- Email: [email protected]
Induction of inducible nitric oxide synthase gene expression by Pokeweed mitogen
Chemico-Biological Interactions 118 (1999) 113 – 125
Induction of inducible nitric oxide synthase gene expression by Pokeweed mitogen Young Jin Jeon a, Jung Sup Lee b, Hye Gwang Jeong b,* a
Department of Biological Sciences, Korea Ad6anced Institute of Science and Technology, Taejon, South Korea b Department of Biological Science, Chosun Uni6ersity, 375 Seosuk-dong, Kwangju, 501 -759, South Korea
Received 16 October 1998; received in revised form 28 December 1998; accepted 2 January 1999
Abstract The present study has characterized the expression of iNOS gene in Pokeweed mitogen (PWM)-driven murine macrophage RAW 264.7 cells. PWM significantly induced nitric oxide production in a dose-dependent manner. Quantitative reverse transcription-polymerase chain reaction analysis demonstrated that the inducible nitric oxide synthase gene expression is increased by PWM treatment. Since iNOS transcription has recently been shown to be under the control of the nuclear factor (NF)-kB/Rel family of transcription factors, the effects of PWM on NF-kB/Rel activation were examined using a transient transfection assay and an electrophoretic mobility shift assay (EMSA). Transient expression assays with NF-kB/Rel binding sites linked to the chloramphenicol acetyltransferase gene suggest that the PWM-induced increase in transcription is mediated by the NF-kB/Rel transcription factor complex. Using DNA fragments containing the NF-kB/Rel binding sequence, PWM was shown to activate the protein/DNA binding of NF-kB/Rel to its cognate site as measured by EMSA. Supershift EMSA showed the presence of p50 and c-Rel protein in the complex at the kB site. Western blot analysis of isolated nuclear fractions, using p65 and c-Rel-specific antibodies, provided further evidence that c-Rel is increased by PWM treatment. N-Tosyl-lphenylalanine chloromethyl ketone, a potent inhibitor of NF-kB/Rel activation, inhibited PWM-induced nitrite generation in a dose-dependent manner. Collectively, the results of
* Corresponding author. Fax: + 82-62-2306639. E-mail address: [email protected] (H.G. Jeong) 0009-2797/99/$ - see front matter © 1999 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 0 0 9 - 2 7 9 7 ( 9 9 ) 0 0 0 0 3 - 4
114
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
these experiments indicate that c-Rel is positively regulated by PWM to assist in the initiation of iNOS gene expression. © 1999 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Pokeweed mitogen; iNOS; NF-kB/Rel; Macrophage
1. Introduction Immunologically activated macrophages produce nitric oxide (NO), which mediates the bactericidal and tumoricidal activities of macrophages and, when produced in excess, is responsible for the damages associated with inflammation. NO is a short-lived bioactive molecule and has a wide biological role in physiological and pathophysiological processes, such as macrophage cytotoxicities, neurotransmissions, and neurotoxicities [1]. NO is synthesized from l-arginine by NO synthase (NOS) with NADPH and oxygen as cosubstrates. Two major classes of NOSs are known: constitutive and inducible [2]. The macrophage enzyme is produced only after activation of the macrophages and requires transcriptional activation of the iNOS gene [3]. Lipopolysaccharides (LPS) stimulate macrophages to release NO, various cytokines, and eicosanoid mediators of the immune response. The mechanism by which LPS stimulates these cells is well characterized. Stimulation of murine macrophages by LPS results in the expression of an iNOS. The promoter of the murine gene encoding iNOS contains two kB binding sites: one beginning at 55 bp and a second at 971 bp upstream of the TATA box [4]. The nuclear factor (NF)-kB/Rel family of transcription factors is a pleiotropic regulator of many genes involved in immune and inflammatory responses, including the iNOS [2]. In mammals, this family contains the proteins p50, p52, p65 (RelA), RelB and c-Rel [2,5]. NF-kB/Rel exists in the cytoplasm of unstimulated cells in a quiescent form bound to its inhibitor, IkB. Macrophage activation by certain external stimuli results in the phosphorylation of IkB by several kinases and its proteolytic degradation, thus releasing the active DNA-binding forms of NF-kB/Rel to translocate to the nucleus where they bind to the kB motifs in the regulatory regions of a variety of genes [2,5]. Pokeweed mitogen (PWM) is a mitogenic lectin obtained from the roots, leaves and berries of the pokeweed, Phytolacca americana. PWM is widely used as an inducer of polyclonal immunoglobulin production. One of the major effects of PWM stimulation is increased production of cytokines, such as interleukin (IL)-2, IL-6, granulocyte macrophage-colony-stimulating factor (GM-CSF), interferon (IFN)-g, TNF-a, and others, through transcriptional and post-transcriptional mechanisms [6 – 8]. The signal transduction mechanisms that are responsible for these PWM effects remain largely unknown and little attention has been paid to the effects of this lectin on the expression of iNOS. A large number of immunostimulants have been reported to depress cytochrome P450 and its related drug biotransformations (for a review see Ref. [9]). Depression of cytochrome P450 causes profound changes in the capacity of the liver to
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
115
metabolize drugs, ultimately resulting in a decreased clearance of drugs. To date, the major identified mediators of suppression of cytochrome P450 caused by immunostimulants appear to be interferons and several cytokines such as IL-1, IL-6 and TNFa [9 – 13]. Recently, NO was suggested as a final mediator of the down-regulation of cytochrome P450 such as 1A1/2, 2B1/2, 2C11 and 3A2 [14– 16]. It has been proposed that the inhibitory effects of NO arise from its binding to P450 heme, leading to inactivation of the enzyme. It was previously demonstrated that the suppressive effects of B- and T-lymphocyte mitogens on the activities of several isozymes of mouse hepatic P450s may be different and that B cell mitogens such as LPS and PWM selectively depress the expression of cytochrome P450 [17]. In this study, the effects of PWM on NO production by macrophages and the involvement of NF-kB/Rel as signals in PWM-induced macrophage activation were examined to elucidate the relation of NO in PWM-induced down-regulation of cytochrome P450. The data suggest that PWM activates early events of NOS induction, and that the activation may occur via an increase of in the binding of the transcription factor NF-kB/Rel to the iNOS promoter, thereby increasing the induction of iNOS transcription. It is also demonstrated that the c-Rel is involved in PWM-induced iNOS gene expression. 2. Materials and methods
2.1. Reagents PWM was purchased from Gibco BRL (Grand Island, NY). LPS and N-tosyll-phenylalanine chloromethyl ketone (TPCK) were purchased from Sigma (St. Louis, MO). Polymerase chain reaction (PCR) reagents were purchased from Promega (Madison, WI). Reagents used for cell culture were purchased from Gibco BRL. The p50, p65, and c-Rel-specific antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).
2.2. Cell culture RAW 264.7 cells (ATCC TIB71) were grown in RPMI 1640 supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 100 U/ml penicillin and 100 ml/ml streptomycin. RAW 264.7 cells were plated at 5×105 cells/ml.
2.3. Nitrite measurement NO2 accumulation was used as an indicator of NO production in the medium as previously described [18]. RAW 264.7 cells were plated at 5× 105 cells/ml in 24-well culture plates, stimulated with LPS or PWM for 24 h. The isolated supernatants were mixed with an equal volume of Griess reagent (1% (w/v) sulfanilamide, 0.1% (w/v) naphthylethylene diamine dihydrochloride, 2% (v/v) phosphoric acid) and incubated at room temperature for 10 min. Using NaNO2
116
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
to generate a standard curve, nitrite production was measured by an O.D. reading at 550 nm.
2.4. Preparation of internal standard for re6erse transcription-PCR An artificial/recombinant mRNA (rcRNA) was used as an internal standard (IS) containing specific PCR primer sequences for iNOS that were added to RNA samples in a dilution series. A rat b-globin sequence was used as the spacer gene for iNOS IS. This method, developed by Vanden Heuvel, avoids sample-to-sample variation of reference gene expression (e.g. b-actin) as well as gene-to-gene differences in amplification efficiency [19]. The primer sequences from 5% to 3% for iNOS are forward primer GGATAGGCAGAGATTGGAGG, and reverse primer AATGAGGATGCAAGGCTGG. The iNOS IS primer design from 5% to 3% is as follows: IS forward primer, T7 promoter (TAATACGACTCACTATAGG); iNOS forward primer (as stated); and rat b-globin forward primer (AAGCCTGGATACCAACCTGCC); and the IS reverse primer design, poly d(T)18, iNOS reverse primer (as stated); and rat b-globin reverse primer (AACCTGGATACCAACCTGCC). The PCR reaction condition for generating the iNOS IS was performed as stated previously using 100 ng of rat genomic DNA [19]. PCR-amplified products were purified and transcribed into RNA. The rcRNA was subsequently treated with RNase-free DNase to remove the DNA template. After quantitation, the IS concentration was calculated; 330×bp is an approximation for the molecular weight of the IS, and the concentration is expressed as molecules of IS/ml.
2.5. Quantitati6e re6erse transcription-PCR RNA was isolated using Tri Reagent (Molecular Research Center, Cincinnati, OH) as described by Chomczynski and Mackey [20]. Competitive reverse transcription (RT)-PCR was performed as previously described [21]. Briefly, total RNA (100 ng) and IS rcRNA of a known amount were reverse transcribed into cDNA using oligo(dT)15 as a primer. Eight aliquots of RNA were taken from each treatment group, and an aliquot of IS rcRNA ranging from 103 to 1011 molecules was added to the appropriate treatment group RNA aliquot. PCR products were electrophoresed in 3% NuSieve 3:1 gels (FMC Bioproducts, Rockland, ME) and visualized by ethidium bromide staining. The iNOS primers produce a 379 bp amplified product from the RNA and a 301 bp product from the IS rcRNA. Quantitation was performed using the Gel Doc 1000 (Bio Rad, Hercules, CA), with which the amount of target mRNA present is determined as described by Gilliland et al. [22]. After performing the 103 –1011 range-finding experiment, a second set of much narrower internal standard dilutions (iNOS 106 –1010 molecules/tube) were examined in order to more accurately quantitate RNA message levels.
2.6. Vector construction For vector construction and electrophoretic mobility shift assay (EMSA), the
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
117
Rel/NF-kB-specific oligonucleotide (5%-gatctCAGAGGGGACTTTCCGAGAG-a3%), containing the NF-kB/Rel site of the Ig light chain gene enhancer (capital letters, nt 3937 to 3958) [23] and BglII restriction sites (small letters), was synthesized in Korea Biotech. Three copies of NF-kB/Rel consensus sequence were inserted into the pCAT-promoter vector (Promega) upstream of the chloramphenicol acetyltransferase (CAT) gene to construct pCAT(kB)3.
2.7. Transient transfection of RAW 264.7 cells and CAT assays RAW 264.7 cells were transfected using DEAE-dextran, diluted to 5×106 cells per 10 ml of complete media, plated on 100 mm plates, and incubated in the presence of 5% CO2 at 37oC for 24 h. The transfectants were treated with LPS or PWM. Eighteen hours later, the cells were washed with ice-cold PBS, resuspended in 0.25 mM Tris (pH 7.8), and subjected to three cycles of freezing and thawing. The lysates were centrifuged (12 000× g for 10 min at 4oC), and the supernatant was assayed for CAT activity by the thin layer chromatography method [24].
2.8. Electrophoretic mobility shift assay Nuclear extracts were prepared as previously described [25]. Treated and untreated RAW 264.7 cells were lysed with hypotonic buffer (10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulphonic acid (Hepes), 1.5 mM MgCl2, pH 7.5) and the nuclei were pelleted by centrifugation at 3000× g for 5 min. Nuclear lysis was performed using a hypertonic buffer (30 mM Hepes, 1.5 mM MgCl2, 450 mM KCl, 0.3 mM EDTA, and 10% glycerol), which contained 1 mM dithiothreitol; 1 mM phenylmethylsulfonyl fluoride; and 1 mg/ml each of aprotinin and leupeptin. Following lysis, the samples were centrifuged at 14 500× g for 15 min, and the supernatant was retained for use in the DNA binding assay. Two double-stranded deoxyoligonucleotides containing the NF-kB/Rel binding site (5%GGGGACTTTCC-3%) [22] were end-labeled with [g-32P]dATP. Nuclear extracts (5 mg) were incubated with 2 mg of poly(dI–dC) and the [32P]-labeled DNA probe in binding buffer (100 mM NaCl, 30 mM Hepes, 1.5 mM MgCl2, 0.3 mM EDTA, 10% glycerol, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 1 mg/ml concentration each of aprotinin and leupeptin) for 10 min on ice. DNA binding activity was separated from the free probe using a 4.8% polyacrylamide gel in 0.5× TBE buffer (44.5 mM Tris, 44.5 mM boric acid, and 1 mM EDTA). Following electrophoresis, the gel was dried and subjected to autoradiography.
2.9. Western blot analysis Nuclear extracts were prepared as described for EMSA. Cytoplasmic fractions were prepared as the post-nuclear fractions of cellular extracts concurrently with nuclear extract preparation. Extract proteins (20 mg) were separated by 10% sodium dodecy sulphate – polyacrylamide gel electrophoresis (SDS–PAGE), then electrob-
118
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
lotted to nitrocellulose membranes (Amersham International, Buckinghamshire, UK). Membranes were preincubated for 1 h at room temperature in Tris-buffered saline (TBS), pH 7.6, containing 0.05% Tween-20 and 5% nonfat dry milk. Immunostaining of membranes was performed with antisera specific for either p65 or c-Rel. Immunoreactive bands were then detected by incubation with conjugates of anti-rabbit immunoglobulin (Ig)G with alkaline phosphatase.
2.10. Statistical analysis of data The mean 9 S.D. was determined for each treatment group in a given experiment. When significant differences occurred, treatment groups were compared to the vehicle controls using a Dunnett’s two-tailed t-test.
3. Results and discussion In this study, the effects of PWM on NO production were examined and the involvement of NF-kB/Rel as signals in PWM-induced macrophage activation in murine macrophage cell line RAW 264.7 was also investigated. The effect of PWM on nitrite production was measured in order to monitor the NO production in the medium. Basal levels of nitrite in unstimulated RAW 264.7 cells were less than 2 nmol/ml (mean9S.D., n = 4); however, upon LPS stimulation, used as a control for 24 h, nitrite production was increased 14-fold over the basal levels as shown in Fig. 1A. PWM treatment for 24 h greatly increased the synthesis of NO in a dose-dependent manner. Consistent with these finding, iNOS mRNA was not detectable in unstimulated RAW 264.7 cells. Conversely, RNA isolated from cells treated for 6 h with PWM showed the active transcription of the iNOS gene as demonstrated by quantitative RT-PCR (Table 1). These results are similar to the induction caused by LPS [26]. These results suggest that PWM causes transcriptional activation of the iNOS gene in the macrophage cell line RAW 264.7. It has been reported that protein binding at the kB binding site is necessary to confer inducibility by LPS of iNOS [27,28]. To further investigate the role of NF-kB/Rel on iNOS gene expression, the effect of PWM on NF-kB/Rel was assessed using a transient transfection assay (Fig. 1B). When cells were transiently transfected with a plasmid containing three copies of the NF-kB/Rel binding sites and the CAT gene, PWM (1 mg/ml) induced a 5.1-fold increase in CAT activity. To further investigate the putative mechanism by which PWM activates iNOS, the effects of PWM on the activation of a family of transcription factors was monitored by gel shift assays during PWM activation of the cells. NF-kB/Rel family member binding activity was examined in the light of their critical role in the regulation of iNOS. EMSA demonstrated that PWM treatment of the cells induced a marked increase in NF-kB/Rel binding to its conserved site, which could be visualized as two distinct bands (Fig. 1C). This banding pattern was similar to that previously described by Xie et al. [28]. Kinetic studies showed strong induction by PWM of two separate kB binding complexes at 30 min that was even more enhanced after
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
119
60 min (Fig. 2A). The magnitude of the activation, however, appeared greater for the protein complex represented by the upper of the two bands. This finding would suggest that PWM may activate the formation of either p50/c-rel or p50/p65 heterodimers based on previous studies by Xie et al. [25], in which they identified these NF-kB/Rel proteins as being responsible for this upper band. The identification of the binding complex was investigated using a gel supershift assay. Both upper and lower bands were supershifted dramatically when the nuclear
Fig. 1. Activation of Rel/ NF-kB PWM in RAW 264.7 cells. (A) RAW 264.7 cells at 5 ×105 cells/ml were incubated with LPS (1 mg/ml) or PWM (0.2, 0.5, and 1 mg/ml) for 24 h. The supernatants were subsequently isolated and analyzed for nitrite. Each bar shows the mean 9S.D. of triplicate determinations. An asterisk denotes a response that is significantly different from the control group as determined by Dunnett’s two-tailed t-test at PB 0.05. (B) RAW 264.7 cells were transfected with pCAT(kB)3 by the DEAE-dextran method. Twenty-four hours after transfection, cells were treated with LPS or PWM (mg/ml) for 18 h. Cell extracts were then prepared and subjected to CAT assay. (C) RAW 264.7 cells were treated with LPS or PWM for 1 h. Nuclear extracts were then prepared and subjected to EMSA. NF-kB/Rel binding is identified by arrows. Cold; 100-fold molar excess of nonlabeled NF-kB probe. Results are representative of three separate experiments.
120
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
Fig. 1. (Continued)
extract was preincubated with antibody against p50. The upper band was supershifted with antibody against c-Rel and p50. However, no supershift was observed with antibody against p65 (Fig. 2B). Thus, the upper band appears to be composed of a p50/c-Rel heterodimer rather than a p50/p65 heterodimer, while the lower band appears to consist of the p50 homodimer. Western immunoblot analysis of the Table 1 The activation of iNOS gene expression by PWM in RAW 264.7 cellsa Treatment
iNOS mRNA (molecules×107/100 ng RNA)
NA LPS (1 mg/ml) PWM (0.2 mg/ml) PWM (0.5 mg/ml) PWM (1 mg/ml)
N.D.b 12.32 90.22 4.65 9 0.64 6.41 91.03 10.14 91.59
a RAW 264.7 cells were treated with LPS or PWM for 6 h. Total RNA was isolated and the number of molecules of iNOS mRNA were quantitated as outlined in Section 2. Results are expressed as the mean9 S.D. derived from three separate experiments in triplicate. b N.D., not detectable.
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
121
Fig. 2. Identification of kB binding proteins in the nuclei of RAW 264.7 cells treated with PWM. (A) Nuclear extracts from PWM (1 mg/ml)-stimulated RAW 264.7 cells were incubated with [32P]-labeled NF-kB probe. Cold; 100-fold molar excess of nonlabeled NF-kB probe. (B) RAW 264.7 cells were treated with PWM (1 mg/ml) for 30 min. Nuclear extracts were incubated in the presence or absence of anti-p50, p65 (Rel A), or c-Rel, followed by a binding reaction with the probe. Reaction products were electrophoresed, and the gels were dried and autoradiographed.
122
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
Fig. 3. Western blot analysis of p65 and c-Rel in the nucleus and cytoplasm of PWM-stimulated RAW 264.7 cells. RAW 264.7 cells were treated with PWM (1 mg/ml) for 30 min. Extract proteins (20 mg) were separated by SDS–PAGE, then electroblotted to nitrocellulose membranes. Immunostaining of the membranes was performed with antisera specific for either p65 or c-Rel. Immunoreactive bands were then detected by incubation with conjugates of anti-rabbit IgG with alkaline phosphatase. Results are representative of three separate experiments.
cytosolic and nuclear fractions provides further evidence that c-Rel but not p65 is activated and translocated to the nucleus. As shown in Fig. 3, p65 and c-Rel were detectable in the cytoplasmic extracts. Stimulation of cells with PWM induced the activation of c-Rel and its translocate to the nucleus, whereas p65 was sequestered in the cytoplasm. Collectively, this series of experiments indicate that c-Rel is positively regulated by PWM to help initiate iNOS gene expression. To confirm the involvement of NF-kB/Rel in the induction of iNOS gene expression by PWM-stimulated cells, TPCK, a serine proteinase inhibitor, was employed since it was reported to inhibit the activation of NF-kB/Rel by stabilizing the inhibitory subunit, IkBa [29]. Concomitant treatment of the cells with TPCK and PWM significantly inhibited NF-kB/Rel binding activity as shown in Fig. 4A. Under identical conditions (i.e. coincubation with TPCK), PWM-activated cells exhibited a dose-dependent inhibition in nitrite production, confirming the involvement of Rel/NF-kB in PWM-induced nitrite production (Fig. 4B). At a concentration of 100 mM, TPCK completely inhibited NO production. Collectively, this series of experiments indicates that NF-kB/Rel is positively activated by PWM to initiate iNOS gene expression. PWM is known to activate macrophages, in which PWM can induce IL-I, IL-6, TNF-a and GM-CSF gene expression [6–8,30,31]. The activation of NF-kB/Rel is triggered by different stimuli, e.g. LPS, viruses, the inflammatory cytokines TNFa and IL-1 [2]. The activated NF-kB/Rel initiates the transcription of several genes, including iNOS, IL-2, IL-6, TNFa, macrophage-CSF (M-CSF), and GM-CSF [2]. Recently, it was revealed that PWM initiates upstream events including phosphorylation and activation of cytoplasmic Raf-1 and MAP kinases [7]. The activation of MAP kinase in turn activates the c-Rel pathway [32]. In addition, the activation of Raf-1 and MAP kinase in murine macrophages partially also mimics LPS-induced signaling events, such as NF-kB/Rel activation [33]. Therefore, the step in the signal transduction pathway of NF-kB/Rel activation by PWM may be at the phosphorylation step of NF-kB/Rel. However, this speculation not to exclude the possibility
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
123
Fig. 4. Inhibition of NF-kB/Rel binding and nitrite production by TPCK in PWM-stimulated RAW 264.7 cells. (A) RAW 264.7 cells were treated with TPCK (50 mM) in the presence or absence of PWM (1 mg/ml) for 30 min. Nuclear extracts were then prepared and subjected to EMSA. NF-kB/Rel binding is identified by arrows. (B) RAW 264.7 cells were treated with TPCK (5, 20, 50, and 100 mM) in the presence of PWM (1 mg /ml) for 24 h. The supernatants were subsequently isolated and analyzed for nitrite. Each bar represents the mean 9 S.D. for triplicate determinations. An asterisk denotes a significant difference from the control group as determined by Dunnett’s two-tailed t-test at PB 0.05. Results are representative of three separate experiments.
124
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
that PWM-induced cytokines, such as TNFa and IL-1, may amplify the NF-kB/Rel activation. In conclusion, these experiments demonstrate that PWM increases the binding of the essential transcription factor NF-kB/Rel to the iNOS promoter, which in turn leads to increased transcription of the iNOS gene in the murine macrophage cell line RAW 264.7.
Acknowledgements This work was supported by KOSEF grant 961-0505-044-2 and Research Funds from Chosun University.
References [1] S. Moncada, R.M.J. Palmer, D.A. Higgs, Nitric oxide: physiology, pathophysiology, and pharmacology, Pharmacol. Rev. 43 (1991) 109 – 142. [2] P.A. Baeuerle, T. Henkel, Function and activation of NF-kappa B in the immune system, Annu. Rev. Immunol. 12 (1994) 141–179. [3] Q.-W. Xie, H.J. Cho, J. Calaycay, R.A. Mumford, K.M. Swiderek, T.D. Lee, A. Ding, T. Troso, C. Nathan, Cloning and characterization of inducible nitric oxide synthase from mouse macrophages, Science 256 (1992) 225 – 228. [4] C.J. Lowenstein, E.W. Alley, P. Raval, A.M. Snowman, S.H. Snyder, S.W. Russell, W.J. Murphy, Macrophage nitric oxide synthase gene: two upstream regions mediate induction by interferon gamma and lipopolysaccharide, Proc. Natl. Acad. Sci. U.S.A. 90 (1990) 9730 – 9734. [5] A.S. Baldwin Jr., The NF-kappa B and I kappa B proteins: new discoveries and insights, Annu. Rev. Immunol. 14 (1996) 649–683. [6] J.M. Ferrer, A. Plaza, M. Kreisler, F. Diaz-Espada, Differential interleukin secretion by in vitro activated human CD45RA and CD45RO CD4 +T cell subsets, Immunology 14 (1992) 10 – 20. [7] D. Chauhan, S.M. Kharbanda, E. Rubin, B.A. Barut, A. Mohrbacher, D.W. Kufe, K.C. Anderson, Regulation of c-jun gene expression in human T lymphocytes, Blood 81 (1993) 1540 – 1548. [8] G. Wallays, J.L. Ceuppens, Human T lymphocyte activation by pokeweed mitogen induces production of TNF-alpha and GM-CSF and helper signaling by IL-1 and IL-6 results in IL-2-dependent T cell growth, Eur. Cytokine Netw. 4 (1993) 269 – 277. [9] E.T. Morgan, Regulation of cytochromes P450 during inflammation and infection, Drug Metab. Rev. 29 (1997) 1129–1188. [10] J.F. Williams, Cytochrome P450 isoforms: Regulation during infection, inflammation and by cytokines, J. Fl. Med.Assoc. 78 (1991) 517 – 519. [11] C.W. Barker, J.B. Fagan, D.S. Pasco, Interleukin-1 suppresses the induction of P4501A1 and P4501A2 mRNAs in isolated hepatocytes, J. Biol. Chem. 267 (1992) 8050 – 8055. [12] Y.L. Chen, I. Florentin, A.M. Batt, L. Ferrari, J.P. Giroud, L. Chauvelot-Moachon, Effects of interleukin-6 on cytochrome P450-dependent mixed-function oxidases in the rat, Biochem. Pharmacol. 44 (1992) 137–148. [13] H.G. Jeong, T.C. Jeong, K.H. Yang, Mouse interferon gamma pretreated hepatocytes conditioned media suppress cytochrome P-450 induction by TCDD in mouse hepatoma cells, Biochem. Mol. Biol. Int. 29 (1993) 197–202. [14] O.G. Khatsenko, S.S. Gross, A.R. Rifkind, J.R. Vane, Nitric oxide is a mediator of the decrease in cytochrome P450-dependent metabolism caused by immunostimulants, Proc. Natl. Acad. Sci. U.S.A. 90 (1993) 11147–11151.
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
125
[15] T.J. Carlson, R.E. Billings, Role of nitric oxide in the cytokine-mediated regulation of cytochrome P450, Mol. Pharmacol. 49 (1996) 796 – 801. [16] O.G. Khatsenko, A.R. Boobis, S.S. Gross, Evidence for nitric oxide participation in down-regulation of CYP2B1/2 gene expression at the pretranslational level, Toxicol. Lett. 90 (1997) 207 – 216. [17] H.G. Jeong, Differential effects of B and T lymphocyte mitogens on cytochrome P450 in mice, Toxicol. Lett. 104 (1999) 57–64. [18] L.C. Green, D.A. Wagner, J. Glogowski, P.L. Skipper, J.S. Wishnok, J.S. Tannenbaum, Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids, Anal. Biochem. 126 (1982) 131 – 138. [19] J. Vanden Heuvel, F. Tyson, D. Bell, Construction of recombinant RNA templates for use as internal standards in quantitative RT-PCR, Biotechniques 14 (1993) 395 – 398. [20] P. Chomczynski, K. Mackey, Substitution of chloroform by bromo-chloropropane in the single-step method of RNA isolation, Anal. Biochem. 225 (1995) 163 – 164. [21] Y.J. Jeon, K.H. Yang, J.T. Pulaski, N.E. Kaminski, Attenuation of inducible nitric oxide synthase gene expression by delta 9-tetrahydrocannabinol is mediated through the inhibition of nuclear factor- kappa B/Rel activation, Mol. Pharmacol. 50 (1996) 334 – 341. [22] G. Gilliland, K. Perrin, K. Blanchard, H. Bunn, Analysis of cytokine mRNA and DNA: detection and quantitation by competitive polymerase chain reaction, Proc. Natl. Acad. Sci. U.S.A. 87 (1990) 2725–2729. [23] J.W. Pierce, M. Lenardo, D. Baltimore, Oligonucleotide that binds nuclear factor NF-kappa B acts as a lymphoid-specific and inducible enhancer element, Proc. Natl. Acad. Sci. U.S.A. 85 (1988) 1482–1486. [24] C.M. Gorman, L.F. Moffat, B.H. Howard, Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells, Mol. Cell. Biol. 2 (1982) 1044 – 1051. [25] H. Xie, T.C. Chiles, T.L. Rothstein, Induction of CREB activity via the surface Ig receptor of B cells, J. Immunol. 151 (1993) 880–889. [26] R.B. Lorsbach, W.J. Murphy, C.J. Lowenstein, S.H. Snyder, S.W. Russell, Expression of the nitric oxide synthase gene in mouse macrophages activated for tumor cell killing. Molecular basis for the synergy between interferon-gamma and lipopolysaccharide, J. Biol. Chem. 268 (1993) 1908 – 1913. [27] J.M. Muller, H.W. Loms Ziegler-Heitbrock, P.A. Baeuerle, Nuclear factor kappa B, a mediator of lipopolysaccharide effects, Immunobiology 187 (1993) 233 – 256. [28] Q.-W. Xie, Y. Kashiwabara, C. Nathan, Role of transcription factor NF-kappa B/Rel in induction of nitric oxide synthase, J. Biol. Chem. 269 (1994) 4705 – 4708. [29] J.-Y. Jeong, K.-U. Kim, D.-M. Jue, Tosylphenylalanine chloromethyl ketone inhibitors TNF-a mRNA synthesis in the presence of activated NF-kB in RAW 264.7 macrophages, Immunology 92 (1997) 267–273. [30] D.S. Temeles, H.E. McGrath, E.L. Kittler, R.K. Shadduck, V.K. Kister, R.B. Crittenden, B.L. Turner, P.J. Quesenberry, Cytokine expression from bone marrow derived macrophages, Exp. Hematol. 21 (1993) 388–393. [31] D. Reinhold, U. Bank, F. Buhling, U. Lendecked, A.J. Ulmer, H.D. Flad, S. Ansorge, Transforming growth factor-beta 1 (TGF-beta 1) inhibits DNA synthesis of PWM-stimulated PBMC via suppression of IL-2 and IL-6 production, Cytokine 6 (1994) 382 – 388. [32] C.F. Meyer, X. Wang, C. Chang, D. Templeton, T.H. Tan, Interaction between c-Rel and the mitogen-activated protein kinase kinase kinase 1 signaling cascade in mediating kappaB enhancer activation, J. Biol. Chem. 271 (1996) 8971 – 8976. [33] J.H. Park, L. Levitt, Overexpression of mitogen-activated protein kinase (ERK1) enhances T-cell cytokine gene expression: role of AP1, NF-AT, and NF-KB, Blood 82 (1993) 2470 – 2477.
.
Induction of inducible nitric oxide synthase gene expression by Pokeweed mitogen Young Jin Jeon a, Jung Sup Lee b, Hye Gwang Jeong b,* a
Department of Biological Sciences, Korea Ad6anced Institute of Science and Technology, Taejon, South Korea b Department of Biological Science, Chosun Uni6ersity, 375 Seosuk-dong, Kwangju, 501 -759, South Korea
Received 16 October 1998; received in revised form 28 December 1998; accepted 2 January 1999
Abstract The present study has characterized the expression of iNOS gene in Pokeweed mitogen (PWM)-driven murine macrophage RAW 264.7 cells. PWM significantly induced nitric oxide production in a dose-dependent manner. Quantitative reverse transcription-polymerase chain reaction analysis demonstrated that the inducible nitric oxide synthase gene expression is increased by PWM treatment. Since iNOS transcription has recently been shown to be under the control of the nuclear factor (NF)-kB/Rel family of transcription factors, the effects of PWM on NF-kB/Rel activation were examined using a transient transfection assay and an electrophoretic mobility shift assay (EMSA). Transient expression assays with NF-kB/Rel binding sites linked to the chloramphenicol acetyltransferase gene suggest that the PWM-induced increase in transcription is mediated by the NF-kB/Rel transcription factor complex. Using DNA fragments containing the NF-kB/Rel binding sequence, PWM was shown to activate the protein/DNA binding of NF-kB/Rel to its cognate site as measured by EMSA. Supershift EMSA showed the presence of p50 and c-Rel protein in the complex at the kB site. Western blot analysis of isolated nuclear fractions, using p65 and c-Rel-specific antibodies, provided further evidence that c-Rel is increased by PWM treatment. N-Tosyl-lphenylalanine chloromethyl ketone, a potent inhibitor of NF-kB/Rel activation, inhibited PWM-induced nitrite generation in a dose-dependent manner. Collectively, the results of
* Corresponding author. Fax: + 82-62-2306639. E-mail address: [email protected] (H.G. Jeong) 0009-2797/99/$ - see front matter © 1999 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 0 0 9 - 2 7 9 7 ( 9 9 ) 0 0 0 0 3 - 4
114
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
these experiments indicate that c-Rel is positively regulated by PWM to assist in the initiation of iNOS gene expression. © 1999 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Pokeweed mitogen; iNOS; NF-kB/Rel; Macrophage
1. Introduction Immunologically activated macrophages produce nitric oxide (NO), which mediates the bactericidal and tumoricidal activities of macrophages and, when produced in excess, is responsible for the damages associated with inflammation. NO is a short-lived bioactive molecule and has a wide biological role in physiological and pathophysiological processes, such as macrophage cytotoxicities, neurotransmissions, and neurotoxicities [1]. NO is synthesized from l-arginine by NO synthase (NOS) with NADPH and oxygen as cosubstrates. Two major classes of NOSs are known: constitutive and inducible [2]. The macrophage enzyme is produced only after activation of the macrophages and requires transcriptional activation of the iNOS gene [3]. Lipopolysaccharides (LPS) stimulate macrophages to release NO, various cytokines, and eicosanoid mediators of the immune response. The mechanism by which LPS stimulates these cells is well characterized. Stimulation of murine macrophages by LPS results in the expression of an iNOS. The promoter of the murine gene encoding iNOS contains two kB binding sites: one beginning at 55 bp and a second at 971 bp upstream of the TATA box [4]. The nuclear factor (NF)-kB/Rel family of transcription factors is a pleiotropic regulator of many genes involved in immune and inflammatory responses, including the iNOS [2]. In mammals, this family contains the proteins p50, p52, p65 (RelA), RelB and c-Rel [2,5]. NF-kB/Rel exists in the cytoplasm of unstimulated cells in a quiescent form bound to its inhibitor, IkB. Macrophage activation by certain external stimuli results in the phosphorylation of IkB by several kinases and its proteolytic degradation, thus releasing the active DNA-binding forms of NF-kB/Rel to translocate to the nucleus where they bind to the kB motifs in the regulatory regions of a variety of genes [2,5]. Pokeweed mitogen (PWM) is a mitogenic lectin obtained from the roots, leaves and berries of the pokeweed, Phytolacca americana. PWM is widely used as an inducer of polyclonal immunoglobulin production. One of the major effects of PWM stimulation is increased production of cytokines, such as interleukin (IL)-2, IL-6, granulocyte macrophage-colony-stimulating factor (GM-CSF), interferon (IFN)-g, TNF-a, and others, through transcriptional and post-transcriptional mechanisms [6 – 8]. The signal transduction mechanisms that are responsible for these PWM effects remain largely unknown and little attention has been paid to the effects of this lectin on the expression of iNOS. A large number of immunostimulants have been reported to depress cytochrome P450 and its related drug biotransformations (for a review see Ref. [9]). Depression of cytochrome P450 causes profound changes in the capacity of the liver to
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
115
metabolize drugs, ultimately resulting in a decreased clearance of drugs. To date, the major identified mediators of suppression of cytochrome P450 caused by immunostimulants appear to be interferons and several cytokines such as IL-1, IL-6 and TNFa [9 – 13]. Recently, NO was suggested as a final mediator of the down-regulation of cytochrome P450 such as 1A1/2, 2B1/2, 2C11 and 3A2 [14– 16]. It has been proposed that the inhibitory effects of NO arise from its binding to P450 heme, leading to inactivation of the enzyme. It was previously demonstrated that the suppressive effects of B- and T-lymphocyte mitogens on the activities of several isozymes of mouse hepatic P450s may be different and that B cell mitogens such as LPS and PWM selectively depress the expression of cytochrome P450 [17]. In this study, the effects of PWM on NO production by macrophages and the involvement of NF-kB/Rel as signals in PWM-induced macrophage activation were examined to elucidate the relation of NO in PWM-induced down-regulation of cytochrome P450. The data suggest that PWM activates early events of NOS induction, and that the activation may occur via an increase of in the binding of the transcription factor NF-kB/Rel to the iNOS promoter, thereby increasing the induction of iNOS transcription. It is also demonstrated that the c-Rel is involved in PWM-induced iNOS gene expression. 2. Materials and methods
2.1. Reagents PWM was purchased from Gibco BRL (Grand Island, NY). LPS and N-tosyll-phenylalanine chloromethyl ketone (TPCK) were purchased from Sigma (St. Louis, MO). Polymerase chain reaction (PCR) reagents were purchased from Promega (Madison, WI). Reagents used for cell culture were purchased from Gibco BRL. The p50, p65, and c-Rel-specific antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).
2.2. Cell culture RAW 264.7 cells (ATCC TIB71) were grown in RPMI 1640 supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 100 U/ml penicillin and 100 ml/ml streptomycin. RAW 264.7 cells were plated at 5×105 cells/ml.
2.3. Nitrite measurement NO2 accumulation was used as an indicator of NO production in the medium as previously described [18]. RAW 264.7 cells were plated at 5× 105 cells/ml in 24-well culture plates, stimulated with LPS or PWM for 24 h. The isolated supernatants were mixed with an equal volume of Griess reagent (1% (w/v) sulfanilamide, 0.1% (w/v) naphthylethylene diamine dihydrochloride, 2% (v/v) phosphoric acid) and incubated at room temperature for 10 min. Using NaNO2
116
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
to generate a standard curve, nitrite production was measured by an O.D. reading at 550 nm.
2.4. Preparation of internal standard for re6erse transcription-PCR An artificial/recombinant mRNA (rcRNA) was used as an internal standard (IS) containing specific PCR primer sequences for iNOS that were added to RNA samples in a dilution series. A rat b-globin sequence was used as the spacer gene for iNOS IS. This method, developed by Vanden Heuvel, avoids sample-to-sample variation of reference gene expression (e.g. b-actin) as well as gene-to-gene differences in amplification efficiency [19]. The primer sequences from 5% to 3% for iNOS are forward primer GGATAGGCAGAGATTGGAGG, and reverse primer AATGAGGATGCAAGGCTGG. The iNOS IS primer design from 5% to 3% is as follows: IS forward primer, T7 promoter (TAATACGACTCACTATAGG); iNOS forward primer (as stated); and rat b-globin forward primer (AAGCCTGGATACCAACCTGCC); and the IS reverse primer design, poly d(T)18, iNOS reverse primer (as stated); and rat b-globin reverse primer (AACCTGGATACCAACCTGCC). The PCR reaction condition for generating the iNOS IS was performed as stated previously using 100 ng of rat genomic DNA [19]. PCR-amplified products were purified and transcribed into RNA. The rcRNA was subsequently treated with RNase-free DNase to remove the DNA template. After quantitation, the IS concentration was calculated; 330×bp is an approximation for the molecular weight of the IS, and the concentration is expressed as molecules of IS/ml.
2.5. Quantitati6e re6erse transcription-PCR RNA was isolated using Tri Reagent (Molecular Research Center, Cincinnati, OH) as described by Chomczynski and Mackey [20]. Competitive reverse transcription (RT)-PCR was performed as previously described [21]. Briefly, total RNA (100 ng) and IS rcRNA of a known amount were reverse transcribed into cDNA using oligo(dT)15 as a primer. Eight aliquots of RNA were taken from each treatment group, and an aliquot of IS rcRNA ranging from 103 to 1011 molecules was added to the appropriate treatment group RNA aliquot. PCR products were electrophoresed in 3% NuSieve 3:1 gels (FMC Bioproducts, Rockland, ME) and visualized by ethidium bromide staining. The iNOS primers produce a 379 bp amplified product from the RNA and a 301 bp product from the IS rcRNA. Quantitation was performed using the Gel Doc 1000 (Bio Rad, Hercules, CA), with which the amount of target mRNA present is determined as described by Gilliland et al. [22]. After performing the 103 –1011 range-finding experiment, a second set of much narrower internal standard dilutions (iNOS 106 –1010 molecules/tube) were examined in order to more accurately quantitate RNA message levels.
2.6. Vector construction For vector construction and electrophoretic mobility shift assay (EMSA), the
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
117
Rel/NF-kB-specific oligonucleotide (5%-gatctCAGAGGGGACTTTCCGAGAG-a3%), containing the NF-kB/Rel site of the Ig light chain gene enhancer (capital letters, nt 3937 to 3958) [23] and BglII restriction sites (small letters), was synthesized in Korea Biotech. Three copies of NF-kB/Rel consensus sequence were inserted into the pCAT-promoter vector (Promega) upstream of the chloramphenicol acetyltransferase (CAT) gene to construct pCAT(kB)3.
2.7. Transient transfection of RAW 264.7 cells and CAT assays RAW 264.7 cells were transfected using DEAE-dextran, diluted to 5×106 cells per 10 ml of complete media, plated on 100 mm plates, and incubated in the presence of 5% CO2 at 37oC for 24 h. The transfectants were treated with LPS or PWM. Eighteen hours later, the cells were washed with ice-cold PBS, resuspended in 0.25 mM Tris (pH 7.8), and subjected to three cycles of freezing and thawing. The lysates were centrifuged (12 000× g for 10 min at 4oC), and the supernatant was assayed for CAT activity by the thin layer chromatography method [24].
2.8. Electrophoretic mobility shift assay Nuclear extracts were prepared as previously described [25]. Treated and untreated RAW 264.7 cells were lysed with hypotonic buffer (10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulphonic acid (Hepes), 1.5 mM MgCl2, pH 7.5) and the nuclei were pelleted by centrifugation at 3000× g for 5 min. Nuclear lysis was performed using a hypertonic buffer (30 mM Hepes, 1.5 mM MgCl2, 450 mM KCl, 0.3 mM EDTA, and 10% glycerol), which contained 1 mM dithiothreitol; 1 mM phenylmethylsulfonyl fluoride; and 1 mg/ml each of aprotinin and leupeptin. Following lysis, the samples were centrifuged at 14 500× g for 15 min, and the supernatant was retained for use in the DNA binding assay. Two double-stranded deoxyoligonucleotides containing the NF-kB/Rel binding site (5%GGGGACTTTCC-3%) [22] were end-labeled with [g-32P]dATP. Nuclear extracts (5 mg) were incubated with 2 mg of poly(dI–dC) and the [32P]-labeled DNA probe in binding buffer (100 mM NaCl, 30 mM Hepes, 1.5 mM MgCl2, 0.3 mM EDTA, 10% glycerol, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 1 mg/ml concentration each of aprotinin and leupeptin) for 10 min on ice. DNA binding activity was separated from the free probe using a 4.8% polyacrylamide gel in 0.5× TBE buffer (44.5 mM Tris, 44.5 mM boric acid, and 1 mM EDTA). Following electrophoresis, the gel was dried and subjected to autoradiography.
2.9. Western blot analysis Nuclear extracts were prepared as described for EMSA. Cytoplasmic fractions were prepared as the post-nuclear fractions of cellular extracts concurrently with nuclear extract preparation. Extract proteins (20 mg) were separated by 10% sodium dodecy sulphate – polyacrylamide gel electrophoresis (SDS–PAGE), then electrob-
118
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
lotted to nitrocellulose membranes (Amersham International, Buckinghamshire, UK). Membranes were preincubated for 1 h at room temperature in Tris-buffered saline (TBS), pH 7.6, containing 0.05% Tween-20 and 5% nonfat dry milk. Immunostaining of membranes was performed with antisera specific for either p65 or c-Rel. Immunoreactive bands were then detected by incubation with conjugates of anti-rabbit immunoglobulin (Ig)G with alkaline phosphatase.
2.10. Statistical analysis of data The mean 9 S.D. was determined for each treatment group in a given experiment. When significant differences occurred, treatment groups were compared to the vehicle controls using a Dunnett’s two-tailed t-test.
3. Results and discussion In this study, the effects of PWM on NO production were examined and the involvement of NF-kB/Rel as signals in PWM-induced macrophage activation in murine macrophage cell line RAW 264.7 was also investigated. The effect of PWM on nitrite production was measured in order to monitor the NO production in the medium. Basal levels of nitrite in unstimulated RAW 264.7 cells were less than 2 nmol/ml (mean9S.D., n = 4); however, upon LPS stimulation, used as a control for 24 h, nitrite production was increased 14-fold over the basal levels as shown in Fig. 1A. PWM treatment for 24 h greatly increased the synthesis of NO in a dose-dependent manner. Consistent with these finding, iNOS mRNA was not detectable in unstimulated RAW 264.7 cells. Conversely, RNA isolated from cells treated for 6 h with PWM showed the active transcription of the iNOS gene as demonstrated by quantitative RT-PCR (Table 1). These results are similar to the induction caused by LPS [26]. These results suggest that PWM causes transcriptional activation of the iNOS gene in the macrophage cell line RAW 264.7. It has been reported that protein binding at the kB binding site is necessary to confer inducibility by LPS of iNOS [27,28]. To further investigate the role of NF-kB/Rel on iNOS gene expression, the effect of PWM on NF-kB/Rel was assessed using a transient transfection assay (Fig. 1B). When cells were transiently transfected with a plasmid containing three copies of the NF-kB/Rel binding sites and the CAT gene, PWM (1 mg/ml) induced a 5.1-fold increase in CAT activity. To further investigate the putative mechanism by which PWM activates iNOS, the effects of PWM on the activation of a family of transcription factors was monitored by gel shift assays during PWM activation of the cells. NF-kB/Rel family member binding activity was examined in the light of their critical role in the regulation of iNOS. EMSA demonstrated that PWM treatment of the cells induced a marked increase in NF-kB/Rel binding to its conserved site, which could be visualized as two distinct bands (Fig. 1C). This banding pattern was similar to that previously described by Xie et al. [28]. Kinetic studies showed strong induction by PWM of two separate kB binding complexes at 30 min that was even more enhanced after
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
119
60 min (Fig. 2A). The magnitude of the activation, however, appeared greater for the protein complex represented by the upper of the two bands. This finding would suggest that PWM may activate the formation of either p50/c-rel or p50/p65 heterodimers based on previous studies by Xie et al. [25], in which they identified these NF-kB/Rel proteins as being responsible for this upper band. The identification of the binding complex was investigated using a gel supershift assay. Both upper and lower bands were supershifted dramatically when the nuclear
Fig. 1. Activation of Rel/ NF-kB PWM in RAW 264.7 cells. (A) RAW 264.7 cells at 5 ×105 cells/ml were incubated with LPS (1 mg/ml) or PWM (0.2, 0.5, and 1 mg/ml) for 24 h. The supernatants were subsequently isolated and analyzed for nitrite. Each bar shows the mean 9S.D. of triplicate determinations. An asterisk denotes a response that is significantly different from the control group as determined by Dunnett’s two-tailed t-test at PB 0.05. (B) RAW 264.7 cells were transfected with pCAT(kB)3 by the DEAE-dextran method. Twenty-four hours after transfection, cells were treated with LPS or PWM (mg/ml) for 18 h. Cell extracts were then prepared and subjected to CAT assay. (C) RAW 264.7 cells were treated with LPS or PWM for 1 h. Nuclear extracts were then prepared and subjected to EMSA. NF-kB/Rel binding is identified by arrows. Cold; 100-fold molar excess of nonlabeled NF-kB probe. Results are representative of three separate experiments.
120
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
Fig. 1. (Continued)
extract was preincubated with antibody against p50. The upper band was supershifted with antibody against c-Rel and p50. However, no supershift was observed with antibody against p65 (Fig. 2B). Thus, the upper band appears to be composed of a p50/c-Rel heterodimer rather than a p50/p65 heterodimer, while the lower band appears to consist of the p50 homodimer. Western immunoblot analysis of the Table 1 The activation of iNOS gene expression by PWM in RAW 264.7 cellsa Treatment
iNOS mRNA (molecules×107/100 ng RNA)
NA LPS (1 mg/ml) PWM (0.2 mg/ml) PWM (0.5 mg/ml) PWM (1 mg/ml)
N.D.b 12.32 90.22 4.65 9 0.64 6.41 91.03 10.14 91.59
a RAW 264.7 cells were treated with LPS or PWM for 6 h. Total RNA was isolated and the number of molecules of iNOS mRNA were quantitated as outlined in Section 2. Results are expressed as the mean9 S.D. derived from three separate experiments in triplicate. b N.D., not detectable.
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
121
Fig. 2. Identification of kB binding proteins in the nuclei of RAW 264.7 cells treated with PWM. (A) Nuclear extracts from PWM (1 mg/ml)-stimulated RAW 264.7 cells were incubated with [32P]-labeled NF-kB probe. Cold; 100-fold molar excess of nonlabeled NF-kB probe. (B) RAW 264.7 cells were treated with PWM (1 mg/ml) for 30 min. Nuclear extracts were incubated in the presence or absence of anti-p50, p65 (Rel A), or c-Rel, followed by a binding reaction with the probe. Reaction products were electrophoresed, and the gels were dried and autoradiographed.
122
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
Fig. 3. Western blot analysis of p65 and c-Rel in the nucleus and cytoplasm of PWM-stimulated RAW 264.7 cells. RAW 264.7 cells were treated with PWM (1 mg/ml) for 30 min. Extract proteins (20 mg) were separated by SDS–PAGE, then electroblotted to nitrocellulose membranes. Immunostaining of the membranes was performed with antisera specific for either p65 or c-Rel. Immunoreactive bands were then detected by incubation with conjugates of anti-rabbit IgG with alkaline phosphatase. Results are representative of three separate experiments.
cytosolic and nuclear fractions provides further evidence that c-Rel but not p65 is activated and translocated to the nucleus. As shown in Fig. 3, p65 and c-Rel were detectable in the cytoplasmic extracts. Stimulation of cells with PWM induced the activation of c-Rel and its translocate to the nucleus, whereas p65 was sequestered in the cytoplasm. Collectively, this series of experiments indicate that c-Rel is positively regulated by PWM to help initiate iNOS gene expression. To confirm the involvement of NF-kB/Rel in the induction of iNOS gene expression by PWM-stimulated cells, TPCK, a serine proteinase inhibitor, was employed since it was reported to inhibit the activation of NF-kB/Rel by stabilizing the inhibitory subunit, IkBa [29]. Concomitant treatment of the cells with TPCK and PWM significantly inhibited NF-kB/Rel binding activity as shown in Fig. 4A. Under identical conditions (i.e. coincubation with TPCK), PWM-activated cells exhibited a dose-dependent inhibition in nitrite production, confirming the involvement of Rel/NF-kB in PWM-induced nitrite production (Fig. 4B). At a concentration of 100 mM, TPCK completely inhibited NO production. Collectively, this series of experiments indicates that NF-kB/Rel is positively activated by PWM to initiate iNOS gene expression. PWM is known to activate macrophages, in which PWM can induce IL-I, IL-6, TNF-a and GM-CSF gene expression [6–8,30,31]. The activation of NF-kB/Rel is triggered by different stimuli, e.g. LPS, viruses, the inflammatory cytokines TNFa and IL-1 [2]. The activated NF-kB/Rel initiates the transcription of several genes, including iNOS, IL-2, IL-6, TNFa, macrophage-CSF (M-CSF), and GM-CSF [2]. Recently, it was revealed that PWM initiates upstream events including phosphorylation and activation of cytoplasmic Raf-1 and MAP kinases [7]. The activation of MAP kinase in turn activates the c-Rel pathway [32]. In addition, the activation of Raf-1 and MAP kinase in murine macrophages partially also mimics LPS-induced signaling events, such as NF-kB/Rel activation [33]. Therefore, the step in the signal transduction pathway of NF-kB/Rel activation by PWM may be at the phosphorylation step of NF-kB/Rel. However, this speculation not to exclude the possibility
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
123
Fig. 4. Inhibition of NF-kB/Rel binding and nitrite production by TPCK in PWM-stimulated RAW 264.7 cells. (A) RAW 264.7 cells were treated with TPCK (50 mM) in the presence or absence of PWM (1 mg/ml) for 30 min. Nuclear extracts were then prepared and subjected to EMSA. NF-kB/Rel binding is identified by arrows. (B) RAW 264.7 cells were treated with TPCK (5, 20, 50, and 100 mM) in the presence of PWM (1 mg /ml) for 24 h. The supernatants were subsequently isolated and analyzed for nitrite. Each bar represents the mean 9 S.D. for triplicate determinations. An asterisk denotes a significant difference from the control group as determined by Dunnett’s two-tailed t-test at PB 0.05. Results are representative of three separate experiments.
124
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
that PWM-induced cytokines, such as TNFa and IL-1, may amplify the NF-kB/Rel activation. In conclusion, these experiments demonstrate that PWM increases the binding of the essential transcription factor NF-kB/Rel to the iNOS promoter, which in turn leads to increased transcription of the iNOS gene in the murine macrophage cell line RAW 264.7.
Acknowledgements This work was supported by KOSEF grant 961-0505-044-2 and Research Funds from Chosun University.
References [1] S. Moncada, R.M.J. Palmer, D.A. Higgs, Nitric oxide: physiology, pathophysiology, and pharmacology, Pharmacol. Rev. 43 (1991) 109 – 142. [2] P.A. Baeuerle, T. Henkel, Function and activation of NF-kappa B in the immune system, Annu. Rev. Immunol. 12 (1994) 141–179. [3] Q.-W. Xie, H.J. Cho, J. Calaycay, R.A. Mumford, K.M. Swiderek, T.D. Lee, A. Ding, T. Troso, C. Nathan, Cloning and characterization of inducible nitric oxide synthase from mouse macrophages, Science 256 (1992) 225 – 228. [4] C.J. Lowenstein, E.W. Alley, P. Raval, A.M. Snowman, S.H. Snyder, S.W. Russell, W.J. Murphy, Macrophage nitric oxide synthase gene: two upstream regions mediate induction by interferon gamma and lipopolysaccharide, Proc. Natl. Acad. Sci. U.S.A. 90 (1990) 9730 – 9734. [5] A.S. Baldwin Jr., The NF-kappa B and I kappa B proteins: new discoveries and insights, Annu. Rev. Immunol. 14 (1996) 649–683. [6] J.M. Ferrer, A. Plaza, M. Kreisler, F. Diaz-Espada, Differential interleukin secretion by in vitro activated human CD45RA and CD45RO CD4 +T cell subsets, Immunology 14 (1992) 10 – 20. [7] D. Chauhan, S.M. Kharbanda, E. Rubin, B.A. Barut, A. Mohrbacher, D.W. Kufe, K.C. Anderson, Regulation of c-jun gene expression in human T lymphocytes, Blood 81 (1993) 1540 – 1548. [8] G. Wallays, J.L. Ceuppens, Human T lymphocyte activation by pokeweed mitogen induces production of TNF-alpha and GM-CSF and helper signaling by IL-1 and IL-6 results in IL-2-dependent T cell growth, Eur. Cytokine Netw. 4 (1993) 269 – 277. [9] E.T. Morgan, Regulation of cytochromes P450 during inflammation and infection, Drug Metab. Rev. 29 (1997) 1129–1188. [10] J.F. Williams, Cytochrome P450 isoforms: Regulation during infection, inflammation and by cytokines, J. Fl. Med.Assoc. 78 (1991) 517 – 519. [11] C.W. Barker, J.B. Fagan, D.S. Pasco, Interleukin-1 suppresses the induction of P4501A1 and P4501A2 mRNAs in isolated hepatocytes, J. Biol. Chem. 267 (1992) 8050 – 8055. [12] Y.L. Chen, I. Florentin, A.M. Batt, L. Ferrari, J.P. Giroud, L. Chauvelot-Moachon, Effects of interleukin-6 on cytochrome P450-dependent mixed-function oxidases in the rat, Biochem. Pharmacol. 44 (1992) 137–148. [13] H.G. Jeong, T.C. Jeong, K.H. Yang, Mouse interferon gamma pretreated hepatocytes conditioned media suppress cytochrome P-450 induction by TCDD in mouse hepatoma cells, Biochem. Mol. Biol. Int. 29 (1993) 197–202. [14] O.G. Khatsenko, S.S. Gross, A.R. Rifkind, J.R. Vane, Nitric oxide is a mediator of the decrease in cytochrome P450-dependent metabolism caused by immunostimulants, Proc. Natl. Acad. Sci. U.S.A. 90 (1993) 11147–11151.
Y.J. Jeon et al. / Chemico-Biological Interactions 118 (1999) 113–125
125
[15] T.J. Carlson, R.E. Billings, Role of nitric oxide in the cytokine-mediated regulation of cytochrome P450, Mol. Pharmacol. 49 (1996) 796 – 801. [16] O.G. Khatsenko, A.R. Boobis, S.S. Gross, Evidence for nitric oxide participation in down-regulation of CYP2B1/2 gene expression at the pretranslational level, Toxicol. Lett. 90 (1997) 207 – 216. [17] H.G. Jeong, Differential effects of B and T lymphocyte mitogens on cytochrome P450 in mice, Toxicol. Lett. 104 (1999) 57–64. [18] L.C. Green, D.A. Wagner, J. Glogowski, P.L. Skipper, J.S. Wishnok, J.S. Tannenbaum, Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids, Anal. Biochem. 126 (1982) 131 – 138. [19] J. Vanden Heuvel, F. Tyson, D. Bell, Construction of recombinant RNA templates for use as internal standards in quantitative RT-PCR, Biotechniques 14 (1993) 395 – 398. [20] P. Chomczynski, K. Mackey, Substitution of chloroform by bromo-chloropropane in the single-step method of RNA isolation, Anal. Biochem. 225 (1995) 163 – 164. [21] Y.J. Jeon, K.H. Yang, J.T. Pulaski, N.E. Kaminski, Attenuation of inducible nitric oxide synthase gene expression by delta 9-tetrahydrocannabinol is mediated through the inhibition of nuclear factor- kappa B/Rel activation, Mol. Pharmacol. 50 (1996) 334 – 341. [22] G. Gilliland, K. Perrin, K. Blanchard, H. Bunn, Analysis of cytokine mRNA and DNA: detection and quantitation by competitive polymerase chain reaction, Proc. Natl. Acad. Sci. U.S.A. 87 (1990) 2725–2729. [23] J.W. Pierce, M. Lenardo, D. Baltimore, Oligonucleotide that binds nuclear factor NF-kappa B acts as a lymphoid-specific and inducible enhancer element, Proc. Natl. Acad. Sci. U.S.A. 85 (1988) 1482–1486. [24] C.M. Gorman, L.F. Moffat, B.H. Howard, Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells, Mol. Cell. Biol. 2 (1982) 1044 – 1051. [25] H. Xie, T.C. Chiles, T.L. Rothstein, Induction of CREB activity via the surface Ig receptor of B cells, J. Immunol. 151 (1993) 880–889. [26] R.B. Lorsbach, W.J. Murphy, C.J. Lowenstein, S.H. Snyder, S.W. Russell, Expression of the nitric oxide synthase gene in mouse macrophages activated for tumor cell killing. Molecular basis for the synergy between interferon-gamma and lipopolysaccharide, J. Biol. Chem. 268 (1993) 1908 – 1913. [27] J.M. Muller, H.W. Loms Ziegler-Heitbrock, P.A. Baeuerle, Nuclear factor kappa B, a mediator of lipopolysaccharide effects, Immunobiology 187 (1993) 233 – 256. [28] Q.-W. Xie, Y. Kashiwabara, C. Nathan, Role of transcription factor NF-kappa B/Rel in induction of nitric oxide synthase, J. Biol. Chem. 269 (1994) 4705 – 4708. [29] J.-Y. Jeong, K.-U. Kim, D.-M. Jue, Tosylphenylalanine chloromethyl ketone inhibitors TNF-a mRNA synthesis in the presence of activated NF-kB in RAW 264.7 macrophages, Immunology 92 (1997) 267–273. [30] D.S. Temeles, H.E. McGrath, E.L. Kittler, R.K. Shadduck, V.K. Kister, R.B. Crittenden, B.L. Turner, P.J. Quesenberry, Cytokine expression from bone marrow derived macrophages, Exp. Hematol. 21 (1993) 388–393. [31] D. Reinhold, U. Bank, F. Buhling, U. Lendecked, A.J. Ulmer, H.D. Flad, S. Ansorge, Transforming growth factor-beta 1 (TGF-beta 1) inhibits DNA synthesis of PWM-stimulated PBMC via suppression of IL-2 and IL-6 production, Cytokine 6 (1994) 382 – 388. [32] C.F. Meyer, X. Wang, C. Chang, D. Templeton, T.H. Tan, Interaction between c-Rel and the mitogen-activated protein kinase kinase kinase 1 signaling cascade in mediating kappaB enhancer activation, J. Biol. Chem. 271 (1996) 8971 – 8976. [33] J.H. Park, L. Levitt, Overexpression of mitogen-activated protein kinase (ERK1) enhances T-cell cytokine gene expression: role of AP1, NF-AT, and NF-KB, Blood 82 (1993) 2470 – 2477.
.