Increased keratinocyte proliferation initiated through downregulation of desmoplakin by RNA interference

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 3 ( 2 00 7 ) 2 3 3 6 –23 4 4

a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m

w w w. e l s e v i e r. c o m / l o c a t e / y e x c r

Research Article

Increased keratinocyte proliferation initiated through downregulation of desmoplakin by RNA interference Hong Wan a,⁎, Andrew P. South b , Ian R. Hart a a

Centre for Tumour Biology, Institute of Cancer and CR-UK Clinical Centre, Barts and The London, Queen Mary's School of Medicine and Dentistry, John Vane Science Centre, Charterhouse Square, London EC1M 6BQ, UK b Centre for Cutaneous Research, Barts and The London, Queen Mary's School of Medicine and Dentistry, 4 Newark Street, London E1 2AT, UK

ARTICLE INFORMATION

ABS T R AC T

Article Chronology:

The intercellular adhesive junction desmosomes are essential for the maintenance of tissue

Received 20 September 2006

structure and integrity in skin. Desmoplakin (Dp) is a major obligate plaque protein which

Revised version received

plays a fundamental role in anchoring intermediate filaments to desmosomal cadherins.

19 December 2006

Evidence from hereditary human disease caused by mutations in the gene encoding Dp, e.g.

Accepted 14 January 2007

Dp haploinsufficiency, suggests that alterations in Dp expression result not only in the

Available online 30 January 2007

disruption of tissue structure and integrity but also could evoke changes in keratinocyte proliferation. We have used transient RNA interference (RNAi) to downregulate Dp

Keywords:

specifically in HaCaT keratinocytes. We showed that this Dp downregulation also caused

RNAi

reduced expression of several other desmosomal proteins. Increased cell proliferation and

Desmoplakin

enhanced G1-to-S-phase entry in the cell cycle, as monitored by colonial cellular density and

Desmosomes

BrdU incorporation, were seen in Dp RNAi-treated cells. These proliferative changes were

Keratinocyte

associated with elevated phospho-ERK1/2 and phospho-Akt levels. Furthermore, this increase

Proliferation

in phospho-ERK/1/2 and phospho-Akt levels was sustained in Dp RNAi-treated cells at confluence whereas in control cells there was a significant reduction in phosphorylation of ERK1/2. This study indicates that Dp may participate in the regulation of keratinocyte cell proliferation by, in part at least, regulating cell cycle progression. © 2007 Elsevier Inc. All rights reserved.

Introduction Desmosomes are specialized cell–cell adhesion junctions enriched in tissues, such as the skin and heart, that are subject to substantial mechanical stress [1–4]. Two members of the cadherin family of adhesion molecules, desmoglein(s) (Dsg) and desmocollin(s) (Dsc), contribute to cell–cell adhesion mediated by desmosomes via their extracellular domains which act in a calcium-dependent manner. Their cytoplasmic tail couples to keratin intermediate filaments through the

cytoplasmic plaque proteins, plakoglobin (Pg), plakophilin(s) (PP) and desmoplakin (Dp). Recent studies suggest that desmosomes function not only as adhesion scaffold structures but also participate in the regulation of keratinocyte cell motility, growth and differentiation [5–8]. Dp is a major obligate protein in desmosomes, where it plays an essential role in anchoring desmosomal cadherins to the keratin intermediate filament network, a process that enhances desmosomal adhesion strength [9–11]. The biological significance of Dp in the maintenance of tissue integrity

⁎ Corresponding author. Fax: +44 207 014 0401. E-mail address: [email protected] (H. Wan). Abbreviations: Ab, antibody; Dp, desmoplakin; Dsc, desmocollin; Dsg, desmoglein; FACS, fluorescence-activated flow cytometry; K14, keratin-14; Pg, plakoglobin; PP, plakophilin; RNAi, RNA interference; siRNA, short interfering RNA 0014-4827/$ – see front matter © 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2007.01.010

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 3 ( 2 00 7 ) 2 3 3 6 –23 4 4

and cellular rigidity has been highlighted by studies in hereditary human diseases and in transgenic animal models [12–16]. Studies in germline knockout or conditional knockout mice reveal that Dp plays a critical role in epithelial sheet formation as well as in various tissue modeling events in heart muscle, neuroepithelium, epidermis and microvasculature [14–16]. Interestingly, a mild form of the striate palmoplantar keratoderma caused by Dp haploinsufficiency manifests itself preferentially at sites, such as the palm and sole, which exhibit increased keratinocyte proliferation and altered differentiation [17]. This finding suggests strongly that the presence of only one functional allele at such sites is insufficient to maintain normal desmosomal function. Our previous studies have shown that desmosomes at such stress burden sites are larger in size overall although no difference in desmosome density is observed as compared with thin skin (e.g. breast) [18]. We demonstrated, in previous work, a differential proliferative capacity in two separate populations of human adult keratinocytes based on different levels of expression of the desmosomal protein Dsg3 [19]. Sorting for cells with low levels of Dsg3 expression (Dsg3dim) isolated a population which showed an increased colony forming efficiency (CFE) and heightened proliferative potential relative to cells with a high level of Dsg3 expression (Dsg3bri) [19]. Cells with high β1 integrin expression, that is, the rapidly adhering cells [20,21], exhibited low levels of desmosomal protein expression, including that of Dp. These data suggest that the desmosomes and their protein expression levels may correlate directly with epithelial cell proliferation and differentiation status. To address this question, we carried out studies on targeting downregulation of Dp by transient RNA interference (RNAi) in immortalized HaCaT human keratinocytes, a cell line which frequently is used as a paradigm of skin development in vitro [20,21], and investigated the effect of Dp knockdown on cell proliferation and differentiation. We show in this in vitro study, with transient RNAi, that Dp plays a role in the control of cell proliferation and differentiation in stratified epithelial tissue.

Materials and methods Antibodies Mouse monoclonal and rabbit polyclonal antibodies (Ab) used were as follows: DG3.10, mouse anti-Dsg1 + 2 (RDI); 5G11, mouse anti-human Dsg3 (Serotec), Dsg1-P124, mouse antiDsg1 (Progen); Dsc3-U114, mouse anti-human Dsc3 (Progen); Pab to Dsc2, rabbit Ab to Dsc2a and Dsc2b (Progen); 115F, mouse Ab against Dp (gift from Professor D Garrod); AHP320, rabbit Ab against Dp (Serotec), PG5.1, mouse Ab against Pg (Cymbus); 11E4, mouse anti-γ catenin [plakoglobin] (Chemicon); PP1-5C2, mouse Ab against PP1 (Progen); mAb to PP2 (2a + 2b) multiepitope cocktail (Progen); ab2498, mouse anti-PP3 (Abcam); HECD-1, mouse anti-E-cadherin (DAKO); 6F9, mouse anti-βcatenin (Sigma); mouse anti-α-catenin (Transduction Lab); mouse anti-K14 LL001 (CRUK); SY5, mouse anti-involucrin (Abcam); rabbit anti-ERK1 and mouse anti-ERK2, rabbit antiPhospho-ERK1/2 (Thr202/Tyr204) Ab, Akt1 (2H10) mAb and

2337

rabbit phospho-Akt (Ser473) Ab (Cell Signaling Technology); β-actin Ab ab6276 (Abcam) and HSC-70 (B-6) (Santa Cruz Biotechnology, Inc.) both were used for loading controls. Secondary Abs were Alexa Fluor 488 conjugated goat antimouse IgG and Alexa Fluor 546 conjugated goat anti-rabbit IgG (Cambridge BioSciences).

Transient Dp siRNA transfection in HaCaT cells An siRNA sequence specific for human Dp mRNA (accession: NM_004415), corresponding to nucleotides 1633 to 1653 of the respective coding region, was designed (AACCCAGACTACAGAAGCAAT) and subjected to a BLAST database search prior to being synthesized by Dharmacon Research (USA). The scrambled controls, a randomized Dp (AACAGCGACTACACCAATAGA) or non-Dp sequence (AAGTTCTGGCTTGTCCAGTCT), were synthesized by the same company. The transfection procedure followed the protocol provided with Oligofectamine Reagent (Invitrogen). Transfection was carried out using Oligofectamine on 1–2 × 105 cells per well in 6-well plates in OPTIMEM 1 (Invitrogen). Cells were washed in OPTIMEM 1 twice prior to addition of 800 μl of serum-free OPTIMEM 1. Then 200 μl of the mixed siRNA of either scrambled or Dp and Oligofectamine (5 μl per well, final concentration 0.1 μM) was added into each well to a final siRNA concentration of 200 nM. Four hours after transfection 500 μl of OPTIMEM 1, supplemented with 30% FBS, was added into each well. Protein expression was determined either by Western blotting or FACS analysis 1–2 days later. In phosphorylation studies, cells were harvested after 1 day and replated at either 0.4 × 106 per well or 1 × 106 per well in 6-well plates to ensure the cell culture reached subconfluence or confluence respectively within the next 2 days prior to protein extraction.

Immunoblotting Protein extraction and Western blotting for the major desmosomal, and other, proteins were carried out as described previously [18]. Western blotting for phospho-ERK1/2 and phospho-Akt as well as total ERK and Akt1 proteins followed the protocol supplied by the company (Cell Signaling Technology). Western blots were scanned as the TIFF image files. Densitometry analyses of the Western blot bands were conducted using the histogram tool in Adobe Photoshop or ImageJ software. Band density was normalized to the loading control for each individual sample and presented as a fold change of the mean of the scrambled control.

Immunofluorescent staining and laser scanning confocal microscopy Immunofluorescence images were acquired following the procedure described previously [18].

Immunofluorescent staining and flow cytometry HaCaT cells routinely were suspended in trypsin/versene. For intracellular Dp labeling, cells were fixed and permeabilized following the protocol supplied with Caltag Fix and Perm Cell Reagent (CALTAG Laboratory, Invitrogen). Briefly, the cell

2338

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 3 ( 2 00 7 ) 2 3 3 6 –23 4 4

pellet was fixed in 100 μl of fixation reagent for 15 min at RT, washed in FACS buffer (PBS + 5% FBS + 0.1% sodium azide) and then resuspended in 100 μl of permeabilization reagent together with the primary Ab for 20 min at RT. Cells were washed before secondary Alexa Fluor 488 IgG conjugates were added and incubated for 20 min. After a final wash, the cells were resuspended in FACS buffer before analysis on a FACScan (BD Biosciences). Alexa Fluor 488 IgG staining alone was used as the negative control in FACS analysis.

of Dp in treated cells (Figs. 1A and B) (β-actin was used as a loading control, n > 5). Time course studies indicated that Dp reduction persisted for between 2 and 6 days (Fig. 1A). By about 6 days, protein levels started to recover though even after 8 days the reduced expression of Dp still was just detectable (Figs. 1A and B). Confocal microscopic analysis revealed Dp staining located in both the cytoplasmic and peripheral area (presumed cell membrane) of HaCaT cells treated with the scrambled control, however, this staining was evidently diminished in Dp siRNA-treated cells (Fig. 1C). Having 10%

Cell growth assay HaCaT cells were grown in DMEM (CRUK) supplemented with 10% FBS (Bio West) and trypsinized the following day after siRNA transfection (on Day 1) and plated at the seeding density of 500, 1000 and 2000 cells/well, respectively, in 6-well plates on Day 2. On Day 7, cells were transfected with siRNA for the second time at the same concentration. Cells were grown for 12–14 days before fixation in 4% formaldehyde for 10–20 min. After washing in PBS (CRUK) the cellular density was determined by staining colonies with 1% rhodamine (Sigma) and 1% Nile blue (Sigma) before washing and air drying. Quantitation was conducted following the procedure described previously [19]. The means ± SEM of six wells are presented. Statistical analysis was conducted using one-way analysis of variance (ANOVA). Significant differences were determined by p < 0.05.

BrdU incorporation assay After siRNA transfections as described above, cells were replated at low density (i.e. 5–10 × 103 cells in 6-well plates) and analyzed at a series of time points. At each time point, cells were labeled with 10 μM BrdU in normal medium for 45 min before being harvested with trypsin/versene for BrdU staining. The dissociated cells were fixed initially in 1 ml formal saline (NaCl 5 mg/ml, Na2SO4 15 mg/ml, formaldehyde 4%) for 5 min and then in 1 ml of ice-cold 70% ethanol for 10 min. After centrifugation, cells were washed in phosphate buffer saline (PBS) and resuspended in 1 ml of the 0.2 mg/ml pepsin solution (Sigma) containing 0.15 M hydrochloric acid and incubated at 37 °C in a water bath for 12 min. The reaction was neutralized by addition of 3 ml PBS prior to centrifugation. After washes in PBS twice, cells were incubated in anti-BrdU Ab (BD Biosciences) at 1 in 5 in PBS/0.5% Tween 20/1% FCS for 1 h at RT. They were then washed in PBS and incubated in FITC-conjugated rabbit anti-mouse F(ab′)2 fragments (DAKO) at 1 in 10 dilution in PBS/0.5% Tween 20/1% FCS for 30 min in the dark. After the final wash, cells were resuspended in 50 μg/ ml propidium iodide solution and left at RT in the dark for 15 min before analysis by FACScan.

Results HaCaT cells treated with Dp siRNA exhibit significant downregulation of Dp Western blotting and FACS analyses after treatment with Dp siRNA consistently revealed a significant reduced expression

Fig. 1 – Western blotting of Dp after RNAi in HaCaT cells. (A) Time course experiment showed that a substantial reduction of Dp, following transfection with siRNA (200 nM), occurred after 2 days and was most pronounced after 4 days. By 6 days, protein recovery was evident. (B) FACS analysis of Dp expression after siRNA transfection (200 nM) shows a similar time course profile of changes to those determined by Western blotting. (C) Confocal microscopy of cells treated with siRNA for 3 days before being fixed and labeled for Dp with mouse anti-Dp 115F. Both cytoplasmic and peripheral Dp staining is noticeable in scrambled control. Evident, albeit partial, Dp reduction is seen in Dp RNAi-treated cells.

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 3 ( 2 00 7 ) 2 3 3 6 –23 4 4

2339

fetal bovine serum present in the medium during transfection with siRNA significantly reduced the transfection efficiency in HaCaT cells (data not shown), indicating that successful knockdown of Dp by RNAi was achieved more readily in serum-free medium. Western blot analyses were consistent with results obtained from relative fluorescence intensities acquired by FACS (Fig. 1B).

letal structure as detected by immunofluorescence laser scanning confocal microscopy. These alterations consisted of the regular cortical actin in the control cells adopting a less structured, more diffuse and somewhat broadened appearance (data not shown). These changes are consistent with actin re-organization observed in keratinocytes from DP-null mice [16].

Dp knockdown in HaCaTs caused reduced expression of several other desmosomal proteins

Downregulation of Dp by transient RNAi results in increased cellular density

Western blotting analysis (Fig. 2) was conducted using a panel of antibodies against desmosomal, as well as non-desmosomal, proteins; the latter group including structurally related molecules such as adherens junction proteins. We observed consistently that Dsg3 and Pg did not show evident alteration following Dp knockdown by Dp RNAi (Fig. 2A) and FACS analysis (data not shown). No detectable reduction also was seen in the expression of adherens junction proteins such as E-cadherin, β- and α-catenin as well as keratin 14 (Fig. 2A). In contrast Dp knockdown caused a reduction in several other desmosomal proteins including Dsg1, Dsg2, Dsc2 and Dsc3 and all three PP family members examined (Fig. 2B and 2C). Dsc1 was not detected in HaCaTs in our culture conditions. Conversely it was, perhaps, surprising to detect Dsg1 expression in HaCaT cells, albeit at low levels, but the observed downregulation was a consistent finding. Dp knockdown by RNAi was associated with some relatively minor alterations in the organization of actin cytoske-

To address the functional consequence of Dp knockdown on cell proliferation we carried out cell growth assays where cells were treated with either the scrambled or Dp siRNA before being plated at the appropriate density in 60 mm Petri dishes and then grown for 7 days. After such a period of culture the cell density of the colonies remained relatively low. Cells then were treated with siRNA for a second time and grown for a further 5–7 days before fixation and staining to allow colony density to be measured. As compared with the scrambled control, we observed consistently an increased cellular density resulting from cells treated with Dp siRNA (Fig. 3A) (n = 5). Quantitation for the scrambled control and RNAitreated cells indicated that this difference, of about a twofold increase, was statistically significant (Fig. 3B). To rule out any cytotoxic effect caused by RNAi, we performed a Trypan blue exclusion assay and showed that there was no cytotoxicity in RNAi-treated cells relative to the scrambled and untreated control cells (data not shown).

Fig. 2 – Western blotting of desmosomal and adherens junction proteins after treatment with Dp siRNA. Protein extracts of 2 days siRNA (200 nM) transfected cells were subjected to Western blotting analysis. (A) Proteins not showing reduced expression following Dp RNAi treatment included Dsg3, Pg, and the three adherens junction proteins tested. (B) Proteins showing reduced expression by Dp RNAi included Dsc2/3, Dsg1/2, and PP1–3. (C) Densitometric quantitation (mean ± SEM) of Dsg2 (n = 8 blots) and PP2 (n = 3 blots) (* indicates statistically significant, p < 0.05).

2340

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 3 ( 2 00 7 ) 2 3 3 6 –23 4 4

Enhanced cell growth by Dp RNAi was correlated with increased BrdU incorporation and elevated phospho-ERK and phospho-Akt levels in cells

Fig. 3 – Cellular density after treatment with Dp RNAi. (A) Fixed cells after 14 days of growth during which transfection with siRNA (200 nM) was performed twice at days 0 and 7. (B) Quantitation of colony density. Data are mean ± SEM from 6 wells of two independent experiments (* indicates statistically significant, p < 0.05).

BrdU incorporation assays were performed several times (n ≥ 16). In these experiments, cells were transfected with siRNA for 2 days and then labeled with 10 μM BrdU in normal growth medium for 45 min. Cells then were harvested by trypsinization, processed for staining for BrdU and analyzed by FACScan. In agreement with the cell growth assay, we showed enhanced S-phase entry and a reduced G0/G1 cell ratio in Dp RNAi-treated cells as compared with the scrambled control, values which were moderate but statistically significant (Fig. 4A, p < 0.05). Time course experiments with siRNA revealed that this increased BrdU incorporation was most effective 2 days after siRNA transfection, and then gradually declined by 5 to 7 days. A representative individual experiment is illustrated in Fig. 4B. As increased cell proliferation and enhanced S-phase entry of epithelial cells in the cell cycle often are associated with activation of MAPK (mitogen-activated protein kinase) and PI3K (phosphatidylinositol 3-kinase) signaling pathways, we determined, by Western blotting analysis, the expression of phospho-ERK1/2 and phospho-Akt at two culture conditions, i.e. subconfluence and confluence [22]. As shown in Fig. 5, increased expression of phospho-ERK1/2 and phospho-Akt occurred in cells treated with Dp RNAi in subconfluent culture (∼ 2 fold increase) and these elevated levels were retained upon confluence (3 fold increase for phospho-ERK1/2 and ∼2 fold increase for phospho-Akt). Interestingly there appeared to be a definite downregulation of total Akt1 in the RNAi-treated confluent cells. In contrast, and as expected [22], the scrambled control cells showed a significantly reduced expression of phospho-ERK1/2 and an increased expression of phospho-Akt

Fig. 4 – BrdU incorporation assay shows an increased incorporation of BrdU in Dp RNAi-treated cells. (A) Cells, transfected with either scrambled or Dp siRNA (200 nM) for 2 days, were labeled with 10 μM BrdU in normal medium for 45 min before being harvested with trypsin/versene for BrdU staining. Statistical analysis from 16 independent experiments indicates that enhanced S-phase entry and reduced G0/G1 phase cell ratio in cell cycle observed after Dp RNAi are significant. Data are mean ± SEM. (B) Time course with siRNA (200 nM) from a single representative experiment reveals that enhanced S-phase entry is most effective after 2 days then gradually declined by 5 and 7 days.

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 3 ( 2 00 7 ) 2 3 3 6 –23 4 4

2341

strengthening intercellular adhesion and maintaining cellular integrity [9,10,13]. However, whether lack of Dp exerts any effect on alterations in cell growth and differentiation was unclear, although increased cell proliferation and skin thickening frequently were reported in patients suffered from abnormalities in the gene encoding Dp [17,23–25]. In the present study, based on the immortalized keratinocyte cell line HaCaT, we show that altered cell proliferation in vitro can be induced by downregulation of Dp expression. The precise mechanism underlying this phenomenon, and how Dp knockdown results in alteration of some (i.e. Dscs and PP family members) but not all desmosomal proteins (e.g. Dsg3 and Pg) (Figs. 1 and 2), remains unclear at this time. Our blast search results confirmed the high sequence specificity of the Dp siRNA sequence we used, suggesting that the alteration in desmosomal protein expression likely is the secondary event following Dp knockdown. Whether it is Dp reduction per se or the subsequent reduction in other desmosomal proteins which affects these proliferative alterations is not known. The observed reduction of Dsc and PP expression but not Dsg3 and Pg simply may reflect mutual molecular and structural associations among these proteins within desmosome junctions [26,27]. Desmosomes are complex structures and the expression of proteins in this complex is tightly regulated by posttranslational mechanisms [1,28,29]. For example, L-cells

Fig. 5 – Western blotting analysis of phospho-ERK1/2 and phospho-Akt in Dp RNAi-treated cells under subconfluence and confluence culture conditions. (A) Cells were transfected with either scrambled or Dp siRNA for 1 day, then replated at 0.4 × 106 or 1 × 106, respectively, in 6-well plates and grown for another day before protein extraction. (B) Densitometry analysis of the increased expression of phospho-ERK1/2 and phospho-Akt in Dp RNAi-treated cells at the two culture conditions (mean ± SEM).

when the cells were approaching confluence (Fig. 5). Quantitative data, based on densitometric analysis, in Fig. 5B are representative from three independent experiments.

Reduced involucrin expression in cells treated with Dp RNAi We analyzed the expression of an early differentiation marker, involucrin, in cells treated with RNAi both by Western blotting and FACS analysis (data not shown). In five independent experiments, we observed consistently a reduced expression of this protein in cells treated with Dp RNAi as compared with the scrambled control (Fig. 6). This reduced expression of involucrin occurred not only in conditions of subconfluence but also in situations when the cells reached confluence (Fig. 6).

Discussion Dp plays a pivotal role in anchoring keratin intermediate filaments to desmosomes at the cell surface and therefore in

Fig. 6 – Involucrin expression in cells treated with RNAi. (A) Western blot analysis of involucrin expression in subconfluent and confluent cell cultures. HSC-70 is used as the loading control. (B) Densitometric analysis of the involucrin expression at the two culture conditions (mean ± SEM).

2342

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 3 ( 2 00 7 ) 2 3 3 6 –23 4 4

expressing Pg mRNA showed little at the protein level but coexpressing either Dsc3a or Dsg1 induced a significant increase in expression of Pg with resultant complex formation [28]. Similarly DP-null embryos (E6.5) exhibit reduced expression of Dsg2, Dsc2 and PP2 [14]. It has been reported that coordinate expression of Dsg1 and Dsc1 is required in the regulation of intercellular adhesion [29]. Collectively, these data suggest the importance of a balance of desmosomal proteins in the desmosome as a means of regulating adhesion, and presumably other, functions. Several studies have generated data consistent with the possibility that constituent desmosomal proteins might have a profound effect on cell proliferation, motility and differentiation [1,8,30–32]. Modulation of desmosome structure, or loss of desmosome proteins at the cell surface, correlates with wound healing [33] and enhanced cell invasiveness in vitro or tumour progression in vivo [34–37]. Mice lacking Dsc1 exhibited increased cell proliferation which manifested itself as epidermal hyperplasia [38], suprabasal keratinocyte proliferation was increased upon misexpression of Dsc3a and 3b as well as Dsg3 [6,39] while Dsg2 appeared to be essential for normal embryonal stem cell proliferation [40]. The latest study on the pathogenesis of pemphigus vulgaris has revealed that Pg participates in the regulation of the c-Myc gene and highlights the importance and additional function of desmosomal constituent proteins in the control of cell proliferation [32]. The desmosomal cadherin proteins are expressed differentially according to cellular location and differentiation status and thus might be expected to confer, or to reflect, positional information. However, how a universal structural component like desmoplakin affects alterations in cell growth and differentiation is still puzzling. Possibly the effects relate to the paramount role of desmoplakin in stabilizing desmosome and classic adherens junction assembly, establishing and maintaining keratinocyte architecture (both in vivo and in vitro) which, in turn, modulates some signaling events involved in the differentiation program within the cells [16]. Certainly the two junctional complexes, desmosomes and adherens junctions, are spatially and biochemically close to each other in epithelial cells [41]. Several armadillo proteins involved in signaling cascades, such as Pg, PP2, PP4 (p0071), β-catenin and p120-catenin, have been shown to associate with both the adherens junction and desmosome components [31]. Desmosome assembly initiates immediately following adherens junction formation in response to extracellular calcium signaling. Typical punctate Dp, tagged with green fluorescence protein, has been shown by time-lapse microscopy to accumulate at sites of epithelial cell–cell contact within 3–10 min [11]. Such a rapid, dynamic process may suggest a critical role for Dp in governing intercellular junction assembly and intermediate filament organization and thereby affecting cell growth and differentiation. We might even postulate that Dp negatively regulates E-cadherin-mediated initiation and activation of certain molecular events, either directly or indirectly, via other constituent desmosomal proteins. However, although altered expression of Dsc2/3 and PP proteins, as well as the early differentiation marker involucrin, occurred following Dp knockdown by RNAi, no detectable changes were seen in E-cadherin junction proteins either by Western blotting analysis or by immunofluorescence confocal microscopy (Fig. 2 and

data not shown). We did observe a mild modulation of cortical actin microfilament organization in Dp RNAi-treated cells which might indicate perturbation of the steady state of intercellular junctions (data not shown). Keratinocyte cell proliferation and differentiation requires establishment and maturation of intercellular junctions [42]. Both MAPK and PI3K signaling pathways are activated when epithelial cells establish contact with each other via Ecadherin-mediated adhesion [43,44]. However, when the epithelial cells are approaching confluence, and initiating their differentiation program in vitro, the MAPK pathway is downregulated and this is through sustained activation of the E-cadherin-dependent PI3K/Akt pathway [22]. In this study, similar changes also were observed in the control cell population at confluence (Fig. 5). However, enhanced activation of phospho-ERK1/2 was seen not only in subconfluent cells but also was sustained after confluence in the cell population treated with Dp RNAi (Fig. 5A). Moreover, consistently increased levels of phospho-Akt, at the expense of total Akt1, were observed under both culture conditions. There has been some suggestion that inhibition of the epidermal growth factor receptor (EGFR) promotes desmosome assembly and strengthens intercellular adhesion in squamous cell carcinoma cells [7]. Whether such cross-talk between EGFR and Dp occurs in our system is not known at this time. In summary, using an RNAi strategy, we have demonstrated that downregulation of Dp in HaCaTs resulted in alteration of expression levels of several desmosomal proteins. Increased cell proliferation and enhanced G0/G1 to Sphase transition in cell cycle progression, as determined by BrdU incorporation, were accompanied by elevated phosphoERK1/2 and phospho-Akt, indicating activation of MAPK and PI3K signaling pathways in cells treated with Dp RNAi. These findings demonstrate that the structural protein Dp may participate in the regulation of epithelial proliferation, and possibly differentiation, in keratinocytes.

Acknowledgments We thank David Garrod and Irene Leigh for providing 115F and keratin antibodies, Kathleen J. Green and Fiona Watt for their support during this fellowship and members of the FACS Laboratory, Cancer Research-UK for technical advice. Special thanks go to Hart laboratory members, in particular Richard Grose for critical reading of the manuscript. This work was funded by an MRC Career Development Fellowship to H. W.

REFERENCES

[1] S. Getsios, A.C. Huen, K.J. Green, Working out the strength and flexibility of desmosomes, Nat. Rev., Mol. Cell Biol. 5 (2004) 271–281. [2] D.R. Garrod, A.J. Merritt, Z. Nie, Desmosomal adhesion: structural basis, molecular mechanism and regulation (Review), Mol. Membr. Biol. 19 (2002) 81–94. [3] D.R. Garrod, A.J. Merritt, Z. Nie, Desmosomal cadherins, Curr. Opin. Cell Biol. 14 (2002) 537–545.

E XP E RI ME N TA L CE L L RE S E A RCH 3 1 3 ( 2 00 7 ) 2 3 3 6 –23 4 4

[4] M. Perez-Moreno, C. Jamora, E. Fuchs, Sticky business: orchestrating cellular signals at adherens junctions, Cell 112 (2003) 535–548. [5] E. Allen, Q.C. Yu, E. Fuchs, Mice expressing a mutant desmosomal cadherin exhibit abnormalities in desmosomes, proliferation, and epidermal differentiation, J. Cell Biol. 133 (1996) 1367–1382. [6] A.J. Merritt, M.Y. Berika, W. Zhai, S.E. Kirk, B. Ji, M.J. Hardman, D.R. Garrod, Suprabasal desmoglein 3 expression in the epidermis of transgenic mice results in hyperproliferation and abnormal differentiation, Mol. Cell. Biol. 22 (2002) 5846–5858. [7] J.H. Lorch, J. Klessner, J.K. Park, S. Getsios, Y.L. Wu, M.S. Stack, K.J. Green, Epidermal growth factor receptor inhibition promotes desmosome assembly and strengthens intercellular adhesion in squamous cell carcinoma cells, J. Biol. Chem. 279 (2004) 37191–37200. [8] A.P. South, H. Wan, M.G. Stone, P.J. Dopping-Hepenstal, P.E. Purkis, J.F. Marshall, I.M. Leigh, R.A. Eady, I.R. Hart, J.A. McGrath, Lack of plakophilin 1 increases keratinocyte migration and reduces desmosome stability, J. Cell Sci. 116 (2003) 3303–3314. [9] E.A. Bornslaeger, C.M. Corcoran, T.S. Stappenbeck, K.J. Green, Breaking the connection: displacement of the desmosomal plaque protein desmoplakin from cell–cell interfaces disrupts anchorage of intermediate filament bundles and alters intercellular junction assembly, J. Cell Biol. 134 (1996) 985–1001. [10] A.C. Huen, J.K. Park, L.M. Godsel, X. Chen, L.J. Bannon, E.V. Amargo, T.Y. Hudson, A.K. Mongiu, I.M. Leigh, D.P. Kelsell, B.M. Gumbiner, K.J. Green, Intermediate filament-membrane attachments function synergistically with actin-dependent contacts to regulate intercellular adhesive strength, J. Cell Biol. 159 (2002) 1005–1017. [11] L.M. Godsel, S.N. Hsieh, E.V. Amargo, A.E. Bass, L.T. Pascoe-McGillicuddy, A.C. Huen, M.E. Thorne, C.A. Gaudry, J.K. Park, K. Myung, R.D. Goldman, T.L. Chew, K.J. Green, Desmoplakin assembly dynamics in four dimensions: multiple phases differentially regulated by intermediate filaments and actin, J. Cell Biol. 171 (2005) 1045–1059. [12] B. Bauce, C. Basso, A. Rampazzo, G. Beffagna, L. Daliento, G. Frigo, S. Malacrida, L. Settimo, G. Danieli, G. Thiene, A. Nava, Clinical profile of four families with arrhythmogenic right ventricular cardiomyopathy caused by dominant desmoplakin mutations, Eur. Heart J. 26 (2005) 1666–1675. [13] M.F. Jonkman, A.M. Pasmooij, S.G. Pasmans, M.P. van den Berg, H.J. Ter Horst, A. Timmer, H.H. Pas, Loss of desmoplakin tail causes lethal acantholytic epidermolysis bullosa, Am. J. Hum. Genet. 77 (2005) 653–660. [14] G.I. Gallicano, P. Kouklis, C. Bauer, M. Yin, V. Vasioukhin, L. Degenstein, E. Fuchs, Desmoplakin is required early in development for assembly of desmosomes and cytoskeletal linkage, J. Cell Biol. 143 (1998) 2009–2022. [15] G.I. Gallicano, C. Bauer, E. Fuchs, Rescuing desmoplakin function in extra-embryonic ectoderm reveals the importance of this protein in embryonic heart, neuroepithelium, skin and vasculature, Development 128 (2001) 929–941. [16] V. Vasioukhin, E. Bowers, C. Bauer, L. Degenstein, E. Fuchs, Desmoplakin is essential in epidermal sheet formation, Nat. Cell Biol. 3 (2001) 1076–1085. [17] H. Wan, P.J. Dopping-Hepenstal, M.J. Gratian, M.G. Stone, G. Zhu, P.E. Purkis, A.P. South, F. Keane, D.K. Armstrong, R.S. Buxton, J.A. McGrath, R.A. Eady, Striate palmoplantar keratoderma arising from desmoplakin and desmoglein 1 mutations is associated with contrasting perturbations of desmosomes and the keratin filament network, Br. J. Dermatol. 150 (2004) 878–891. [18] H. Wan, P.J. Dopping-Hepenstal, M.J. Gratian, M.G. Stone, J.A.

[19]

[20]

[21]

[22]

[23] [24]

[25]

[26]

[27]

[28]

[29]

[30]

[31] [32]

[33]

[34]

[35]

2343

McGrath, R.A. Eady, Desmosomes exhibit site-specific features in human palm skin, Exp. Dermatol. 12 (2003) 378–388. H. Wan, M.G. Stone, C. Simpson, L.E. Reynolds, J.F. Marshall, I.R. Hart, K.M. Hodivala-Dilke, R.A. Eady, Desmosomal proteins, including desmoglein 3, serve as novel negative markers for epidermal stem cell-containing population of keratinocytes, J. Cell Sci. 116 (2003) 4239–4248. M.F. Denning, S.G. Guy, S.M. Ellerbroek, S.M. Norvell, A.P. Kowalczyk, K.J. Green, The expression of desmoglein isoforms in cultured human keratinocytes is regulated by calcium, serum, and protein kinase C, Exp. Cell Res. 239 (1998) 50–59. V.M. Schoop, N. Mirancea, N.E. Fusenig, Epidermal organization and differentiation of HaCaT keratinocytes in organotypic coculture with human dermal fibroblasts, J. Invest. Dermatol. 112 (1999) 343–353. P. Laprise, M.J. Langlois, M.J. Boucher, C. Jobin, N. Rivard, Down-regulation of MEK/ERK signaling by E-cadherin-dependent PI3K/Akt pathway in differentiating intestinal epithelial cells, J. Cell Physiol. 199 (2004) 32–39. M.W. Fear, S.J. Hatsell, I.M. Leigh, D.P. Kelsell, Whats new in genodermatoses? Keio J. Med. 50 (2001) 35–38. E.E. Norgett, S.J. Hatsell, L. Carvajal-Huerta, J.C. Cabezas, J. Common, P.E. Purkis, N. Whittock, I.M. Leigh, H.P. Stevens, D.P. Kelsell, Recessive mutation in desmoplakin disrupts desmoplakin-intermediate filament interactions and causes dilated cardiomyopathy, woolly hair and keratoderma, Hum. Mol. Genet. 9 (2000) 2761–2766. J.E. Lai Cheong, V. Wessagowit, J.A. McGrath, Molecular abnormalities of the desmosomal protein desmoplakin in human disease, Clin. Exp. Dermatol. 30 (2005) 261–266. C.D. Andl, J.R. Stanley, Central role of the plakoglobin-binding domain for desmoglein 3 incorporation into desmosomes, J. Invest. Dermatol. 117 (2001) 1068–1074. J.Y. Roh, J.R. Stanley, Plakoglobin binding by human Dsg3 (pemphigus vulgaris antigen) in keratinocytes requires the cadherin-like intracytoplasmic segment, J. Invest. Dermatol. 104 (1995) 720–724. A.P. Kowalczyk, H.L. Palka, H.H. Luu, L.A. Nilles, J.E. Anderson, M.J. Wheelock, K.J. Green, Posttranslational regulation of plakoglobin expression. Influence of the desmosomal cadherins on plakoglobin metabolic stability, J. Biol. Chem. 269 (1994) 31214–31223. S. Getsios, E.V. Amargo, R.L. Dusek, K. Ishii, L. Sheu, L.M. Godsel, K.J. Green, Coordinated expression of desmoglein 1 and desmocollin 1 regulates intercellular adhesion, Differentiation 72 (2004) 419–433. V. Vasioukhin, C. Bauer, M. Yin, E. Fuchs, Directed actin polymerization is the driving force for epithelial cell–cell adhesion, Cell 100 (2000) 209–219. T. Yin, K.J. Green, Regulation of desmosome assembly and adhesion, Semin. Cell Dev. Biol. 15 (2004) 665–677. L. Williamson, N.A. Raess, R. Caldelari, A. Zakher, A. de Bruin, H. Posthaus, R. Bolli, T. Hunziker, M.M. Suter, E.J. Muller, Pemphigus vulgaris identifies plakoglobin as key suppressor of c-Myc in the skin, EMBO J. 25 (2006) 3298–3309. S. Wallis, S. Lloyd, I. Wise, G. Ireland, T.P. Fleming, D. Garrod, The alpha isoform of protein kinase C is involved in signaling the response of desmosomes to wounding in cultured epithelial cells, Mol. Biol. Cell 11 (2000) 1077–1092. A.L. Krunic, D.R. Garrod, N.P. Smith, G.S. Orchard, O.B. Cvijetic, Differential expression of desmosomal glycoproteins in keratoacanthoma and squamous cell carcinoma of the skin: an immunohistochemical aid to diagnosis (published erratum appears in Acta Derm Venereol 1996 Nov;76(6):504), Acta Derm. -Venereol. 76 (1996) 394–398. A.L. Krunic, D.R. Garrod, S. Madani, M.D. Buchanan, R.E. Clark, Immunohistochemical staining for desmogleins 1 and 2 in

2344

[36]

[37]

[38]

[39]

E XP E RI ME N TA L CE LL RE S E A RCH 3 1 3 ( 2 00 7 ) 2 3 3 6 –23 4 4

keratinocytic neoplasms with squamous phenotype: actinic keratosis, keratoacanthoma and squamous cell carcinoma of the skin, Br. J. Cancer 77 (1998) 1275–1279. H. Kurzen, I. Munzing, W. Hartschuh, Expression of desmosomal proteins in squamous cell carcinomas of the skin, J. Cutan. Pathol. 30 (2003) 621–630. T. Yin, S. Getsios, R. Caldelari, A.P. Kowalczyk, E.J. Muller, J.C. Jones, K.J. Green, Plakoglobin suppresses keratinocyte motility through both cell–cell adhesion-dependent and -independent mechanisms, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 5420–5425. M. Chidgey, C. Brakebusch, E. Gustafsson, A. Cruchley, C. Hail, S. Kirk, A. Merritt, A. North, C. Tselepis, J. Hewitt, C. Byrne, R. Fassler, D. Garrod, Mice lacking desmocollin 1 show epidermal fragility accompanied by barrier defects and abnormal differentiation, J. Cell Biol. 155 (2001) 821–832. M.J. Hardman, K. Liu, A.A. Avilion, A. Merritt, K. Brennan, D.R. Garrod, C. Byrne, Desmosomal cadherin misexpression alters {beta}-Catenin stability and epidermal differentiation, Mol. Cell. Biol. 25 (2005) 969–978.

[40] L. Eshkind, Q. Tian, A. Schmidt, W.W. Franke, R. Windoffer, R.E. Leube, Loss of desmoglein 2 suggests essential functions for early embryonic development and proliferation of embryonal stem cells, Eur. J. Cell Biol. 81 (2002) 592–598. [41] C. Jamora, E. Fuchs, Intercellular adhesion, signalling and the cytoskeleton, Nat. Cell Biol. 4 (2002) E101–E108. [42] C. Kolly, M.M. Suter, E.J. Muller, Proliferation, cell cycle exit, and onset of terminal differentiation in cultured keratinocytes: pre-programmed pathways in control of C-Myc and Notch1 prevail over extracellular calcium signals, J. Invest. Dermatol. 124 (2005) 1014–1025. [43] S. Pece, M. Chiariello, C. Murga, J.S. Gutkind, Activation of the protein kinase Akt/PKB by the formation of E-cadherin-mediated cell–cell junctions. Evidence for the association of phosphatidylinositol 3-kinase with the E-cadherin adhesion complex, J. Biol. Chem. 274 (1999) 19347–19351. [44] S. Pece, J.S. Gutkind, Signaling from E-cadherins to the MAPK pathway by the recruitment and activation of epidermal growth factor receptors upon cell–cell contact formation, J. Biol. Chem. 275 (2000) 41227–41233.