Improvement of the CRISPR-Cas9 mediated gene disruption and large DNA fragment deletion based on a chimeric promoter in Acremonium chrysogenum

Journal Pre-proofs Improvement of the CRISPR-Cas9 mediated gene disruption and large DNA fragment deletion based on a chimeric promoter in Acremonium chrysogenum Chang Chen, Jiajia Liu, Chengbao Duan, Yuanyuan Pan, Gang Liu PII: DOI: Reference:

S1087-1845(19)30214-2 https://doi.org/10.1016/j.fgb.2019.103279 YFGBI 103279

To appear in:

Fungal Genetics and Biology

Received Date: Revised Date: Accepted Date:

8 July 2019 30 September 2019 10 October 2019

Please cite this article as: Chen, C., Liu, J., Duan, C., Pan, Y., Liu, G., Improvement of the CRISPR-Cas9 mediated gene disruption and large DNA fragment deletion based on a chimeric promoter in Acremonium chrysogenum, Fungal Genetics and Biology (2019), doi: https://doi.org/10.1016/j.fgb.2019.103279

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2019 Elsevier Inc. All rights reserved.

Improvement of the CRISPR-Cas9 mediated gene disruption and large DNA fragment deletion based on a chimeric promoter in Acremonium chrysogenum

Chang Chen1,3, Jiajia Liu1,3, Chengbao Duan1,3, Yuanyuan Pan1, Gang Liu1,2,3*

1State

Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of

Sciences, Beijing 100101, China 2The

Innovative Academy of Seed Design, Chinese Academy of Sciences, Beijing

100864, China 3University

of Chinese Academy of Sciences, Beijing 100049, China

*Corresponding author. Mailing address: The State Key Laboratory of Mycology, Institute of Microbiology, ChineseAcademy of Sciences, Beijing 100101, China. Phone:(86)-10-64807892. Fax:(86)-10-64806017. E-mail: [email protected].

1

Abstract Acremonium chrysogenum has been employed in the industrial production of cephalosporin C (CPC). However, there are still some impediments to understanding the regulation of CPC biosynthesis and improving strains due to the difficulty of genetic manipulation in A. chrysogenum, especially in the CPC high-producing strain C10. Here, an improved CRISPR-Cas9 system was constructed based on an U6/tRNA chimeric promoter. Using this system, high efficiency for single gene disruption was achieved in C10. In addition, double loci were simultaneously targeted when supplying with the homology-directed repair templates (donor DNAs). Based on this system, large DNA fragments up to 31.5 kb for the yellow compound sorbicillinoid biosynthesis were successfully deleted with high efficiency. Furthermore, CPC production was significantly enhanced when the sorbicillinoid biosynthetic genes were knocked out. This study provides a powerful tool for gene editing and strain improvement in A. chrysogenum.

Keywords: Acremonium chrysogenum; Chimeric promoter; CRISPR-Cas9; Large DNA fragment deletion; Targeted gene disruption; tRNA.

2

1. Introduction Acremonium chrysogenum is an important industrial fungus for producing the β-lactam antibiotic cephalosporin C (CPC) and its derivates (Ozcengiz and Demain, 2013). Traditional genetic manipulation by homologous recombination (HR) has low efficiency in A. chrysogenum. The ku70 deletion improves the recombination rate in this strain (Bloemendal et al., 2014), but deficiency of ku70 could lead to unknown physiological changes. Moreover, this strategy is complicated and laborious for disruption of multiple genes. Therefore, an efficient tool is required for studying the regulation of CPC biosynthesis and for directed strain improvement of A. chrysogenum. The clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR associated protein (Cas9), which function as an adaptive immune system in bacteria and archaea, have been adapted as a precise and efficient gene editing tool in various species (Cong et al., 2013; Doudna and Charpentier, 2014; Mali et al., 2013; Nodvig et al., 2015). In this system, the Cas9 endonuclease forms a ribonucleoprotein (RNP) complex with a chimeric single-strand guide RNA (sgRNA) (Jinek et al., 2012). The guide ability depends on the 20 bp nucleotide sequence in the 5’-region of the sgRNA, which complements the protospacer in the genome (Makarova et al., 2015). The 3’-region of the protospacer adjacent motif (PAM) contains a 5’-NGG DNA motif. The double strand break (DSB) introduced by the RNP complex in the targeted locus is repaired by nonhomologous end-joining (NHEJ), which could produce an indel that often causes a frameshift mutation (Hsu et al., 2014). If supplied 3

with a homology-directed repair template (donor DNA) simultaneously, the DSB would be repaired by a homologous recombination (HR). The CRISPR-Cas9 system has been used in several filamentous fungi (Arazoe et al., 2015; Fuller et al., 2015; Liu et al., 2015; Nodvig et al., 2015; Pohl et al., 2016). The robust and exact expression of sgRNA is a key parameter for efficient gene editing (Zheng et al., 2018). Recently, it was reported that a CRISPR-Cas9 system based on the RNA polymerase II promoter-driven self-cleavage ribozyme sgRNA cassette has been used for single gene disruption in the A. chrysogenum CGMCC 3.3795 which produces very low yield of CPC (Chen and Chu, 2019), but no application of CRISPR-Cas9 system in the CPC high-producing stain has been reported so far. In this study, we established an improved CRISPR-Cas9 system in the CPC high-producing strain C10 based on an U6/tRNA chimeric promoter. Using the chimeric promoter led to high efficiency for both single and double gene disruptions, and a large DNA fragment was deleted when supplying with donor DNAs. This study provides a powerful tool for targeted gene disruption and large DNA fragment deletion in the CPC high-producing strain of A. chrysogenum.

2. Materials and Methods 2.1. Strains, plasmids, media, and culture conditions Strains and plasmids used in this study are listed in Table S1. The A. chrysogenum C10 has a higher yield of CPC compared with A. chrysogenum ATCC11550 (Liu et al., 2001). TSA, LPE and the modified MDFA medium were 4

used for the cultivation and fermentation of A. chrysogenum C10 as described previously (Liu et al., 2017a). 2.2. sgRNA design Protospacers were designed by sgRNAcas9 software (Xie et al., 2014) according to the A. chrysogenum ATCC11550 genome (Terfehr et al., 2014). 2.3. Plasmid construction Primers used in this study are listed in Table S2. The cas9 expression cassette was amplified from the plasmid FM6 (Zhang et al., 2016) with the primers Gpd-AscI-F/TrpC-AscI-R, and ligated into the AscI site of pAg-H3 to generate the cas9-expressed plasmid pLC1. For expressing the sgRNA, the heterologous U6 promoter (AfU6p) was amplified from

the

genome

of

Aspergillus

fumigatus

Af293.1

with

the

primers

afu6-PacI-F/afu6-acpcbab-R. The sgRNA scaffold was synthesized by BGI (Beijing, China). The sgRNA for targeting pcbAB was amplified from the sgRNA scaffold with the primers acpcbab-F/gRNA-PacI-R and was named pcbab. Then the AfU6p and pcbab were ligated into the PacI site of pLC1 via Gibson assembly (Gibson et al.,

2009), thus generating pLC2. To construct the plasmid pLC3 (MN400966), fragments including the AfU6p, pcbab and two tRNAGlys were ligated into the SrfI site of pLC1 which were amplified with the primers afu6p-F/afu6p-Gly-R, Gly-F/Gly-pcbab-R, acpcbab-F/grna-Gly-R and grna-Gly-F/Gly-T-R via Gibson assembly. The cassettes for targeting sorB, niaD, and acA were amplified from pLC3 with the corresponding overlapped primers (afu6p-F/Gly-sor-R and sor-F/Gly-T-R, afu6p-F/Gly-niad2-R and 5

niad2-F/Gly-T-R, afu6p-F/Gly-AcA-R and AcA-F/Gly-T-R). Then these cassettes were ligated into the SrfI site of pLC1, thereby generating pLC4, pLC5 and pLC6, respectively. The plasmid for simultaneously targeting niaD and sorB was constructed as follows. The chimeric promoters and sgRNAs for targeting niaD and sorB were amplified

with

the

primers

afu6p-F/Gly-niad2-R,

niad2-F/Gly-sor-R

and

sor-F/Gly-T-R. Then, they were ligated into the SrfI site of pLC1via Gibson assembly to generate the plasmid pLC7. The homology-directed repair templates (donor DNAs) of niaD and sorB were amplified from the genome of C10 with the primers NLA-F/NLA-R, NRA-F/NRA-R, SLA-F/SLA-R and SRA-F/SRA-R. Then they were cloned into the SrfI site of pLC7 via Gibson assembly, resulting in the plasmid pLC8. The plasmids for large DNA fragments deletion were constructed using the similar strategy as that for constructing the pLC8. For deleting the 17.5 kb DNA fragment, the chimeric promoter and the sgRNAs were amplified with the primers afu6p-F/17kL-R, 17kL-F/17kR-R and 17kR-F/Gly-T-R. The resulting fragments were cloned into the SrfI site of pLC1 to generate the plasmid pLC9. For deleting the 31.5 Kb DNA fragment, the chimeric promoter and the sgRNAs were amplified with the primers afu6p-F/31kL-R, 31kL-F/31kR-R and 31kR-F/Gly-T-R. The resulting fragments were also cloned into the SrfI site of pLC1 to generate the plasmid pLC10. The homology-directed repair templates (donor DNAs) of the targeted loci were amplified from C10 with the primers LA-F/LA-R, RA-F/RA-R, LA’-F/LA’-R and RA-31k-F/RA-R. Then they were cloned into the SrfI site of pLC9 or pLC10 to 6

generate the plasmid pLC11 or pLC12, respectively. 2.4. Transformation All of the constructed plasmids for the gene disruption and large DNA fragments deletion were introduced into A. chrysogenum C10 through the Agrobacterium tumefaciens-mediated transformation as described previously (Khang et al., 2006;Liu et al., 2017a). 2.5. Determination of CPC production The fermentation and detection of CPC production were carried out as described previously (Long et al., 2012). Bacillus subtilis CGMCC 1.1630 was used as the indicator strain in the bioassays through a disk diffusion test. 2.6. Genomic DNA extraction The fungal genomic DNA was extracted in liquid nitrogen with mortar and pestle and was isolated with a DNA Quick Plant System (TianGen, China) according to the commercial manual. DNA sequencing was carried out by SinoGenoMax (Beijing, China). 2.7. Western blot analysis To examine the expression of cas9, Western blot analysis was performed as described previously (Liu et al., 2017a). Total cellular extracts from A. chrysogenum were collected after culturing for 72 h. Proteins were separated by the 8% SDS-PAGE followed by immunoblotting with an anti-FLAG antibody (CMC-TAG). GAPDH was used as the control. 2.8. Statistical analysis 7

All data were expressed as the mean ± SD. Differences were determined by 2-tailed Student's t-test between two groups in Excel (Microsoft). Statistical significance is indicated as * for p < 0.05 and ** for p < 0.01.

3. Results 3.1. Expression of cas9 in the CPC high-producing strain C10 To establish a CRISPR-Cas9 system in the CPC high-producing strain C10, the plasmid pLC1 carrying the cas9 cassette (Fig. 1A) was introduced. The designed Cas9 protein includes a FLAG tag at its N-terminus for protein detection. In addition, it includes the SV40 NLS at its N-terminus and the nucleoplasmin NLS at its C-terminus to promote its nuclear localization. Three transformants were randomly selected and were confirmed by PCR analysis. Western blotting showed a specific band (164 kDa) in the verified transformants (Fig. 1B).These results confirmed that cas9 was expressed in C10. Before using the CRISPR-Cas9 system, it is imperative that cas9 expression is not deleterious for the growth and CPC production of C10. Therefore, the influence of cas9 expression on the fungal growth and CPC production was checked during fermentation. The results demonstrated no significant difference (t>0.05) in CPC production and dry mycelium weight during fermentation between C10 and the cas9-expressing strains (Fig. 1C and 1D), thus indicating that the constitutive expression of cas9 did not influence the CPC production and the growth of C10. 3.2. The CRISPR-Cas9 system based on an AfU6p/tRNA chimeric promoter 8

Except the endonuclease Cas9, the efficient CRISPR-Cas9 system requires the robust expression of sgRNA. The A. fumigatus U6 promoter (AfU6p) was considered since it has been commonly used in fungi. The key gene pcbAB (ACRE_003240) involved in cephalosporin biosynthesis was chosen as the target to test the efficiency of this CRISPR-Cas9 system in C10. Since pcbAB disruption mutants were expected to lose their ability to produce CPC, these clones can be identified through their inability to give rise to inhibition halos in bioassay experiments. The selected protospacers are listed in Table 1. The sgRNA for targeting pcbAB was constructed by an overlapping PCR, and then it was ligated into the PacI site of pLC1 to generate pLC2. After pLC2 was introduced into C10, hundreds of colonies have been selected, but no one showed a defect in producing CPC even with further streaked as reported (Nodvig et al., 2015; Zhang et al., 2016). The promoter AfU6p generally has low activity in the heterologous host (Katayama et al., 2016; Zheng et al., 2017), which could be the reason for low targeting efficiency. To improve it, a tRNA encoding fragment was fused to the U6 promotor as previously described (Xie et al., 2015).

tRNAGly (ACRE_053150) was chosen for

fusing with AfU6p (Fig. 2A). When tRNA is placed on both sides of sgRNA, it leads to the precise release of sgRNA in vivo. Meanwhile, due to the presence of internal recognition/recruitment motifs (Xie et al., 2015) for RNA pol III, the tRNA fragments also promote the transcription of sgRNA. To test this improved CRISPR-Cas9 system, pcbAB was targeted after the plasmid pLC3 carrying sgRNA under the control of a chimeric promoter was introduced into C10. Ninety transformants in total 9

were selected and their CPC production was determined through bioassay. On average, 90% of the hygromycin resistant transformants lost the ability to produce CPC (Fig. S2), demonstrating that the targeting efficiency using the improved CRISPR-Cas9 system was much higher than the efficiency of traditional homologous recombination (~5%) in A. chrysogenum (Kuck and Hoff, 2010). As a control, the transformants expressing cas9 only still produced CPC. Thirty-six of the CPC-non producing transformants were randomly selected and sequenced. Sequencing analysis revealed that all of them contain indels around the protospacer region. The most frequent mutation was a deletion of a single G just three base pairs upstream of the PAM site, whereas other types of indel only appeared once or twice in the thirty-six transformants (Table 2). Next, three other genes (sorB, niaD and acA) were chosen as the targets to address whether this high efficiency was locus-specific. sorB (ACRE_048170) encodes a polyketide synthase which is involved in the biosynthesis of the yellow compound sorbicillinoid in A. chrysogenum (Derntl et al., 2017; Guzman-Chavez et al., 2017). niaD (ACRE_046650) is the nitrate reductase-encoding gene. acA (ACRE_004040) encodes a SAM-dependent methyltransferase with an unknown function. All of the protospacers are listed in Table 1. At all the loci, the improved CRISPR-Cas9 system exhibited similar targeting efficiency (Fig. 2B). These results indicated that this improved CRISPR-Cas9 system is a powerful tool for targeted gene disruption in C10. The nature of the mutations obtained in these three genes was determined (Table 2). In agreement with the results with pcbAB, one base pair 10

insertion or deletion just three base pairs upstream of the targeted PAM site had occurred in most of gene disruption mutants of sorB, niaD and acA. These data also agree with the fact that Cas9 generally introduces DSB three base pairs upstream of the PAM site. Sequencing analysis revealed that a proportion of the transformants displayed overlapping sequence peaks beginning at the mutagenesis site (Fig. 2C). This phenomenon was found in all single locus targeting experiments (29% among mutagenesis colonies of acA, 42% among mutagenesis colonies of pcbAB, 72% among mutagenesis colonies of sorB, 73% among mutagenesis colonies of niaD). These data suggested that the transformants were heterokaryotic. Based on the hypothesis, the transformant sorB-59 which contains the overlapping peaks in the mutagenesis site was separated and purified (Fig. 2C). After single colony purification, sorB-59-1 and sorB-59-2 were obtained as two pure homokaryotic colonies from sorB-59. Sequencing analysis revealed that the overlapping peaks of sorB-59 were caused by the mix of two different mutagenesis type cells, thus confirming our hypothesis. 3.3. CRISPR-Cas9 mediated double gene disruption in C10 To investigate whether this improved CRISPR-Cas9 system is efficient for multiple loci editing, niaD and sorB were chosen for subsequent experiments. The sgRNAs of niaD and sorB were ligated in tandem and was used for the double gene disruption without providing the donor DNA. Unfortunately, no disruption mutant of niaD and sorB was obtained. Since there was a high efficiency for targeting a single locus, it was unexpected that no double gene disruption mutant was obtained. 11

Meanwhile, it was difficult to obtain transformants carrying the plasmid pLC7 expressing the tandem sgRNA of niaD and sorB. Since DSBs induced by Cas9 could be lethal for fungi if they cannot be repaired, this result suggests that more than one sgRNA may exceed the repairing capability of C10. Thus, the homology-directed repair templates (donor DNAs) were added to the construct. To express the repair templates, the 800 bp homologous arms were ligated in tandem at the SrfI sites of pLC7 through a Gibson assembly, generating pLC8 (Fig. 3). After transformation, twenty hygromycin resistant colonies were randomly selected for PCR analysis. Most PCR products from these colonies showed two bands (Fig. 4A), one band was similar to the wild-type control, and the second band was approximately 200 bp smaller than the control. The colonies which PCR products possessing smaller bands in two loci simultaneously were likely the double gene disruption mutants. To confirm this prediction, clones #3 and #10 in Fig. 4A were chosen, and they were separated and purified. The purified clones did not show multiple PCR bands, allowing us to obtain double targeted isolates (Fig. 4B and 4C). There were no changes at those loci when the plasmid was introduced without sgRNA (data not shown). One of the double targeted isolates was selected and sequenced. The 200 bp deletions both in niaD and sorB were confirmed (Fig. 4D). 3.4. CRISPR-Cas9 mediated large DNA fragment deletion in C10 To test whether this improved CRISPR-Cas9 system could be applied to large DNA fragment deletion in C10, the gene cluster for biosynthesis of the yellow compound sorbicillinoid was chosen as the target (Derntl et al., 2017). First, the locus 12

(approximately 17.5 kb) containing sorA and sorB was targeted. The sgRNAs in tandem were used for targeting the flanking regions of the 17.5 kb DNA fragment, together with the homology-directed repair templates (800 bp DNA fragment for left arm and 718 bp DNA fragment for right arm) flanking the targeted fragment (Fig. 5A). After the plasmid pLC11 was introduced into C10, twelve colonies were selected randomly and were analyzed by PCR using the primers 17ktest-F/17ktest-R. Nine of twelve (75%) colonies showed the expected band at 1755 bp (Fig. 5B). Partial sequence of sorB was amplified in some colonies reflecting colonies heterogeneity. Furthermore, we expanded the targeting scale up to 31.5 kb which covers the sorbicillinoid biosynthesis gene cluster from sorR2 to sorA. Twelve colonies were selected

randomly.

After

being

analyzed

by

PCR

using

the

primers

31ktest-F/17ktest-R, eight colonies (66.7%) showed the expected band at 1776 bp (Fig. 5C). The colony heterogeneity was also found in the large DNA fragment deletion experiments. The first lane of those colonies from either the 17.5 kb deletion mutants or the 31.5 kb deletion mutants was selected and designated 17.5 k-1 and 31.5 k-1, respectively. Sequencing analysis revealed that either the 17.5 kb DNA fragment or the 31.5 kb DNA fragment was deleted successfully (Fig. 5D). These results demonstrated that the improved CRISPR-Cas9 system is efficient for large DNA fragment deletion in C10. 3.5. Deletion of the sorbicillinoid biosynthetic genes increases CPC production Since sorbicillinoids show a yellow color, that the culture broth turns yellow during fermentation indicates that a certain amount of sorbicillinoids is accumulated. 13

As one of the secondary metabolites, the sorbicillinoid production could compete for energy or carbon sources with the CPC biosynthesis (Salo et al., 2016; Terfehr et al., 2017). To figure out the relationship between the sorbicillinoid and CPC synthesis, fermentations of C10, 17.5 k-1 and 31.5 k-1 were performed. Fermentation broth from17.5 k-1 and 31.5 k-1 did not turn yellow, which indicated the sorbicillinoid biosynthesis was blocked (Fig. 6A). Meanwhile, the CPC production was significantly increased in the 17.5 k-1 and 31.5 k-1 strains compared with that of C10 (Fig. 6B), which indicated that deletion of the sorbicillinoid biosynthetic genes could enhance CPC production in C10 probably through blocking the sorbicillinoid biosynthesis.

4. Discussion The efficiency of CRISPR-Cas9-mediated gene editing depends on the Cas9 protein and sgRNA (DiCarlo et al., 2013). cas9 can be expressed conveniently using an RNA pol II promoter, such as PgpdA, which has been widely used (Zhang et al., 2016). The expression of sgRNA is usually driven by RNA pol III to avoid post-transcriptional modifications (Cong et al., 2013). The U6 promoter is the most widely used RNA polymerase III promoter, but it has not been characterized in A. chrysogenum. Heterologous U6 promoters have been reported to have low efficiency (Katayama et al., 2016; Zheng et al., 2017). tRNA is a small noncoding RNA that is transcribed by RNA pol III (Phizicky and Hopper, 2010). Using tRNA could enhance the sgRNA transcription (Xie et al., 2015). Meanwhile, the splicing mechanism of 14

tRNA maturation ensures the precise release of sgRNA (Phizicky and Hopper, 2010). Through fusing tRNA to a heterologous U6 promoter, we achieved a high efficiency for targeted gene disruption in C10. The U6 promoter activity requires the defined initiating nucleotide (G), which limits the choice of a protospacer. The chimeric promoter strategy can overcome this disadvantage. Compared with the system that was recently applied in A. chrysogenum, which was based on RNA polymerase II promoter-driven self-cleavage ribozymes sgRNA expression (Chen and Chu, 2019), our system is easy to construct and can be used for simultaneously targeting multiple loci. Based on this improved CRISPR-Cas9 system, we achieved double gene disruption in one step and a large DNA fragment deletion in C10. In Blastomyces dermatitidis (Kujoth et al., 2018), multiple gene disruption could be obtained by introducing multiple sgRNAs. However, we could not obtain the mutant strains until we added the homology-directed repair templates. DSBs limit the survival of many fungi, and the efficient CRISPR-Cas9 system has a strong lethality (Nødvig et al., 2018). Our results suggested that multiple loci targeting is too lethal for survival of A. chrysogenum C10 without the repair templates. Using this improved CRISPR-Cas9 system, we successfully deleted large DNA fragments up to 31.5 kb at 66.7% efficiency. To our knowledge, this could be the largest DNA fragment deletion in A. chrysogenum so far. Deletion of the sorbicillinoid biosynthesis cluster eliminated the sorbicillinoid production and enhanced CPC production. These results demonstrated that this system could be used 15

for deleting whole secondary metabolism gene clusters or gene families that influence CPC production in A. chrysogenum. During gene editing using this improved system, a phenomenon that targeted colonies possessed multiple mutagenesis or contained a mixture of mutagenesis and wild-type was observed. A similar phenomenon was also found in other filamentous fungi, such as B. dermatitidis, U. maydis and A. niger (Kujoth et al., 2018; Liu et al., 2017b; Schuster et al., 2018; Zheng et al., 2018). As a reflection of the colony heterogeneity, a colony contains a mixture of nuclei with a different sequence. Compared with the heterokaryosis in multinucleate Blastomyces cells (Kujoth et al., 2018), we inferred this mixture as being caused by different cells containing different nuclei since we did obtain pure clones through colony separation and purification. Agrobacterium tumefaciens-mediated transformation should not be the reason, since a similar phenomenon also exists in another transform method (Liu et al., 2017b). The A. chrysogenum C10 is a CPC high-producing strain that has been widely studied (Liu et al., 2001). There are many differences between C10 and the wild-type strain due to strain improvement, such as in morphology and sensitivity to carbon catabolite repression (Shen et al., 1986). In this work, we established an efficient CRISPR-Cas9 system for gene editing in C10. Those results indicate that this system could also be applied for gene editing in the industrial strain of A. chrysogenum. In summary, we established an efficient CRISPR-Cas9 system based on a chimeric promoter in the CPC high-producing strain C10 of A. chrysogenum. Single gene disruption is highly efficient without locus specific and targeting for double loci 16

was achieved via a single transformation. Large DNA fragments were successfully deleted using this system. This improved CRISPR-Cas9 system will promote a study on the regulation of CPC biosynthesis and industrial strain improvement in the future.

5. Acknowledgements We are grateful to Prof. Ling Lu (Nanjing Normal University, China) for providing the plasmid FM6, Prof. Seogchan Kang (Penn State University, USA) and Prof. Xingzhong Liu (Institute of Microbiology, Chinese Academy of Sciences) for providing plasmid pAg1-H3. We thank Prof. Francisco Fierro (Universidad Autónoma Metropolitana-Unidad Iztapalapa, Mexico) for providing the A. chrysogenum C10.This work was supported by grants from the National Natural Science Foundation of China (31670091) and Biological Resources Programme, Chinese Academy of Sciences (KFJ-BRP-009).

17

References Arazoe, T., Miyoshi, K., Yamato, T., Ogawa, T., Ohsato, S., Arie, T., Kuwata, S., 2015. Tailor-made CRISPR/Cas system for highly efficient targeted gene replacement in the rice blast fungus. Biotechnol Bioeng. 112, 2543-2549. Bloemendal, S., Loper, D., Terfehr, D., Kopke, K., Kluge, J., Teichert, I., Kuck, U., 2014. Tools for advanced and targeted genetic manipulation of the beta-lactam antibiotic producer Acremonium chrysogenum. J Biotechnol. 169, 51-62. Chen, C., He, J., Gao, W., Wei, Y., Liu, G., 2019. Identification and characterization of an autophagy-related gene Acatg12 in Acremonium chrysogenum. Curr Microbiol. 76(5), 545-551. Chen, G., Chu, J., 2019. Characterization of two polyketide synthases involved in sorbicillinoid

biosynthesis

by

Acremonium

chrysogenumusing

the

CRISPR/Cas9 system. Appl Biochem Biotechnol. 188(4), 1134-1144. Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W., Marraffini, L.A., Zhang, F., 2013. Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819-23. Derntl, C., Guzman-Chavez, F., Mello-de-Sousa, T. M., Busse, H.J., Driessen, A.J.M., Mach, R.L., Mach-Aigner, A.R., 2017. In vivo study of the sorbicillinoid gene cluster in Trichoderma reesei. Front Microbiol. 8, 2037. DiCarlo, J.E., Norville, J. E., Mali, P., Rios, X., Aach, J., Church, G.M., 2013. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 41, 4336-43. 18

Doudna, J.A., Charpentier, E., 2014. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 346, 1258096. Fuller, K.K., Chen, S., Loros, J.J., Dunlap, J.C., 2015. Development of the CRISPR/Cas9 system for targeted gene disruption in Aspergillus fumigatus. Eukaryot Cell 14, 1073-80. Gibson, D.G., Young, L., Chuang, R.Y., Venter, J.C., Hutchison, C.A., 3rd, Smith, H.O., 2009. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 6, 343-5. Guzman-Chavez, F., Salo, O., Nygard, Y., Lankhorst, P.P., Bovenberg, R.A.L., Driessen, A.J.M., 2017. Mechanism and regulation of sorbicillin biosynthesis by Penicillium chrysogenum. Microb Biotechnol. 10, 958-968. Hsu, P.D., Lander, E.S., Zhang, F., 2014. Development and applications of CRISPR-Cas9 for genome engineering. Cell 157, 1262-78. Hu, P., Wang, Y., Zhou, J., Pan, Y., Liu, G., 2015. AcstuA, which encodes an APSES transcription regulator, is involved in conidiation, cephalosporin biosynthesis and cell wall integrity of Acremonium chrysogenum. Fungal Genet Biol. 83, 26-40. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., Charpentier, E., 2012. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821. Katayama, T., Tanaka, Y., Okabe, T., Nakamura, H., Fujii, W., Kitamoto, K., Maruyama, J., 2016. Development of a genome editing technique using the 19

CRISPR/Cas9 system in the industrial filamentous fungus Aspergillus oryzae. Biotechnol Lett. 38, 637-42. Khang, C.H., Park, S.Y., Rho, H.S., Lee, Y.H., Kang, S., 2006. Filamentous fungi (Magnaporthegrisea and Fusarium oxysporum). Methods Mol Biol. 344, 403-20. Kuck, U., and Hoff, B., 2010. New tools for the genetic manipulation of filamentous fungi. Appl Microbiol Biotechnol. 86, 51-62. Kujoth, G.C., Sullivan, T.D., Merkhofer, R., Lee, T.J., Wang, H., Brandhorst, T., Wuthrich, M., Klein, B. S., 2018. CRISPR/Cas9-mediated gene disruption reveals the importance of zinc metabolism for fitness of the dimorphic fungal pathogen Blastomyces dermatitidis. MBio. 9, e00412-18. Li, J., Pan, Y., Liu, G., 2013. Disruption of the nitrogen regulatory gene AcareA in Acremonium chrysogenum leads to reduction of cephalosporin production and repression of nitrogen metabolism. Fungal Genet Biol. 61, 69-79. Liu, G., Casqueiro, J., Banuelos, O., Cardoza, R.E., Gutierrez, S., Martin, J.F., 2001. Targeted inactivation of the mecB gene, encoding cystathionine-gamma-lyase, shows that the reverse transsulfuration pathway is required for high-level cephalosporin biosynthesis in Acremonium chrysogenum C10 but not for methionine induction of the cephalosporin genes. J Bacteriol. 183, 1765-72. Liu, J., Hao, T., Hu, P., Pan, Y., Jiang, X., Liu, G., 2017a. Functional analysis of the selective autophagy related gene Acatg11 in Acremonium chrysogenum. Fungal Genet Biol. 107, 67-76. 20

Liu, Q., Gao, R., Li, J., Lin, L., Zhao, J., Sun, W., Tian, C., 2017b. Development of a genome-editing CRISPR/Cas9 system in thermophilic fungal Myceliophthora species and its application to hyper-cellulase production strain engineering. Biotechnol Biofuels 10, 1. Liu, R., Chen, L., Jiang, Y., Zhou, Z., Zou, G., 2015. Efficient genome editing in filamentous fungus Trichoderma reesei using the CRISPR/Cas9 system. Cell Discov. 1, 15007. Long, L. K., Yang, J., An, Y., Liu, G., 2012. Disruption of a glutathione reductase encoding gene in Acremonium chrysogenum leads to reduction of its growth, cephalosporin production and antioxidative ability which is recovered by exogenous methionine. Fungal Genet Biol. 49, 114-22. Makarova, K.S., Wolf, Y.I., Alkhnbashi, O.S., Costa, F., Shah, S.A., Saunders, S.J., Barrangou, R., Brouns, S.J., Charpentier, E., Haft, D.H., Horvath, P., Moineau, S., Mojica, F.J., Terns, R.M., Terns, M.P., White, M.F., Yakunin, A.F., Garrett, R.A., van der Oost, J., Backofen, R., Koonin, E.V., 2015. An updated evolutionary classification of CRISPR-Cas systems. Nat Rev Microbiol. 13, 722-36. Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E., Church, G.M., 2013. RNA-guided human genome engineering via Cas9. Science 339, 823-6. Nødvig, C.S., Hoof, J.B., Kogle, M.E., Jarczynska, Z.D., Mortensen, U.H., 2018. Efficient oligo nucleotide mediated CRISPR-Cas9 gene editing in Aspergilli. 21

Fungal Genet Biol. 115, 78-89. Nodvig, C.S., Nielsen, J.B., Kogle, M.E., Mortensen, U.H., 2015. A CRISPR-Cas9 system for genetic engineering of filamentous fungi. PLoS One 10, e0133085. Ozcengiz, G., Demain, A.L., 2013. Recent advances in the biosynthesis of penicillins, cephalosporins and clavams and its regulation. Biotechnol Adv. 31, 287-311. Phizicky, E. M., Hopper, A. K., 2010. tRNA biology charges to the front. Genes Dev. 24, 1832-60. Pohl, C., Kiel, J.A., Driessen, A.J., Bovenberg, R.A., Nygard, Y., 2016. CRISPR/Cas9 based genome editing of Penicillium chrysogenum. ACS Synth Biol. 5, 754-64. Salo, O., Guzmán-Chávez, F., Ries, M. I., Lankhorst, P. P., Bovenberg, R. A. L., Vreeken, R. J., Driessen, A. J. M., 2016. Identification of a Polyketide Synthase Involved in Sorbicillin Biosynthesis by Penicillium chrysogenum. Appl Environ Microbiol. 82, 3971-3978. Schuster, M., Schweizer, G., Kahmann, R., 2018. Comparative analyses of secreted proteins in plant pathogenic smut fungi and related basidiomycetes. Fungal Genet Biol. 112, 21-30. Shen, Y.-Q., Wolfe, S., Demain, A. L., 1986. Levels of isopenicillin N synthetase and deacetoxycephalosporin C synthetase in Cephalosporium acremonium producing high and low levels of cephalosporin C. Nat Biotechnol. 4, 61-64. Terfehr, D., Dahlmann, T. A., Kück, U., 2017. Transcriptome analysis of the two unrelated

fungal β-lactam producers

Acremonium

chrysogenum and 22

Penicillium chrysogenum: Velvet-regulated genes are major targets during conventional strain improvement programs. BMC Genomics. 18, 272-272. Terfehr, D., Dahlmann, T.A., Specht, T., Zadra, I., Kurnsteiner, H., Kuck, U., 2014. Genome sequence and annotation of Acremonium chrysogenum, producer of the

beta-Lactam

antibiotic

cephalosporin

C.

Genome

Announc.

2(5):e00948-14. Xie, K., Minkenberg, B., Yang, Y., 2015. Boosting CRISPR/Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proc Natl Acad Sci USA. 112, 3570-3575. Xie, S., Shen, B., Zhang, C., Huang, X., Zhang, Y., 2014. sgRNAcas9: a software package for designing CRISPR sgRNA and evaluating potential off-target cleavage sites. PLoS One 9, e100448. Zhang, C., Meng, X., Wei, X., Lu, L., 2016. Highly efficient CRISPR mutagenesis by microhomology-mediated end joining in Aspergillus fumigatus. Fungal Genet Biol. 86, 47-57. Zheng, X., Zheng, P., Sun, J., Kun, Z., Ma, Y., 2018. Heterologous and endogenous U6 snRNA promoters enable CRISPR/Cas9 mediated genome editing in Aspergillus niger. Fungal Biol Biotechnol. 5, 2. Zheng, Y.M., Lin, F.L., Gao, H., Zou, G., Zhang, J.W., Wang, G.Q., Chen, G.D., Zhou, Z.H., Yao, X. S., Hu, D., 2017. Development of a versatile and conventional technique for gene disruption in filamentous fungi based on CRISPR-Cas9 technology. Sci Rep. 7, 9250 23

Figure Captions Figure 1. Expression of cas9 in C10. (A) Schematic diagram of cas9 expression cassette. Hph, a hygromycin B resistance marker. LB and RB stand for the repeat sequences at the left and right border of T-DNA in pAg1H3 which was used for Agrobacterium tumefaciens-mediated gene transfer. PgpdA and TtrpC indicate the gpdA promoter and the trpC terminator from A. nidulans respectively. 3xFLAG, triple FLAG tag; NLS, nuclear localization sequence. (B) Western blot analysis of the cas9 expression. After 3 days growth, the fungal mycelia were collected and the protein was extracted. The protein was separated on the 8% SDS-PAGE gel. GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was used as a control. (C) CPC production of the cas9-expressing strains in MDFA medium. (D) Dry mycelium weight of the cas9-expressing strains in MDFA medium. Error bars represent the standard

deviations

from

three

independent

experiments.

C10,

the

CPC

high-producing strain of A. chrysogenum; C-1, C-2 and C-3, the cas9-expressing strains. Figure 2. Targeted gene disruption using the CRISPR-Cas9 system with a chimeric promoter for sgRNA expression. (A) Schematic diagram of a chimeric promoter construction. sgRNA was flanked by tRNA on both sides and was expressed under the control of AfU6p. (B) The targeting efficiency of four different loci in the genome of C10. Error bars represent the standard deviations from three independent experiments. pcbAB, Delta-(L-α-aminoadipyl)-L-cysteinyl-D-valine synthetase gene; niaD, the nitrate reductase encoding gene; sorB, a polyketide synthase gene involved in the 24

biosynthesis of the yellow compound sorbicillinoid; acA, a putative SAM-dependent methyltransferase gene. (C) The sequence of the targeted locus in the sorB mutants. SorB-59 contains overlapping sequence peaks in the mutagenesis site. Through single colony purification, sorB-59-1 and sorB-59-2 were obtained as the pure homokaryotic colonies from sorB-59. SorB-59-1 contains one base pair insert just three base pairs upstream of the PAM site. SorB-59-2 contains three base pairs deletion upstream of the PAM site. Figure 3. Schematic diagram of the simultaneous disruption of niaD and sorB. The left arm of niaD (NLA), the right arm of niaD (NRA), the left arm of sorB (SLA) and the right arm of sorB (SRA) were assembled via Gibson assembly. Each sgRNA was flanked by tRNA on both sides. C10, the CPC high-producing strain of A. chrysogenum; Double gene disruption mutant, the gene disruption mutant of niaD and sorB. niaDΔ, 200 bp was deleted inside of niaD; sorBΔ, 200 bp was deleted inside of sorB. Figure 4. Disruption of niaD and sorB using the improved CRISPR-Cas9 system in C10. (A) PCR analysis of the targeted loci in the transformants. Twenty transformants were randomly selected for PCR analysis with the outside primers niatest-F/niatest-R and sortest-F/sortest-R. The PCR products from the expected mutants were 200 bp shorter than the control. The PCR product from C10 was used as a control. Clones #3 and #10 in (A) were chosen, and were separated and purified. Twenty isolates from each transformants were randomly selected and analyzed. PCR analysis of the targeted loci in the isolates separated from the Clones #3 (B) and Clones #10 (C) 25

respectively. The purified clones did not show multiple PCR bands, allowing us to obtain double targeted isolates. (D) Sequencing of the targeted loci in the disruption mutant. The 200 bp deletions both in niaD and sorB were confirmed. Figure 5. Large DNA fragment deletion mediated by the improved CRISPR-Cas9 system in C10. (A) The strategy used for large DNA fragment deletion. Part of the putative sorbicillinoid biosynthesis gene cluster was used as the target. sorR2 (ACRE_048120) encodes a transcription factor; sorT (ACRE_048130) encodes a transporter of the multifacilitator superfamily; HYD (ACRE_048140) encodes a hydrolase;

sorR1

(ACRE_048150)

encodes

a

transcription

factor;

FMO

(ACRE_048160) encodes a FAD-dependent monooxygenase; sorB (ACRE_048170) encodes a nonreducing PKS; sorA (ACRE_048180) encodes a highly reducing PKS. Two sgRNAs flanking the targeted region were designed to cause two DSBs. The 800 bp homologous arms flanking the targeted region were used as the repair template. LA and RA stand for the left arm and the right arm of the targeted region (17.5 kb). LA’ stands for the left arm of the targeted region (31.5 kb). The outside primers 17ktest-F/17ktest-R and 31ktest-F/17ktest-R are located outside of the homologous arms. The internal primers sorBseq-F/sorBseq-R are located inside of sorB. (B) PCR analysis of the 17.5 kb targeted region. Upper row shows the PCR product with the outside primers. Nine of twelve colonies showed the expected bands at 1755 bp and were identified as the 17.5 kb DNA fragment deletion mutants. Lower row shows the PCR product with the internal primers. Clone #1 is homokaryotic according to the results of first lane. (C) PCR analysis of the 31.5 kb targeted region. Upper row shows 26

the PCR product with the outside primers. Eight of twelve colonies showed the expected band at 1776 bp and were identified as the 31.5 kb DNA fragment deletion mutants. Lower row shows the PCR product with the internal primers. Clone #1 is homokaryotic according to the results of first lane. Figure 6. Fermentation of the 17.5 kb and 31.5 kb deletion mutants. (A) Colour observation of the 6th day fungal culture broth. (B) The CPC production of the 17.5 kb and 31.5 kb

deletion mutants in MDFA medium. Error bars represent the standard

deviations from three independent experiments. C10, the CPC high-producing strain of A. chrysogenum; 17.5 k-1, the deletion mutant of the 17.5 kb region containing the sorbicillinoid biosynthetic genes sorA and sorB. 31.5 k-1, the deletion mutant of the 31.5 kb region containing the sorbicillinoid biosynthetic gene cluster. Statistical significance is indicated as * for p < 0.05 and ** for p < 0.01.

27

28

29

30

31

32

33

Highlights: 1, An improved CRISPR-Cas9 system based on a chimeric promoter. 2, This system shows a high efficiency for gene disruption in A. chrysogenum. 3, A large DNA fragment was deleted at a high efficiency by the system. 4, Blocking the sorbicillinoid biosynthesis increases the CPC production.

34

Table 1 All protospacers used in this study. sgRNA name

Target

Protospacer

PAM

pcbab

pcbAB

GTCGTCACGATAGAGGGTCA

CGG

niad2

niaD

TCCTACAATGGTCACACCCG

GGG

aca

AcA

TATGTCAACCCCGATTCCTC

TGG

sor

sorB

GCGACTTTCGATGTCATCGA

TGG

17kL

The left side of sorA

GGTTTCTTGCGCTGATCATCA

AGG

17kR

The right side of sorB

AGGGTGACGAGGTCCTATCC

TGG

31kL

The right side of sorR2

GAGTAGCCCCCACAATGTCA

CGG

35

Table 2 Mutagenesis observed in targeted transformants Target pcbAB

Mutagenesis type

Position

Numbers

Del G Ins A + Del 251 bp Del GATAGAGGG Ins TC Del TAGAGGGTCACGG Del 42 bp Del AGAGGGT

-3 +249 -3 -3 +4 +27 -2

16 1 1 1 2 1 1

Ins AGAGA + Del 32 bp Del 45 bp Del T Del GGGTCACGGGCGCGAAGA Ins AC + Del GTCACGGGCGCGAAG Ins ATATATATATATATATAT Ins T Del 67bp Del ATAGAGGG Ins C Del 34bp Ins A

-3 +37 -2 +13 +12 +5 +5 +1 -3 -5 +24 -3

1 1 1 1 1 1 2 1 1 1 1 1

sorB

Ins T Del ATGTCAT Ins AAGAGAAAGACAGTGGGAATCAA Del TCA

-3 -3 -4 -4

31 1 1 3

niaD

Del C Del AACCGCGTTCTTCCTACAATGGTCACAC Del AC Del CC Ins CC＋Del ACACCCGGGGCA

-3 -3 -3 -2 +6

11 1 1 1 1

AcA

Del C Del TCC Ins A Del CCGATT Del TTC Ins GGGCTA + Del CCCCGATTC Del 55bp Del ATTC Del CCTCTGGCGCC Del TC Ins 154bp + Del 161 bp

-3 -2 -3 -4 -3 -3 +30 -3 +8 -3 +118

24 1 1 1 1 1 1 1 1 1 1

Del, deletion; Ins, insert. First base of PAM is definded as +1. Position stands for the distance form the mutagenesis site to the first base of PAM. Numbers stand for the numbers of mutagenesis occurrences. 36