggested that either other potential bHLH-PAS binding proteins were not present in the library or that only a subset of HLH-containing proteins (e.g. ARNT)

can form stabilized heterodimers with the HLH-PAS domains of AhR in yeast. Of course, this is only a hypothesis in molluscs, but also the need for more research to prove. TLR signaling pathway is an important and evolutionarily conserved innate immune pathway. TLRs, an ancient family of pattern recognition receptors, plays key roles in detecting various non-self substances and then initiating and activating immune system. On binding a pathogen-associated molecular patterns (PAMPs), mammalian TLRs can initiate signaling transduction by recruiting its canonical adaptor myeloid differentiation factor 88 (Myd88) or others, leading to the activation of a NF-κB-mediated immune response. In contrast, Drosophila TLR does not directly recognize any PAMPs, but is instead activated by the endogenous ligand Spätzle (Anderson et al., 1985). As mollusks, are continuously exposed to marine water that is rich in microorganisms, they have evolved an effective innate immune system to cope with potentially harmful pathogens (Bachère et al., 2004). Evidence is also emerging that suggests oysters Crassostrea gigas have a complete TLR and NF-κB signaling pathway, which plays a role in host defense against pathogen infection; this is considered as the functional analogue to human TLR and NF-κB (Huang et al., 2012; Zhang et al., 2011a,b; Qiu et al., 2007; Toubiana et al., 2013). As reported as Zhang et al., transfection with oyster TLRs constitutively activates NF-κB reporter in a dose-dependent manner, suggesting an ancient and conserved link between TLRs and NF-κB signaling in mollusks (Zhang et al., 2013). In contrast, Sasaki et al. demonstrated that ascidian Ciona intestinalis TLRs show too low level responses to high concentrations of PAMPs and too weak to distinguish from C. intestinalis TLR's authentic ability (Sasaki et al., 2009). In order to investigate the potential effects of TLR signaling pathway in C. farreri on the downstream immune response, Wang et al. silenced TLR gene applied RNAi technique shown the mRNA expression of superoxide dismutase (SOD) and catalase (CAT) in TLR-suppressed scallops was continually up-regulated significantly, implying that the suppression of TLR might disarrange the regulation of these antioxidant genes (Wang et al., 2011). In most pathways, the key genes are always activated together with similar gene expression profiles, and their proteins often interact with each other coordinately to execute a particular function (Segal et al., 2003). Alternation of immunocompetence had been reported for bivalve molluscs exposed to contamination. Coles et al. observed that fluoranthene (200 and 400 mg/l) could affect the haemocyte number, production of reactive oxygen metabolites (ROS) and lysosomal enzymes of Mytilus edulis to different extent (Coles et al., 1994). Several authors have suggested that metabolic activation was required for PAHs to produce immunosuppression (Mudzinski, 1993). This phenomenon has been described for 3-MC in murine cytotoxic T-lymphocytes (Davila et al., 1995). Others have shown that PAHs directly modulate Ca2 þ homeostasis

Fig. 4. The clover type structure of the yeast zygote (40  objective) (A) and blue positive colonies on the last screening medium (B). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Please cite this article as: Cai, Y., et al., Identification of interacting proteins with aryl hydrocarbon receptor in scallop Chlamys farreri by yeast two hybrid screening. Ecotoxicol. Environ. Saf. (2016), http://dx.doi.org/10.1016/j.ecoenv.2016.07.013i

Y. Cai et al. / Ecotoxicology and Environmental Safety 133 (2016) 381–389

387

Table 3 Putative genes identified in cDNA clones of Cf-S cDNA library on their sequences comparison through BLASTx search engine of NCBI database. Clone no.

CF034 CF007 CF029 CF094 CF024 CF112 CF085 CF011 CF055 CF111 CF001 CF015

Best hit in the NCBI NR database mRNA

Accession

Organism

e-Value

Identity (%)

Frequency

Receptor of Activated Kinase C 1 Thyroid peroxidase-like protein ADP/ATP carrier protein Short-chain collagen C4-like Toll-like receptor 4 Androglobin-like isoform X17 Cytochrome b Actin Polyubiquitin Ferritin subunit 1 Thioesterase Hypothetical protein OXYTRI_13059

CAL48986 AAT90332 ADD63991 XP_011425831 XP_011426173 XP_011423051 YP_002640515 ACF28566 ABA54442 ADR71731 WP_03276856 EJY66654

Mya arenaria Lytechinus variegatus Mizuhopecten yessoensis Crassostrea gigas Crassostrea gigas Crassostrea gigas Azumapecten farreri Amphidinium carterae Massisteria marina Argopecten irradians Streptomyces sp. CNS654 Oxytricha trifallax

1e-42 1e-19 2e-10 2e-31 7e-15 3e-41 5e-51 1e-78 2e-09 9e-20 2e-09 5e-18

87 39 76 52 49 87 94 57 82 96 61 66

2 2 2 5 2 7 13 2 2 2 2 2

(Archuleta et al., 1993; Krieger et al., 1994; Mounho and Burchiel, 1998). However, there were few studies on mechanism of xenobiotic-induced immunotoxicity in bivalves. In our study, Toll-like receptor 4 was identified in scallop as an interacting protein of AhR. As a number of bHLH/PAS family of heterodimeric transcriptional regulators, AhR might play an important role in the downstream immune response related with TLR and its related gene transcription and expression. By virtue of its ability to coordinate the interaction of key signaling molecules, RACK1 was becoming widely perceived as playing a central role in critical biological responses, such as cell movement growth (Hermanto et al., 2002), cellular adaptation processes (Chou et al., 1999), immune responsiveness (Korchak and Kilpatrick, 2001). The RACK1 protein appeared to interact with many different cellular proteins and associates with several signal transduction pathways (McCahill et al., 2002), such as the PKC/ RACK pathway (Ron et al., 1999, 1995), the cyclic AMP-specific phosphodiesterase pathway (McLeod et al., 2000; Yarwood et al., 1999) and the tyrosine kinase-phosphatase pathway (Chang et al., 1998). It has been reported that RACK1 act as a negative regulator of apoptosis in mammalian cells (Sang et al., 2001; Ozaki et al., 2003). Furthermore, using the yeast two hybrid technique, Rigas et al. has identified RACK1 as an androgen receptor (AR) interacting protein. Their data demonstrated that RACK1 played an important role in ligand independent movement and transactivation of the AR via the PKC signaling pathways (Rigas et al., 2003). Due to the pivotal role of RACK1 in a variety of cellular pathways of regulation and since, to our knowledge, the function of RACK1 in an aquatic mollusc had to been studied. For example, the RACK from the snail Biomphalaria glabratacan coupled with different heterologous isoenzymes in PKC-mediated signaling pathways (Lardans et al., 1998). In oysters C. angulata, RACK1 played an important role in tissue differentiation and cell growth during larval development (Yang et al., 2014). RACK1 has been shown to be involved in immune defense of shrimp Fenneropenaeus chinensis (Ren et al., 2011) and mussel Mytilus galloprovincialisat (Ji et al., 2013). It is reported that RACK1 was involved in oxidative stress response caused by bacteria and cadmium in pearl oyster Pinctada martensii (Chen et al., 2011), tributyltin in Mya arenaria (Siah et al., 2007). In this study, the interaction of RACK1 with AhR, a critical regulator of xenobiotic metabolism, suggested that AhR may be intimately involved in the regulation of pathways activated by RACK1. It could also be imagined that RACK1 may contribute to the regulation of collaborative interactions between PKC and cAMP signaling cascades in certain circumstances, which is regulated by AhR through xenobiotic-related oxidative stress indirectly. In vertebrates, thyroid hormones (THs) signaling pathway was

essential for the animal's growth, development and energy metabolism. In addition, it also involved in metamorphosis process of amphibian and fish. In recent, increasing evidence supported the existence of signal molecules of THs signaling pathway in the development and metamorphosis process of marine invertebrates, such as endogenous THs and thyroid hormone receptors (TRs) and so on. Thyroid peroxidase (TPO) is a type of enzyme produced in the thyroid, which plays a vital role in helping the thyroid gland produce hormones, specifically triiodothyronine (T3) and thyroxine (T4) hormones. Heyland and his colleagues identified TPO genes from Aplysia californica and Lytechinus variegatus firstly (Heyland et al., 2006). Subsequently, TPO was found in other marine invertebrates, such as Branchiostoma floridae (Putnam et al., 2008), C. gigas (Zhang et al., 2012) and Lottia gigantean (Simakov et al., 2012). Analysis of protein structure found that the catalytic center of TPO from marine invertebrates also contained highly-conserved HRH action site which similar to those in vertebrates. So invertebrates may also have a THs signaling pathway in which TPO was used to the synthesis of thyroid hormones (Heyland et al., 2006). Previous studies reported that a relationship existed between TPO levels and levels of several organochlorines among adult zebrafish under long term high exposure (Langer et al., 2007; Chan and Chan, 2012). However, the intracellular signal transduction mechanisms of regulation expression of TPO were almost unknown. This research found that, as an interacting protein of AhR, the expression of TPO could be affected by the AhR signaling pathways, as well as the regulation of neuroendocrine-immunoregulatory network, in this way AhR regulated growth and development indirectly.

5. Conclusion In conclusion, we reported the construction and characterization of a Y2H system compatible cDNA library from C. farreri's gills. The library was generated from high quality gills mRNA using SMART technique. The library was evaluated for various parameters and found suitable to be used as prey for studying protein interactions. 13 Proteins has been identified interacting with the CfAhR and increase experimental evidence suggests physiological roles for the AhR in immune system homeostasis, oxidative stress response, and in grow and development of C. farreri. The elucidation of these protein interactions is of much importance both in understanding the normal physiological function of AhR, and as potential targets for further research on protein function in AhR interactions.

Please cite this article as: Cai, Y., et al., Identification of interacting proteins with aryl hydrocarbon receptor in scallop Chlamys farreri by yeast two hybrid screening. Ecotoxicol. Environ. Saf. (2016), http://dx.doi.org/10.1016/j.ecoenv.2016.07.013i

388

Y. Cai et al. / Ecotoxicology and Environmental Safety 133 (2016) 381–389

Acknowledgment This work was supported by National Natural Science Foundation of China (Research Grant no. 30972237) and the Research Fund for the Doctoral Program of Higher Education of China (Research Grant no. 20130132110008). We thank the staff at the Laboratory of Environmental Physiology of Aquatic Animals for the help with sampling and taking care of the scallops.

References Anderson, K.V., Jürgens, G., Nüsslein-Volhard, C., 1985. Establishment of dorsalventral polarity in the Drosophila embryo: genetic studies on the role of the Toll gene product. Cell 42, 779–789. Antenos, M., Casper, R.F., Brown, T.J., 2002. Interaction with Nedd8, a ubiquitin-like protein, enhances the transcriptional activity of the aryl hydrocarbon receptor. J. Biol. Chem. 277, 44028–44034. Archuleta, M.M., Schieven, G.L., Ledbetter, J.A., Deanin, G.G., Burchiel, S.W., 1993. 7,12-Dimethylbenz[a]anthracene activates protein-tyrosine kinases Fyn and Lck in the HPB-ALL human T-cell line and increases tyrosine phosphorylation of phospholipase C-gamma 1, formation of inos itol 1,4,5-trisphosphate, and mobilization of intracellular calcium. Proc. Natl. Acad. Sci. USA 90, 6105–6109. Bachère, E., Gueguen, Y., Gonzalez, M., de Lorgeril, J., Garnier, J., et al., 2004. Insights into the anti-microbial defense of marine invertebrates: the penaeid shrimps and the oyster Crassostrea gigas. Immunol. Rev. 198, 149–168. Barouki, R., Coumoul, X., Fernandez-Salguero, P.M., 2007. The aryl hydrocarbon receptor, more than a xenobiotic-interacting protein. FEBS Lett. 581, 3608–3615. Bunger, M.K., Moran, S.M., Glover, E., et al., 2003. Resistance to 2,3,7,8-tetrachlorodibenzo-p-dioxin toxicity and abnormal liver development in mice carrying a mutation in the nuclear localization sequence of the aryl hydrocarbon receptor. J. Biol. Chem. 278, 17767–17774. Cai, Y.F., Pan, L.Q., Miao, J.J., 2016. Molecular evidence for the existence of an aryl hydrocarbon receptor pathway in scallops Chlamys farreri. Comp. Biochem. Phys. B. 196-197, 74–84. Carlson, E.A., Li, Y., Zelikoff, J.T., 2004. Benzo[a]pyrene-induced immunotoxicity in Japanese medaka (Oryzias latipes): relationship between lymphoid CYP1A activity and humoral immune suppression. Toxicol. Appl. Pharmacol. 201, 40–52. Carver, L.A., Jackiw, V., Bradfield, C.A., 1994. The 90-kDa heat shock protein is essential for Ah receptor signaling in a yeast expression system. J. Biol. Chem. 269, 30109–30112. Chan, W.K., Chan, K.M., 2012. Disruption of the hypothalamic-pituitary-thyroid axis in zebrafish embryo-larvae following waterborne exposure to BDE-47, TBBPA and BPA. Aquat. Toxicol. 108, 106–111. Chang, B.Y., Conroy, K.B., Machleder, E.M., Cartwright, C.A., 1998. RACK1, a receptor for activated C kinase and a homolog of the beta subunit of G proteins, inhibits activity of src tyrosine kinases and growth of NIH 3T3 cells. Mol. Cell. Biol. 18, 3245–3256. Chen, J., Liu, J., Xiao, S., et al., 2011. Molecular cloning, characterization and expression analysis of receptor for activated C kinase 1 (RACK1) from pearl oyster (Pinctada martensii) challenged with bacteria and exposed to cadmium. Fish Shellfish Immunol. 31, 781–787. Chou, Y., Chou, C., Chen, Y., Tsai, S., Hsieh, F., Liu, H., Hseu, T., 1999. Structure and genomic organization of porcine RACK1 gene. Biochim. Biophys. Acta 1489, 315–322. Coles, J.A., Fairly, S.R., Pipe, R.K., 1994. Effects of fluoranthene on the immunocompetence of the common marine mussel Mytilus edulis. Aquat. Toxicol. 30, 367–369. Crews, S.T., 1998. Control of cell lineage-specific development and transcription by bHLH-PAS proteins. Genes Dev. 12, 607–620. Crews, S.T., Brenman, J.E., 2006. Spineless provides a little backbone for dendritic morphogenesis. Genes Dev. 20, 2773–2778. Davila, D.R., Davis, D.A.P., Campbell, K., et al., 1995. Role of alterations in Ca2 þ associated signaling pathways in the immunotoxicity of polycyclic aromatic hydrocarbons. J. Toxicol. Environ. Health A 45, 101–126. Duncan, D.M., Burgess, E.A., Duncan, I., 1998. Control of distal antennal identity and tarsal development in Drosophila by spineless-aristapedia, a homolog of the mammalian dioxin receptor. Genes Dev. 12, 1290–1303. Esser, C., Rannug, A., Stockinger, B., 2009. The aryl hydrocarbon receptor in immunity. Trends Immunol. 30, 447–454. Fernandez-Salguero, P., Pineau, T., Hilbert, D.M., et al., 1995. Immune system impairment and hepatic fibrosis in mice lacking the dioxin-binding Ah receptor. Science 268, 722–726. Goldberg, E.D., Bowen, V.T., Farrington, J.W., et al., 1978. The mussel watch. Environ. Conserv. 5, 101–125. Gonzalez, F.J., Fernandez-Salguero, P., 1998. The aryl hydrocarbon receptor: studies using the AhR-null mice. Drug Metab. Dispos. 26, 1194–1198. Hermanto, U., Zong, C.S., Li, W., Wang, L.H., 2002. RACK1, an insulin-like growth factor I (IGF-I) receptor-interacting protein, modulates IGF-I-dependent integrin signaling and promotes cell spreading and contact with extracellular matrix. Mol. Cell. Biol. 22, 2345–2365.

Heyland, A., Price, D.A., Bodnarova-buganova, M., et al., 2006. Thyroid hormone metabolism and peroxidase function in two non-chordate animals. J. Exp. Zool. Part B 306, 551–566. Hoffman, E.C., Reyes, H., Chu, F.F., et al., 1991. Cloning of a factor required for activity of the Ah (dioxin) receptor. Science 252, 954–958. Huang, X., Liu, W., Guan, Y., Shi, Y., Wang, Q., et al., 2012. Molecular cloning and characterization of class I NF-kappa B transcription factor from pearl oyster (Pinctada fucata). Fish Shellfish Immunol. 33, 659–666. Ji, C., Wu, H., Wei, L., et al., 2013. Responses of Mytilus galloprovincialis to bacterial challenges by metabolomics and proteomics. Fish Shellfish Immunol. 35, 489–498. Korchak, H.M., Kilpatrick, L.E., 2001. Roles for beta II-protein kinase C and RACK1 in positive and negative signaling for superoxide anion generation in differentiated HL60 cells. J. Biol. Chem. 276, 8910–8917. Krieger, J.A., Born, J.L., Burchiel, S.W., 1994. Persistence of calcium elevation in the HPB-ALL human T cell line correlates with immunosuppressive properties of polycyclic aromatic hydrocarbons. Toxicol. Appl. Pharmacol. 127, 268–274. Lahvis, G.P., Bradfield, C.A., 1998. Ahr null alleles: distinctive or different? Biochem. Pharmacol. 56, 781–787. Langer, P., Kocan, A., Tajtakova, M., Petrik, J., 2007. Fish from industrially polluted freshwater as the main source of organochlorinated pollutants and increased frequency of thyroid disorders and dysglycemia. Chemosphere 67, S379–S385. Lardans, V., Serra, E., Capron, A., Dissous, C., 1998. Characterization of an intracellular receptor for activated protein kinase C (RACK) from the mollusk Biomphalaria glabrata, the intermediate host for Schistosoma mansoni. Exp. Parasitol. 88, 194–199. Li, Y., Innocentin, S., Withers, D.R., et al., 2011. Exogenous stimuli maintain intraepithelial lymphocytes via aryl hydrocarbon receptor activation. Cell 147, 629–640. Ma, Q., Baldwin, K.T., 2007. 2,3,7,8-Tetrachlorodibenzo-p-dioxin-induced degradation of aryl hydrocarbon receptor (AhR) by the ubiquitin-proteasome pathway role of the transcription activaton and DNA binding of AhR. J. Biol. Chem. 275, 8432–8438. Ma, Q., Whitlock, J.P., 1996. The aromatic hydrocarbon receptor modulates the Hepa 1c1c7 cell cycle and differentiated state independently of dioxin. Mol. Cell. Biol. 16, 2144–2150. McCahill, A., Warwicker, J., Bolger, G.B., Houslay, M.D., Yarwood, S.J., 2002. The RACK1 scaffold protein: a dynamic cog in cell response mechanisms. Mol. Pharmacol. 62, 1261–1273. McGuire, J., Whitelaw, M.L., Pongratz, I., et al., 1994. A cellular factor stimulates ligand-dependent release of hsp90 from the basic helix-loop-helix dioxin receptor. Mol. Cell. Biol. 14, 2438–2446. McLeod, M., Shor, B., Caporaso, A., Wang, W., Chen, H., Hu, L., 2000. Cpc2, afission yeast homologue of mammalian RACK1 protein, interacts with Ran1 (Pat1) kinase to regulate cell cycle progression and meiotic development. Mol. Cell. Biol. 20, 4016–4027. Merson, R.R., Franks, D.G., Karchner, S.I., Hahn, M.E., 2006. Development and characterization of polyclonal antibodies against the aryl hydrocarbon receptor protein family (AHR1, AHR2, and AHR repressor) of Atlantic Killifish Fundulus heteroclitus. Comp. Biochem. Phys. C 142, 85–94. Meyer, B.K., Petrulis, J.R., Perdew, G.H., 2000. Aryl hydrocarbon (Ah) receptor levels are selectively modulated by hsp90-associated immunophilin homolog XAP2. Cell Stress Chaperones 5, 243. Mounho, B.J., Burchiel, S.W., 1998. Alterations in human B cell calcium homeostasis by polycyclic aromatic hydrocarbons: possible associations with cytochrome P450 metabolism and increased protein tyrosine phosphorylation. Toxicol. Appl. Pharmacol. 149, 80–89. Mudzinski, S.P., 1993. Effects of benzo[a]pyrene on concanavalin Astimulated human peripheral blood mononuclear cells in vitro: inhibition of proliferation but no effect on parameters related to the G1 phase of the cell cycle. Toxicol. Appl. Pharmacol. 119, 166–174. Nebert, D.W., Dalton, T.P., Okey, A.B., et al., 2004. Role of aryl hydrocarbon receptormediated induction of the CYP1 enzymes in environmental toxicity and cancer. J. Biol. Chem. 279, 23847–23850. Nguyen, N.T., Hanieh, H., Nakahama, T., et al., 2013. The roles of aryl hydrocarbon receptor in immune responses. Int. Immunol. 25, 335–343. Okey, A.B., Franc, M.A., Moffat, I.D., et al., 2005. Toxicological implications of polymorphisms in receptors for xenobiotic chemicals: the case of the aryl hydrocarbon receptor. Toxicol. Appl. Pharmacol. 207, 43–51. Ozaki, T., Watanabe, K., Nakagawa, T., Miyasaki, K., Takahashi, M., Nakagawara, A., 2003. Function of p73 not of p53 is inhibited by the physical interaction with RACK1 and its inhibitory effect is counteracted by pRB. Oncogene 22, 3231–3242. Puga, A., Tomlinson, C.R., Xia, Y., 2005. Ah receptor signals cross-talk with multiple developmental pathways. Biochem. Pharmacol. 69, 199–207. Putnam, N.H., Butts, T., Ferrier, D.E., et al., 2008. The amphioxus genome and the evolution of the chordate karyotype. Nature 453, 1064–1071. Qiu, L., Song, L., Xu, W., Ni, D., Yu, Y., 2007. Molecular cloning and expression of a Toll receptor gene homologue from Zhikong Scallop, Chlamys farreri. Fish Shellfish Immunol. 22, 451–466. Quintana, F.J., Basso, A.S., Iglesias, A.H., et al., 2008. Control of T(reg) and T(H)17 cell differentiation by the aryl hydrocarbon receptor. Nature 453, 65–71. Ren, Q., Zhou, J., Zhao, X.F., et al., 2011. Molecular cloning and characterization of a receptor for activated protein kinase C1 (RACK1) from Chinese white shrimp; Fenneropenaeus chinensis. Dev. Comp. Immunol. 35, 629–634. Reyes, H., Reisz-Porszasz, S., Hankinson, O., 1992. Identification of the Ah receptor

Please cite this article as: Cai, Y., et al., Identification of interacting proteins with aryl hydrocarbon receptor in scallop Chlamys farreri by yeast two hybrid screening. Ecotoxicol. Environ. Saf. (2016), http://dx.doi.org/10.1016/j.ecoenv.2016.07.013i

Y. Cai et al. / Ecotoxicology and Environmental Safety 133 (2016) 381–389

nuclear translocator protein (Arnt) as a component of the DNA binding form of the Ah receptor. Science 256, 1193–1195. Rigas, A.C., Ozanne, D.M., Neal, D.E., Robson, C.N., 2003. The scaffolding protein RACK1 interacts with androgen receptor and promotes cross talk through a protein kinase C signalling pathway. J. Biol. Chem. 278, 46087–46093. Roberts, B.J., Whitelaw, M.L., 1999. Degradation of the basic helix-loop-helix/PerARNT-Sim homology domain dioxin receptor via the ubiquitin/proteasome pathway. J. Biol. Chem. 274, 36351–36356. Ron, D., Jiang, Z., Yao, L., Vagts, A., Diamond, I., Gordon, A., 1999. Coordinated movement of RACK1 with activatedβIIPKC. J. Biol. Chem. 274, 27039–27046. Ron, D., Luo, J., Mochly-Rosen, D., 1995. C2 region-derived peptides inhibit translocation and function of beta protein kinase C in vivo. J. Biol. Chem. 270, 24180–24187. Sang, N., Severino, A., Russo, P., Baldi, A., Giordano, A., Mileo, A.M., Paggi, M.G., De Luca, A., 2001. RACK1 interacts with E1A and rescues E1A induced yeast growth inhibition and mammalian cell apoptosis. J. Biol. Chem. 276, 27026–27033. Sasaki, N., Ogasawara, M., Sekiguchi, T., Kusumoto, S., Satake, H., 2009. Toll-like receptors of the ascidian Ciona intestinalis: prototypes with hybrid functionalities of vertebrate Toll-like receptors. J. Biol. Chem. 284, 27336–27343. Segal, E., Wang, H., Koller, D., 2003. Discovering molecular pathways from protein interaction and gene expression data. Bioinformatics 19, i264–i272. Siah, A., Masson, R., Loup, B., et al., 2007. Receptor activated C kinase is downregulated in the male gonad of the marine bivalve mollusc Mya arenaria exposed to tributyltin (TBT). Aquat. Toxicol. 83, 295–305. Simakov, O., Marletaz, F., Cho, S.J., et al., 2012. Insights into bilaterian evolution from three spiralian genomes. Nature 11696, 1–6. Stynen, B., Tournu, H., Tavernier, J., Van Dijck, P., 2012. Diversity in genetic in vivo methods for protein-protein interaction studies: from the yeast two-hybrid system to the mammalian split-luciferase system. Microbiol. Mol. Biol. Rev. 76, 331–382. Toubiana, M., Gerdol, M., Rosani, U., Pallavicini, A., Venier, P., et al., 2013. Toll-like receptors and MyD88 adaptors in Mytilus: complete cds and gene expression levels. Dev. Comp. Immunol. 40, 158–166. Walisser, J.A., Bunger, M.K., Glover, E., et al., 2004a. Gestational exposure of Ahr and

389

Arnt hypomorphs to dioxin rescues vascular development. Proc. Natl. Acad. Sci. USA 101, 16677–16682. Walisser, J.A., Bunger, M.K., Glover, E., et al., 2004b. Patent ductus venosus and dioxin resistance in mice harboring a hypomorphic Arnt allele. J. Biol. Chem. 279, 16326–16331. Wang, M., Yang, J., Zhou, Z., et al., 2011. A primitive Toll-like receptor signaling pathway in mollusk Zhikong scallop Chlamys farreri. Dev. Comp. Immunol. 35, 511–520. White, E.A., Howley, P.M., 2013. Proteomic approaches to the study of papillomavirus-shost interactions. Virology 435, 57–69. Whitlock Jr., J.P., 1999. Induction of cytochrome P4501A1. Annu. Rev. Pharmacol. Toxicol. 39, 103–125. Yamaguchi, Y., Kuo, M.T., 1995. Functional analysis of aryl hydrocarbon receptor nuclear translocator interactions with aryl hydrocarbon receptor in the yeast two-hybrid system. Biochem. Pharmacol. 50, 1295–1302. Yang, B., Pu, F., Qin, J., et al., 2014. Characterization of receptor of activated C kinase 1 (RACK1) and functional analysis during larval metamorphosis of the oyster Crassostrea angulata. Gene 537, 294–301. Yang, M., Wu, Z., Fields, S., 1995. Protein-peptide interactions analyzed with the yeast two-hybrid system. Nucleic Acids Res. 23, 1152–1156. Yarwood, S.J., Steele, M.R., Scotland, G., Houslay, M.D., Bolger, G.B., 1999. The RACK1 signaling scaffold protein selectively interacts with the cAMP-specific phosphodiesterase PDE4D5 isoform. J. Biol. Chem. 274, 14909–14917. Zhang, G., Fang, X., Guo, X., et al., 2012. The oyster genome reveals stress adaptation and complexity of shell formation. Nature 490, 49–54. Zhang, L., Li, L., Zhang, G., 2011b. A Crassostrea gigas Toll-like receptor and comparative analysis of TLR pathway in invertebrates. Fish Shellfish Immunol. 30, 653–660. Zhang, Y., He, X., Yu, F., et al., 2013. Characteristic and functional analysis of Toll-like receptors (TLRs) in the lophotrocozoan, Crassostrea gigas, reveals ancient origin of TLR-mediated innate immunity. PloS One 8, e76464. Zhang, Y., He, X., Yu, Z., 2011a. Two homologues of inhibitor of NF-kappaB (IkappaB) are involved in the immune defense of the Pacific oyster, Crassostrea gigas. Fish Shellfish Immunol. 30, 1354–1361.

Please cite this article as: Cai, Y., et al., Identification of interacting proteins with aryl hydrocarbon receptor in scallop Chlamys farreri by yeast two hybrid screening. Ecotoxicol. Environ. Saf. (2016), http://dx.doi.org/10.1016/j.ecoenv.2016.07.013i