Insecticide resistance in Bemisia tabaci Gennadius (Homoptera: Aleyrodidae) and Anopheles gambiae Giles (Diptera: Culicidae) could compromise the sustainability of malaria vector control strategies in West Africa

G Model ACTROP-3105; No. of Pages 11

ARTICLE IN PRESS Acta Tropica xxx (2013) xxx–xxx

Contents lists available at SciVerse ScienceDirect

Acta Tropica journal homepage: www.elsevier.com/locate/actatropica

Insecticide resistance in Bemisia tabaci Gennadius (Homoptera: Aleyrodidae) and Anopheles gambiae Giles (Diptera: Culicidae) could compromise the sustainability of malaria vector control strategies in West Africa Olivier Gnankiné a,∗ , Imael H.N. Bassolé b , Fabrice Chandre c , Isabelle Glitho d , Martin Akogbeto e , Roch K. Dabiré f , Thibaud Martin g,h a

Laboratoire d’Entomologie Appliquée, Université de Ouagadougou, BP 7021 Ouagadougou, Burkina Faso Laboratoire BAEBIB, Université de Ouagadougou, Burkina Faso c IRD-MIVEGEC (UM1-UM2-CNRS 5290-IRD 224), BP 64501, 911 Av Agropolis, 34394 Montpellier Cedex 5, France d Université de Lomé, Faculté de Sciences et Techniques, Lomé, Togo e Centre de Recherche Entomologique de Cotonou (CREC), 06 BP 2604. Cotonou, Benin f IRSS/Centre Muraz, BP 390 Bobo-Dioulasso, Burkina Faso g Cirad – UR Hortsys, 34398 Montpellier Cedex 5, France h icipe, PO Box 30772-00100 Nairobi, Kenya b

a r t i c l e

i n f o

Article history: Received 9 March 2013 Received in revised form 29 May 2013 Accepted 9 June 2013 Available online xxx Keywords: West Africa Insecticide resistance Bioassays Bemisia tabaci Anopheles gambiae Integrated Pest Management (IPM)

a b s t r a c t Insecticides from the organophosphate (OP) and pyrethroid (PY) chemical families, have respectively, been in use for 50 and 30 years in West Africa, mainly against agricultural pests, but also against vectors of human disease. The selection pressure, with practically the same molecules year after year (mainly on cotton), has caused insecticide resistance in pest populations such as Bemisia tabaci, vector of harmful phytoviruses on vegetables. The evolution toward insecticide resistance in malaria vectors such as Anopheles gambiae sensus lato (s.l.) is probably related to the current use of these insecticides in agriculture. Thus, successful pest and vector control in West Africa requires an investigation of insect susceptibility, in relation to the identification of species and sub species, such as molecular forms or biotypes. Identification of knock down resistance (kdr) and acetylcholinesterase gene (Ace1) mutations modifying insecticide targets in individual insects and measure of enzymes activity typically involved in insecticide metabolism (oxidase, esterase and glutathion-S-transferase) are indispensable in understanding the mechanisms of resistance. Insecticide resistance is a good example in which genotype–phenotype links have been made successfully. Insecticides used in agriculture continue to select new resistant populations of B. tabaci that could be from different biotype vectors of plant viruses. As well, the evolution of insecticide resistance in An. gambiae threatens the management of malaria vectors in West Africa. It raises the question of priority in the use of insecticides in health and/or agriculture, and more generally, the question of sustainability of crop protection and vector control strategies in the region. Here, we review the susceptibility tests, biochemical and molecular assays data for B. tabaci, a major pest in cotton and vegetable crops, and An. gambiae, main vector of malaria. The data reviewed was collected in Benin and Burkina Faso between 2008 and 2010 under the Corus 6015 research program. This review aims to show: (i) the insecticide resistance in B. tabaci as well as in An. gambiae; and (ii) due to this, the impact of selection of resistant populations on malaria vector control strategies. Some measures that could be beneficial for crop protection and vector control strategies in West Africa are proposed. © 2013 Elsevier B.V. All rights reserved.

Contents 1. 2.

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Insecticide resistance in B. tabaci populations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

00 00

∗ Corresponding author. Tel.: +226 78826245. E-mail addresses: [email protected], [email protected] (O. Gnankiné), [email protected] (I.H.N. Bassolé), [email protected] (F. Chandre), [email protected] (I. Glitho), [email protected] (M. Akogbeto), dabire [email protected] (R.K. Dabiré), [email protected] (T. Martin). 0001-706X/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.actatropica.2013.06.004

Please cite this article in press as: Gnankiné, O., et al., Insecticide resistance in Bemisia tabaci Gennadius (Homoptera: Aleyrodidae) and Anopheles gambiae Giles (Diptera: Culicidae) could compromise the sustainability of malaria vector control strategies in West Africa. Acta Trop. (2013), http://dx.doi.org/10.1016/j.actatropica.2013.06.004

G Model ACTROP-3105; No. of Pages 11 2

ARTICLE IN PRESS O. Gnankiné et al. / Acta Tropica xxx (2013) xxx–xxx

3.

4. 5.

6.

Susceptibility tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.1. 2.2. Biochemical assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.3. Molecular assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Insecticide resistance in Anopheles gambiae populations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.1. Molecular forms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.2. Insecticide susceptibility tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.3. Biochemical assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.4. Molecular analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Impact of selection of resistant insect populations on malaria vector control strategies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A selection of sustainable insect pest and vector management measures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.1. Impact of transgenic cotton on resistance: The case of Burkina Faso . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.2. Bacteria in controlling pests and vectors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Funding . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Conflicts of interest . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Authors’ contributions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Acknowledgments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Appendix A. Supplementary data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

1. Introduction Most pesticides used in West Africa are for crop protection on cotton, especially in Sudano-Sahelian countries. Six liters of insecticide per hectare are distributed on credit each year to cotton farmers by ginning companies (Martin et al., 2005). But these insecticides are also sold on the informal market, and used on other crops such as vegetables (Ahouangninou et al., 2011). They belong mainly to the pyrethroids (PY) and organophosphate (OP) chemical families. The whitefly Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae) is one of the major pests of cotton and vegetable crops worldwide. This pest causes damage both directly by feeding and indirectly through the excretion of honeydew (Jones, 2003). B. tabaci is also a vector of Tomato yellow leaf curl virus (TYLCV), a complex of geminiviruses infecting tomato cultures worldwide (Berlinger, 1986). At present, invasions of virus-bearing B. tabaci continues to be a critical barrier to establishment of tomato crops in open fields (Berlinger, 1986). There is a considerable genetic and biological variability of B. tabaci leading to the opinion that B. tabaci is in fact a complex of morphologically indistinguishable species/biotypes (Perring, 2001; Simon et al., 2003; Pascual and Callejas, 2004; Boykin et al., 2007; McKenzie et al., 2009; De Barro and Ahmed, 2011; De Barro et al., 2011). We have retained the commonly used term biotype here to link this study with previous studies. To date, approximately 30 B. tabaci biotypes have been identified that differ with regard to various characteristics as host range, fecundity, ability to transmit plant viruses, endosymbionts diversity and insecticide resistance (Dittrich et al., 1990; Byrne and Toscano, 2002; Otoidobiga et al., 2002; Horowitz et al., 2003, 2005; Musa and Ren, 2005; Gnankiné et al., 2002, 2007; Xu et al., 2010). PYs and OPs were introduced in agriculture for the control of cotton pests about 30 years ago. They exerted a huge selection pressure on B. tabaci populations, which resulted to the selection of insecticide resistance in populations from West Africa (Houndété et al., 2010). In Burkina Faso indeed, B. tabaci populations in cotton fields were shown to be resistant to cypermethrin, methamidophos and omethoate (Houndété et al., 2010). Sub-Saharan Africa Silverleafing (ASL) and Q1 biotypes were identified on cotton plants, tomatoes, and okra by Cytochrome Oxidase1 (CO1) (Gnankiné et al., 2013a). Generally, Q1 biotypes are found predominantly and preferentially on cotton plants. ASL biotype is found in sympatry with Q1 on vegetable crops. A recent report done by Gnankiné et al. (2013b) showed the presence of the mutations that are responsible for the kdr and ace-1R resistance. These results clearly indicate that different biotypes/genetic groups co-exist in West Africa and

00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00

exhibit variations in insecticide resistance. Regarding resistance, F331W mutation in the acetylcholinesterase gene (ace1) was closed to fixation in Q1 and ASL individuals, but all Q3 individuals were susceptible. For kdr, the L925I mutation was observed only in Q1 populations. Thus, insecticide treatments rapidly selected for resistant individuals of Q biotypes; for instance, B biotype is known to be more susceptible to several chemical compounds than the Q biotype explaining why it sometimes displaces the B biotype (Horowitz et al., 2005; Chu et al., 2010). The evolution toward insecticide resistance in malaria vectors such as Anopheles gambiae Giles (Diptera: Culicidae) is partly related to the current use of these insecticides in agriculture (Corbel et al., 2007; Djogbénou et al., 2010; Yadouleton et al., 2011). The residues in plots are known to contaminate mosquito-breeding sites, resulting in delayed growth rates and development of resistance in larvae (Akogbeto et al., 2006). To date, malaria vector control has predominantly focused on targeting the adult mosquito through house spraying and long lasting insecticide net (LLIN) use (Kelly-Hope et al., 2008; Raghavendra et al., 2011). Unfortunately, OPs and PYs currently used in control of agricultural pests as B. tabaci are also the same ones used for vector control increasing the potential for resistance selection in mosquitoes as An. gambiae. An. gambiae is also a complex, with seven sibling species that are closely related and morphologically indistinguishable from each other by routine taxonomic methods (Gillies and Coetzee, 1987). It includes some of the most important malaria vector species of subSaharan Africa i.e. An. gambiae s.s. and An. arabiensis, Patton. Genetic differentiation also occurs within the highly polymorphic An. gambiae s.s. species subdivided into five cytoforms: Forest, Savanna, Bamako, Mopti, and Bissau. They differ in their arrangement of chromosomal inversion and appear more or less genetically isolated in the field (Coluzzi et al., 1985, 2002). In addition, studies using molecular markers such as X-linked ribosomal DNA revealed the presence of two distinct molecular forms within An. gambiae s.s: the M and S forms that co-exist in West Africa (Della Torre et al., 2005). In the dry savannahs of West Africa, the S form preferentially breeds in temporary aquatic habitats and is found during the rainy seasons, whereas the M form is present all year round, breeding in man-made permanent aquatic habitats (Simard et al., 2009). In Burkina Faso, genes conferring resistance to insecticides display large frequency differences in M and S forms and also within An. arabiensis (Dabiré et al., 2012). Resistance of An. gambiae s.l. to DDT and pyrethroids is especially conferred in West Africa by mutation of the sodium channel target site, the L1014F kdr (Martinez-Torres et al., 1998; Diabaté et al., 2002a,b;

Please cite this article in press as: Gnankiné, O., et al., Insecticide resistance in Bemisia tabaci Gennadius (Homoptera: Aleyrodidae) and Anopheles gambiae Giles (Diptera: Culicidae) could compromise the sustainability of malaria vector control strategies in West Africa. Acta Trop. (2013), http://dx.doi.org/10.1016/j.actatropica.2013.06.004

G Model ACTROP-3105; No. of Pages 11

ARTICLE IN PRESS O. Gnankiné et al. / Acta Tropica xxx (2013) xxx–xxx

Awolola et al., 2005; Fanello et al., 2000; Weill et al., 2000; Della Torre et al., 2001; N’Guessan et al., 2007). But now both mutations (L1014F, L1014S) coexist in some countries and are widely distributed throughout sub-Saharan Africa as well as in Burkina Faso (Dabiré et al., 2012; Verhaeghen et al., 2006; Etang et al., 2006). An insensitive acetylcholinesterase (ace-1R mutation) is involved in organophosphate/carbamate (OP/CX) resistance in field populations of An. gambiae s.l. from West Africa. Indeed, this mutation is a single amino-acid substitution, from a glycine to a serine at the position 119, in the AChE1 catalytic site (G119S) (Weill et al., 2004). To date, in Burkina Faso, especially in the west, we found An. gambiae exhibiting the double mutation (kdr and ace-1R ). Several years of intensive use of chemical insecticides to control arthropod pests and disease vectors has led to the selection of resistant populations in not only B. tabaci and An. gambiae, but also in other insect species. Integrated pest management has evolved as a favored approach to delay or reduce the impact of insecticide resistance. In Burkina Faso, the introduction of genetically modified cotton plants expressing the Cry1Ac and Cry2Ab toxins (Greenplate et al., 2003) which have a different mode of action to that of pyrethroids, may be an interesting and effective alternative to chemical control. Pray et al. (2002), have shown that transgenic cotton use has greatly reduced pesticide treatments while effectively controlling caterpillar pests. Supplementary treatments with neonicotonids at the boll opening stage against B. tabaci is thus not due to failure of Bt cotton. B. tabaci causes damages indirectly through honeydew excretion leading to the sticky cotton. The neonicotinoids are recommended because of their systemic effect making them suitable against sucking insect while the Bt genes handle most of the lepidopteran larvae. Monitoring resistance and identifying mechanisms involved are important steps in the management and setting up of better methods for controlling the two insects. This review considers the phenotypical and genotypical data on B. tabaci and An. gambiae, based on reliable methods currently used in West Africa. The data uncovered the spread of insecticide resistance among the B. tabaci biotypes and An. gambiae molecular forms, and the addition of resistance mechanisms in West African populations. This led us to ask the question: Do selection of resistant insect populations may compromise malaria vector control strategies used in West Africa? In this paper, we will answer this question and propose some measures on insect pest management (see Fig. 1).

2. Insecticide resistance in B. tabaci populations 2.1. Susceptibility tests Most techniques exist and are used to assess insecticide susceptibility of B. tabaci populations. A leaf dip bioassay method performed on the basis of previous studies (Rowland et al., 1991; Cahill et al., 1995), has been used to evaluate the resistance status in western Africa (Houndété et al., 2010). A few insecticides from different chemical families (OP, PY, neonicotinoids) were tested. Using this technique, Houndété et al. (2010) demonstrated that populations from Burkina Faso (BF) showed higher resistance to all insecticides tested than populations from Benin and frequently from Togo. In the absence of a susceptible strain, the population that exhibits a low value was used as reference strain. For instance, the highest resistance to deltamethrin and bifenthrin (PY) was observed in the Tiara (BF) population, which exhibited respectively, a 4.7- and 36-fold resistance. Soumousso (BF) populations showed greater resistance to dimethoate, (8.4-fold) than populations from Lomé (Togo) (1.6-fold). The populations from Bohicon (Benin) and Lomé (Togo) have been used to calculate the resistance ratio (RR)

3

for other field populations. To follow the phenotypical resistance during the season and for a rapid survey of resistance, the glass vial technique is recommended. This technique was used to determine the susceptibility of B. tabaci field populations to insecticides (OP, PY, carbamates) in the USA (Plapp et al., 1987; Sivasupramaniam et al., 1997). This technique is more suitable than the leaf-disk assay because it is less time consuming. 2.2. Biochemical assays Biochemical assays permit to detect enzymes associated with mechanism of resistance like elevated esterases, P-450s and glutathione-S-transferases. These include electrophoretic gels. The advantages of biochemical testing include the ability to carry out multiple assays on a single insect to look for multiple insecticide resistance rapidly (Brogdon, 1989). We have no data in Africa but in Greece, B. tabaci resistance to pyrethroids has been associated with both target-site modifications and enhanced detoxification of insecticidal compounds (Roditakis et al., 2009). Oxidative and hydrolytic pathways associated with elevated carboxylesterases (COE) and cytochrome P450-dependent monoxygenase activities have been reported (Dittrich et al., 1990; Bloch and Wool, 1994; Shchukin and Wool, 1994). A significant correlation was observed between ␣-cypermethrin resistance levels and COE activity with ␣-naphthyl acetate (Roditakis et al., 2009). The resistance to OPs and carbamates might involve enhanced detoxification of the insecticides by non-specific COE and cytochrome P450-dependent monoxygenases (Bloch and Wool, 1994), but also target site modifications (Byrne and Devonshire, 1997; Anthony et al., 1998; Alon et al., 2006). Cytochrome P450 activity was strongly correlated with resistance to imidacloprid (Karunker et al., 2008). It has been demonstrated that overexpression of CYP6CM1 is associated with high levels of imidacloprid resistance in B. tabaci. 2.3. Molecular assays The PCR procedure was performed to determine B. tabaci biotypes (Gnankiné, 2011) associated to the identification of kdr and ace-1R mutations (Tsagkarakou et al., 2009). Thus, genomic DNA was extracted from each individual adult of B. tabaci in 26 ␮l of Nonidet P-40 extraction buffer. Biotypes were identified using a PCR-RFLP (restriction fragment length polymorphism) based diagnostic assay. Briefly, in this method, a fragment of the mitochondrial marker CO1 (cytochrome oxidase 1 gene sequences, mtCOI) gene was amplified by PCR (Frohlich et al., 1999), using universal COI primers C1J-2195 (5 -TTGATTTTTTGGTCATCCAGAAGT-3 ) and TL2-N-3014 (5 -TCCAATGCACTAATCTGCCATATTA-3 ) (Khasdan et al., 2005). The PCR products were then digested by the restriction endonucleases XapI (Fermentas) and/or BfmI (Fermentas), which generates a clear polymorphism between biotypes B, MS, Q and Q1, Q2 or Q3 genetic groups. The PCR products are incubated with 10 U/␮L XapI (Fermentas) at 37 ◦ C for 3 h before loading onto agarose gel (Gnankiné, 2011). For identification of various kdr and ace-1R mutations, genomic DNA of samples was also used to amplify a ∼0.145 kb DNA fragment from the IIS4-6 region of the B. tabaci sodium channel, using primers Bt-kdr-F1 (5 -GCCAAATCCTGGCCAACT-3 ) and Bt-kdr-RIntr1 (5 -GAGACAAAAGTCCTGTAGC-3 ). For ace-1R , primers Bt-ace-F (5 -TAGGGATCTGCGACTTCCC-3 ) and Bt-ace-R (5 -GTTCAGCCAGTCCGTGTACT-3 ) were used to amplify a ∼0.25 kb DNA fragment from AChE gene of B. tabaci. Tsagkarakou et al. (2009) developed a PCR-RFLP method to detect mutations on Vgsc (Voltage-gated sodium channel) and ace1R allele. This method checks the genotypes resistance for a high

Please cite this article in press as: Gnankiné, O., et al., Insecticide resistance in Bemisia tabaci Gennadius (Homoptera: Aleyrodidae) and Anopheles gambiae Giles (Diptera: Culicidae) could compromise the sustainability of malaria vector control strategies in West Africa. Acta Trop. (2013), http://dx.doi.org/10.1016/j.actatropica.2013.06.004

G Model ACTROP-3105; No. of Pages 11

ARTICLE IN PRESS

4

O. Gnankiné et al. / Acta Tropica xxx (2013) xxx–xxx

Phenotypical and genotypical assays

B. tabaci from coon and vegetable plants under inseccides pressure

Inseccide residues contaminaon

An. gambiae in coon and peri-urban growing areas

Bioassay: Resistance rao

Molecular assay with PCR technique: species idenficaon

Biochemical assays: Metabolic resistance

Sustainable management of pests and vectors

Molecular assays with microarrays: Resistance genes Highlight of B. tabaci resistance

Highlight of An. gambiae resistance

- Stopping the use of PYR and OP inseccides and implementing the use of Bt coon - Eliminating bacteria In Bemisia or introducing Wolbachia in mosquitoes - Using alternave inseccides with no cross -resistance or with no negave impact on mosquitoes (i.e. biopescides)

Fig. 1. Monitoring resistance in Bemisia tabaci and Anopheles gambiae for improving IPM strategies.

number of samples from populations. It requires a two-step procedure PCR amplification and subsequent digestion by restriction enzymes. PCR and gel electrophoresis-based detection methods, including PCR-RFLP, are difficult to employ for high-throughput screening. Recently, an oligonucleotide microarray was developed for the detection of the M918V, L925I and T929V mutations in the voltage-gated sodium channel gene (vgsc) associated with PY resistance, and the F331W ace1 mutation associated with OP resistance (Chung et al., 2011). The oligonucleotide microarray was then applied to detect the resistance allele frequency in B. tabaci adults collected in areas of Korea, Japan, China and Greece in which OPs and PYs have been widely applied for pest control. By means of these techniques, three biotypes AnSL (Sub-Saharan Africa Non-Silverleafing), ASL and Q have been detected in 3 West African countries (Gnankiné et al., 2013a). These biotypes display a specific pattern of geographic distribution influenced by the host plant species. In Benin and Togo, the ASL and AnSL biotypes were predominant. In Burkina Faso the Q biotype was dominant, with two sub-groups, Q1 and Q3 (recorded to date only in this country), and ASL individuals found in sympatry with Q1 individuals in some localities (Gnankiné et al., 2013b). In addition, the data indicated that the biotype seemed to be linked to the kind

of mutations detected in all samples. F331W mutation (ace1 gene) was closed to fixation in Q1 and ASL individuals tested (e.g. Western BF) (Fig. 2). In the para-type voltage gated sodium channel gene (kdr), the L925I mutation was observed only in Q1 populations with the exception of Q1 individuals from Bittou (middle-East BF), where no mutation was detected (Gnankiné, 2011) and no M918T and T929V mutations have been observed in all populations tested. In northern Benin, no kdr gene was detected but ace-1R gene has been recorded. In Q3 individuals none of F331W (ace1 gene) and L925I (kdr gene) mutations were found in all individuals. 3. Insecticide resistance in Anopheles gambiae populations 3.1. Molecular forms PCR tests revealed two “molecular” forms (M and S), which are morphologically identical and largely sympatric throughout West Africa (Della Torre et al., 2001, 2005, Touré et al., 1998), but show molecular differences in the intergenic spacer (IGS) of the ribosomal DNA (Favia et al., 2001). Although a strong deficit of M/S hybrids is observed in the field (Diabaté et al., 2003) the forms interbreed in the laboratory and their offsprings are viable and fertile

Please cite this article in press as: Gnankiné, O., et al., Insecticide resistance in Bemisia tabaci Gennadius (Homoptera: Aleyrodidae) and Anopheles gambiae Giles (Diptera: Culicidae) could compromise the sustainability of malaria vector control strategies in West Africa. Acta Trop. (2013), http://dx.doi.org/10.1016/j.actatropica.2013.06.004

G Model ACTROP-3105; No. of Pages 11

ARTICLE IN PRESS O. Gnankiné et al. / Acta Tropica xxx (2013) xxx–xxx

5

Fig. 2. Distribution of the frequency of kdr and Ace1R in B. tabaci populations in two countries of West Africa.

(Diabaté et al., 2007). That raises the question of their taxonomic status. 3.2. Insecticide susceptibility tests Susceptibility tests involve the use of WHO (World Health Organization) test kits, a specially designed plastic container lined with insecticide-impregnated papers (WHO, 1998, 2011). Susceptibility tests were performed on 2–3 day-old An. gambiae s.l. females provided by larval collection, using the WHO standard vertical tube protocol. Bioassays with WHO diagnostic test kits were carried out using PY, carbamate and OP insecticides. Mortality control was carried out by exposing wild populations from each site to non-insecticidal impregnated paper. After 1 h exposure,

mosquitoes were transferred into insecticide-free tubes and maintained on sucrose solution. Final mortality was recorded 24 h after exposure. The threshold of susceptibility was fixed at 98% for the active molecules according to the WHO protocol (WHO, 1998). The resistance/susceptibility status was evaluated according to WHO criteria (WHO, 2011) considering mortality above 97% and below 90% representative of susceptibility and resistance, respectively. But between the two values, resistance was suspected. Dead and surviving mosquitoes were grouped separately and stored on silica gel at −20 ◦ C for further molecular characterization. In Benin, WHO diagnostic tests showed high frequency of resistance in both M and S forms of An. gambiae s.s. to permethrin, bendiocarb, fenitrothion and DDT (Corbel et al., 2007; Djègbè et al.,

Please cite this article in press as: Gnankiné, O., et al., Insecticide resistance in Bemisia tabaci Gennadius (Homoptera: Aleyrodidae) and Anopheles gambiae Giles (Diptera: Culicidae) could compromise the sustainability of malaria vector control strategies in West Africa. Acta Trop. (2013), http://dx.doi.org/10.1016/j.actatropica.2013.06.004

G Model ACTROP-3105; No. of Pages 11 6

ARTICLE IN PRESS O. Gnankiné et al. / Acta Tropica xxx (2013) xxx–xxx

2011). Yadouleton et al. (2011) investigated 3 cotton systems practices in Benin: (1) A Biological Program (BP) where no chemical was used but only organic products and natural fertilizers; (2) a Calendar Control Program (CCP) where 6 treatments were sprayed; and (3) a Targeted Intermittent Control Program (TICP), where 3 to 6 treatments were sprayed with chemical insecticides depending on pest infestation. An. gambiae populations from areas using the CCP and TICP Programs showed resistance to permethrin with mortality of 50 and 58%, respectively. On the contrary, susceptibility tests on An. gambiae from BP areas showed a high level of susceptibility to permethrin with an average mortality of 94%. In Burkina Faso, recent studies done by Dabiré et al. (2012) confirmed that resistance to DDT 4% is still prevailing with highest level (mortality rates <60%) in An. gambiae populations where also resistance to permethrin (PY) was increasingly reported (Diabaté et al., 2004; Dabiré et al., 2009c, 2012). Among OPs and carbamates tested, only bendiocarb was recommended for indoor residual spraying to supplement the efficacy of ITNs (Dabiré et al., 2012). WHO tests represent the first indicator of resistance and allow to confirm it by biochemical assays or molecular tests, depending on the mechanism involved. The limitation reported for this type of assay is the availability of WHO test kits with impregnated paper (Brogdon, 1989). 3.3. Biochemical assays Resistance may occur by other physiological mechanisms such as metabolic detoxification through increased enzyme activities (monooxygenase, esterase or glutathione S-transferase) (Hemingway, 1998). In Benin, Corbel et al. (2007) have carried out a study using biochemical assays suggesting that detoxification enzymes could be involved in the resistance of An. gambiae to permethrin, DDT, dieldrin and carbosulfan. An. gambiae s.l. mosquitoes from Malanville and Ladji showed significantly higher mixed function oxidase (MFO) content than the susceptible reference strain Kisumu. The level of esterase activity (using ␣-naphthyl acetate as a substrate) in Ladji population was significantly higher than that measured for Kisumu strain and other field populations (Corbel et al., 2007). Differences in the levels of GST activity were also observed in populations collected in Malanville and Asecna compared with Kisumu strain and populations collected in Ladji and Parakou. However, An. gambiae s.l. mosquitoes from Cotonou and Malanville showed higher oxidase activity compared to the Kisumu susceptible strain in 2009, whereas the esterase activity was higher in Bohicon mosquitoes in both 2008 and 2009 (Djègbè et al., 2011). In western Burkina Faso, a higher level of esterases was observed in the predominant molecular S form of An. gambiae from Banfora, Orodara and in M and S forms from Tiéfora (Namountougou et al., 2012). A significantly high level of GSTs was observed in An. gambiae populations from all sample sites compared with Kisumu strain, except from those collected in Dédougou. 3.4. Molecular analysis Genomic DNA was extracted from individual mosquitoes according to a procedure described by Collins et al. (1987). After quantification of the extracted DNA, adults of An. gambiae tested in the bioassay were processed by PCR for molecular identification of species complex and molecular forms according to Scott et al. (1993) and Favia et al. (2001), respectively. For kdr detection the frequency of the L1014F mutation in the same samples was determined by allele-specific PCR as described by Martinez-Torres et al. (1998). Ace-1R mutation was detected using the procedure based on the PCR-RFLP assay described by Weill et al. (2004) with minor modification. Specific primers, Ex3AGdir (GATCGTGGACACCGTGTTCG) and Ex3AGrev (AGGATGGCCCGCTGGAACAG) were used

in PCR reactions. Fifteen microliter of PCR product was digested with 5 U of AluI restriction enzyme (Promega, France) in a final volume of 25 ␮l at 37 ◦ C for 3 h. Products were then analyzed by electrophoresis on a 2% agarose gel stained with ethidium bromide and visualized under UV light. By means of these techniques, many authors could detect the prevalence of target site mutations molecular M and S forms of An. gambiae in several geographical areas, either alone or in sympatry (Fig. 3). The establishment of frequencies of kdr and ace-1R mutations on a map in connection with the molecular forms represents an overview of the resistance situation in Burkina Faso (Dabiré et al., 2012). An. gambiae form S was predominant in the west, which is also the cotton belt area, except in VK5 and VK7 localities near rice-growing areas. This form was also found in majority of eastern areas. In the middle part of Burkina Faso (Yamtenga and Koubri), M-forms were found with a moderate prevalence. The frequency of L1014F kdr allele implied in pyrethroid-resistance in cottongrowing areas was highest and ranged between 0.79 and 0.99 and was assumed to be selected by the intensive use of insecticides in agriculture (Chandre et al., 1999; Diabaté et al., 2002a). It was far more frequent in the S form than in the sympatric M form (Djogbénou et al., 2008a,b). Even though the ace-1R mutation was spread across two climatic zones, it was recorded mostly in the cotton growing areas (Dabiré et al., 2009b). Ace-1R mutation was less spread than kdr mutation within the An. gambiae s.s (Fig. 3). In Benin, M and S forms were also detected either alone or in sympatry (Yadouleton et al., 2011; Djègbè et al., 2011). A higher frequency of L1014F kdr allele was also detected in An. gambiae mosquitoes collected in urban areas compared to those collected in cotton growing areas (Yadouleton et al., 2011). The expansion of vegetable growing within urban and cotton treated areas probably contributed to selection pressure on mosquitoes (Corbel et al., 2007; Yadouleton et al., 2011; Djogbenou et al., 2011). Another L1014S kdr mutation was found recently in An. arabiensis in Benin (Djègbè et al., 2011). Up to now, the situation of OP and carbamates is not worrying. Nevertheless, less than 1% of An. gambiae showed the presence of the ace-1R mutation (Yadouleton et al., 2011).

4. Impact of selection of resistant insect populations on malaria vector control strategies Although it is known that selection for resistance in mosquitoes occurs at the adult stage as a consequence of household insecticide use, or public health including treated bed nets it cannot be ignored that the indirect selection pressure from the agricultural use of insecticides on breeding sites is a noteworthy consideration (Mouchet, 1988). The highest frequencies of L1014F mutation in An. gambiae are found in cotton growing regions of Burkina Faso, including the old and the new cotton belts (Namountougou et al., 2013; Dabiré et al., 2009c). The expansion of vegetable growing within urban areas in Benin probably contributed to selection pressure on mosquitoes (Corbel et al., 2007). In old cotton areas, insecticides, may have selected resistance in S form and not M form. Indeed, the S form occurred in relative important proportion toward the end of the rainy season with a maximum peak in October (Diabaté et al., 2002a; Dabiré et al., 2009a). Then, L1014F mutation may have been transferred from S form to M form by introgression in sympatric populations (Diabaté et al., 2002b). Recently in Cameroon, Fossog et al. (2012) showed phenotypic resistance in An. gambiae larvae to deltamethrin. Highest resistance ratio (RR = 325) was observed in larvae from cultivated areas as compared to polluted (RR = 195) by wastes or organic products in decomposition or non-polluted areas (RR = 205). According to

Please cite this article in press as: Gnankiné, O., et al., Insecticide resistance in Bemisia tabaci Gennadius (Homoptera: Aleyrodidae) and Anopheles gambiae Giles (Diptera: Culicidae) could compromise the sustainability of malaria vector control strategies in West Africa. Acta Trop. (2013), http://dx.doi.org/10.1016/j.actatropica.2013.06.004

G Model ACTROP-3105; No. of Pages 11

ARTICLE IN PRESS O. Gnankiné et al. / Acta Tropica xxx (2013) xxx–xxx

7

Fig. 3. Distribution of the frequency of kdr and Ace1R in An.gambiae s.l.populations in two countries of West Africa.

Nazni et al. (2005) resistance at larval stages is extremely high compared to adult stages. Mosquitoes may develop different resistance mechanisms through different metabolic pathways in the larval and adult stages (Kawada et al., 2011). In Burkina Faso and Benin, there is some evidence that the process of insecticide selection begins in fields, in treated areas, as most of the criteria listed by Georghiou (1982) were already observed. Among these criteria, one can retain: (i) Appearance of vector resistance prior to application of chemicals against the vector; (ii) higher resistance of vectors in agricultural areas than in non-agricultural; (iii) correlation between intensity of insecticide use on crops and degree of resistance vectors; (iv) fluctuations in resistance of vectors in parallel with periods of agricultural spraying; (v) correspondence between the spectrum of resistance of

vectors and types of insecticides applied to crops; (vi) temporary suppression of mosquito population densities following application of agricultural sprays. At the same time, use of PY and OP in agriculture has caused resistance in the tomato bollworm Helicoverpa armigera to PYs (Martin et al., 2000, 2002), the whitefly B. tabaci to PYs, OPs and neonicotinoids (Houndété et al., 2010) and the aphid Aphis gossypii to PYs and OPs (Carletto et al., 2010). To manage these resistant populations, the cotton protection strategy has been modified, reducing the use of PY and OP and re-introducing (Martin et al., 2005). PY and OP are still used, not only for cotton protection, but also in protection of vegetables in peri-urban areas (Ahouangninou et al., 2011) despite the resistance of these same pest species.

Please cite this article in press as: Gnankiné, O., et al., Insecticide resistance in Bemisia tabaci Gennadius (Homoptera: Aleyrodidae) and Anopheles gambiae Giles (Diptera: Culicidae) could compromise the sustainability of malaria vector control strategies in West Africa. Acta Trop. (2013), http://dx.doi.org/10.1016/j.actatropica.2013.06.004

G Model ACTROP-3105; No. of Pages 11 8

ARTICLE IN PRESS O. Gnankiné et al. / Acta Tropica xxx (2013) xxx–xxx

Fig. 4. Wolbachia-induced cytoplasmic incompatibility in insects.

We have detected the presence of high frequency of ace-1R allele in ASL biotypes of B. tabaci in northern Benin (Fig. 2). This shows the permanent selection pressure of OP on B. tabaci and other pests, and may selected rapidly individual mosquitoes in the breeding sites in the future. In western Burkina Faso, Q1 and ASL biotypes of B. tabaci exhibit a higher level of ace-1R (Fig. 2).The ace-1R mutation prevalence is fixed in some western cotton and vegetable areas (range between 0.9 and 1). This also indicates that the farmers currently use OPs against B. tabaci. In the same areas, Dabiré et al. (2012) showed a rather high level of ace-1R frequency in An. gambiae populations (<0.4). This level could increase more if farmers do not stop the OP treatments against agricultural pests. In some areas, the level of adult resistance may be higher than larvae. A similar case was previously reported regarding the malathion resistance of An. arabiensis in Sudan (Hemingway, 1983) where the authors attributed the absence of larval resistance to the house spraying as the major source of selection pressure rather than agricultural spraying. Nevertheless, alternatives to PYs and OPs are registered on cotton in most West African countries and some of them are already in use. Spinosad and indoxacarb have been tested with success against H. armigera (Ochou and Martin, 2003). Low quantities of spinosad are regularly used on cotton and growers appreciate this product because of its effectiveness in protecting vegetables against caterpillars. Neonicotinoids are used on cotton in Burkina Faso to control the sucking pests, B. tabaci and A. gossypii. But the resistance recently detected in B. tabaci field populations (Houndété et al., 2010), raises concerns of their impact on the selection of Q biotype. 5. A selection of sustainable insect pest and vector management measures 5.1. Impact of transgenic cotton on resistance: The case of Burkina Faso Implementation of transgenic cotton gave rise to hope, because pesticides belonging to OP and PY are not used in fields of Bt-cotton. Only, neonicotinoids are used at the end of the cotton phenological stages. It is probable that this technology allows homozygous and heterozygous ace-1R pests and vectors, which survive in the presence of insecticide, to be rapidly outcompeted in the absence of insecticide. In Culex pipiens, there is direct and indirect evidence that the resistance allele (ace-1R ) entails a large fitness cost, probably due to the mutated AChE1 having a much lower level of activity (Berticat et al., 2008). However, the recent observation of Ace1 duplicated alleles (i.e. the presence of a resistant and a susceptible

allele on the same chromosome) in An. gambiae populations from West Africa should reduce the fitness cost associated with resistance and slow its regression (Djogbénou et al., 2008a, 2010). 5.2. Bacteria in controlling pests and vectors B. tabaci, like most phloem-feeding insects, hosts an obligatory primary endosymbiont, the bacterium Portiera aleyrodidarum, required for providing essential nutrients for its survival and development. B. tabaci is also infected by several facultative vertically-transmitted symbiotic bacteria called secondary endosymbionts (Gueguen et al., 2010). Interestingly, a specific symbiotic community infects each biotype or genetic group (Gnankiné et al., 2013b). The symbiotic Rickettsia function as both mutualist and reproductive manipulators (Himler et al., 2011). In the laboratory, elimination of symbionts by the use of antibiotics is recommended. Population transformation using the intracellular bacterium Wolbachia is particularly attractive because this maternally inherited agent provides a powerful mechanism to invade natural populations, through cytoplasmic incompatibility (CI) (Fig. 4). Trans-infected Wolbachia strains from Drosophila melanogaster introduced into the dengue vector Ae. aegypti successfully invaded two natural Ae. aegypti populations in Australia, reaching nearfixation in a few months following releases of male-infected Ae. aegypti adults (Hoffmann et al., 2011). Maternal transmission of Wolbachia to resulting progeny is dependent on establishing infections in the ovaries of adult females. Ultimately this barrier to germline infection must be overcome to establish stably infected lines that could be deployed for malaria vector control strategies. A recent study shows that Plasmodium falciparum development in An. gambiae is suppressed by transient somatic infections of wMelPopCLA (Hughes et al., 2011). However, Anopheles species are naturally not infected by Wolbachia and then the control of malaria using Wolbachia-based methods is likely not achievable before a long term. 6. Conclusions IPM strategies adopted against cotton pests lead to a reduction in the level of pest populations and could influence positively the management of mosquitoes. For conventional cotton adopted in all West African countries, two to four treatments with PY plus OP contribute to the selection of resistant B. tabaci ASL and Q biotypes, increasing ineffectiveness of the treatments and enhancing pest infestations. This is due to the increasing dosages and application

Please cite this article in press as: Gnankiné, O., et al., Insecticide resistance in Bemisia tabaci Gennadius (Homoptera: Aleyrodidae) and Anopheles gambiae Giles (Diptera: Culicidae) could compromise the sustainability of malaria vector control strategies in West Africa. Acta Trop. (2013), http://dx.doi.org/10.1016/j.actatropica.2013.06.004

G Model ACTROP-3105; No. of Pages 11

ARTICLE IN PRESS O. Gnankiné et al. / Acta Tropica xxx (2013) xxx–xxx

frequencies, which have a reverse effect of gradually reducing the natural enemy populations. The Bt cotton strategy in Burkina Faso with one or two treatments of neonicotinoids, leads to the selection of B. tabaci Q biotype resistance. This technology have the same effects as conventional cotton, except the replacement of the local biotype (ASL) by Q biotype which could have a strong rate of recurrence in the transmission of viral diseases, particularly in solanaceous crops. In this strategy, suppression of PY and OP applications should result in reduction of selection pressure in An. gambiae, decreasing mainly OP resistance, thus increasing sensitivity of pyrethroids against mosquitoes (dominance and fixation of kdr mutation), in particular, their repulsive effects before the addition of enzymatic resistance mechanisms lead to their inefficiency. Management of resistance can slow resistance spread in all insect populations, and perhaps cause a resistant population to “revert” to a more susceptible level. Tactics for management of resistance can include the following counter measures: (i) respecting the dose and frequency of pesticide application; (ii) using local rather than area wide application; (iii) spraying locally only when pests are present; (iv) using targeted and less persistent pesticides; and (v) using, as far as possible, non-chemical control methods, alone or in combination with chemical measures. Meanwhile, with the development of durable tools such as vaccines, vector control has also been enhanced by the use of long lasting impregnated bed nets (LLINs) that are expected to improve the efficacy of classic impregnated nets. Globally, malaria prevention remains a long-term challenge and we must change our multidisciplinary concepts. The use of genetically modified mosquitoes and the perspective of the use of bacteria can now be properly envisioned, not exclusively but as part of a complete package in the current successful strategies used in the field.

Funding Authors are grateful to the project Corus 6015 from AIRD, which financially supported the study on resistance monitoring. Thank to University of Ouagadougou, University of Lomé, IRSS, IRD and CREC that contributed to fund this project.

Conflicts of interest The authors declare that they have no competing interests

Authors’ contributions OG and MT conceived and designed the study. OG, MT and INHB drafted the manuscript. MT, FC, MA, IG, RKD supervised and reviewed this manuscript. Each author approved the final manuscript.

Acknowledgments Authors also thank Dr. Dolorosa Osogo from Icipe for editing this manuscript.

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.actatropica.2013.06.004. These data include Google maps of the most important areas described in this article.

9

References Ahouangninou, C., Fayomi, B.E., Martin, T., 2011. Évaluation des risques sanitaires et environnementaux des pratiques phytosanitaires des producteurs maraîchers dans la commune rurale de Tori-Bossito (Sud-Bénin). Cah. Agric. 20, 216–222. Akogbeto, M., Djouaka, R., Kinde-Gazard, D.A., 2006. Screening of pesticide residues in soil and water samples from agricultural settings. Malaria J. 5, 22. Alon, M., Alon, F., Morin, S., Benting, J., Lueke, B., Ponge, T., 2006. Multiple origins of pyrethroid resistance in sympatric biotypes of Bemisia tabaci (Hemiptera: Aleyrodidae). Insect. Biochem. Mol. Biol. 36, 71–79. Anthony, N.M., Brown, J.K., Feyereisen, R., French-Constant, R.H., 1998. Diagnosis and characterization of insecticide-insensitive acetylcholinesterase in 3 populations of the sweet-potato whitefly Bemisia tabaci. Pestic. Sci. 52, 39–46. Awolola, T.S., Oyewole, I.O., Amajoh, C.N., Idowu, E.T., Ajayi, M.B., Oduola, A., Manafa, O.U., Ibrahim, K., Koekemoer, L.L., Coetzee, M., 2005. Distribution of the molecular forms of Anopheles gambiae and pyrethroid knock down resistance gene in Nigeria. Acta Trop. 95, 204–209. Berlinger, M.J., 1986. Host plant resistance to Bemisia tabaci. Agric. Ecosyst. Environ. 17, 69–82. Berticat, C., Bonnet, J., Duchon, S., Agnew, P., Weill, M., Corbel, V., 2008. Costs and benefits of multiple resistance to insecticides for Culex quinquefasciatus mosquitoes. BMC Evol. Biol. 8, 104. Bloch, G., Wool, D., 1994. Methidathion resistance in the sweetpotato whitefly (Aleyrodidae, Homoptera) in Israel: selection, heritability and correlated changes in esterase activity. J. Econ. Entomol. 87, 1147–1156. Boykin, L.M., Shatters, R.G., Rosell, R.C., Mckenzie, C.L., Bagnall, R.A., De Barro, P., Frohlich, D.R., 2007. Global relationships of Bemisia tabaci (Hemiptera Aleyrodidae) revealed using Bayesian analysis of mitochondrial COI DNA sequences. Mol. Phylogenet. Evol. 44, 1306–1319. Brogdon, W.G., 1989. Biochemical resistance detection: an alternative to bioassay. Parasitol. Today 5, 56–60. Byrne, F.J., Devonshire, A.L., 1997. Kinetics of insensitive acetylcholinesterases in organophosphate-resistant tobacco whitefly, Bemisia tabaci (Gennadius) (Homoptera Aleyrodidae). Pestic. Biochem. Physiol. 58, 119–124. Byrne, F.J., Toscano, N.C., 2002. Evaluation of peracid activated organophosphates in studies of insecticide resistance conferred by insensitive acetylcholinesterases. J. Econ. Entomol. 95, 425–429. Cahill, M., Byrne, F.J., Denholm, I., Devonshire, A.I., Gorman, K.J., 1995. Pyrethroid and organophosphate resistance in the tobacco whitefly Bemisia tabaci (Gennadius) (Homoptera Aleyrodidae). Bull. Entomol. Res. 84, 181–187. Carletto, J., Martin, T., Vanlerberghe-Masutti, F., Brévault, T., 2010. Insecticide resistance traits differ among genotypes from different host races in the aphid Aphis gossypii. Pest. Manage. Sci. 66, 301–307. Chandre, F., Manguin, S., Brengues, C., Dossou-Yovo, J., Darriet, F., Diabaté, A., Faye, O., Mouchet, J., Guillet, P., 1999. Status of pyrethroid resistance in Anopheles gambiae sensu lato. Bull. WHO 77, 230–234. Chu, D., Wan, F.H., Zhang, Y.J., Brown, J.K., 2010. Change in the biotype composition of Bemisia tabaci in Shandong Province of China from 2005 to 2008. Environ. Entomol. 39, 1028–1036. Chung, I.H., Kang, S., Kim, Y.R., Kim, J.H., Jung, J.W., Lee, S., Lee, S.H., Hwang, S.Y., 2011. Development of a low-density DNA microarray for diagnosis of targetsite mutations of pyrethroid and organophosphate resistance mutations in the whitefly Bemisia tabaci. Pestic. Manage. Sci. 67, 1541–1548. Collins, F.H., Mendez, M.A., Rasmussen, M.O., Mehaffey, P.C., Besansky, N.J., Finnerty, V., 1987. A ribosomal RNA gene probe differentiates member species of the Anopheles gambiae complex. Am. J. Trop. Med. Hyg. 37, 37–41. Coluzzi, M., Petrarca, V., Di Deco, M.A., 1985. Chromosomal inversion intergradation and incipient speciation in Anopheles gambiae. Boll. Zool. 52, 45–63. Coluzzi, M., Sabatini, A., Della Torre, A., Di Deco, M.A., Petrarca, V., 2002. A polytene chromosome analysis of the Anopheles gambiae species complex. Science 298, 1415–1418. Corbel, V., N’guessan, R., Brengues, C., Chandre, F., Djogbenou, L., Martin, T., Akogbéto, M., Houghard, J.M., Rowland, M., 2007. Multiple insecticide resistance mechanisms in Anopheles gambiae and Culex quinquefasciatus from Benin. West Africa. Acta. Trop. 101, 207–216. Dabiré, K.R., Diabaté, A., Djogbenou, L., Ouari, A., N‘guessan, R., Ouédraogo, J.B., Hougard, J.M., Chandre, F., Baldet, T., 2009a. Dynamics of multiple insecticide resistance in the malaria vector Anopheles gambiae in a rice growing area in South-Western Burkina Faso. Malaria J. 7, 188. Dabiré, K.R., Diabaté, A., Namountougou, M., Djogbenou, L., Kengne, P., Ouédraogo, J.B., Simard, F., Bass, C., Baldet, T., 2009b. The distribution of insensitive acetylcholinesterase (ace-1R ) in Anopheles gambiae s.l. populations from Burkina Faso (West Africa). Trop. Med. Int. Health 14, 396–403. Dabiré, K.R., Diabaté, A., Namountougou, M., Toé, K.H., Ouari, A., Kengne, P., Bass, C., Baldet, T., 2009c. Distribution of pyrethroid and DDT resistance and the L1014F kdr mutation in Anopheles gambiae s l. from Burkina Faso (West Africa). Trans. R. Soc. Trop. Med. Hyg. 103, 1113–1120. Dabiré, K.R., Diabaté, A., Namountougou, M., Djogbenou, L., Wondji, C., Chandre, F., Simard, F., Ouédraogo, J-B., Martin, T., Weill, M., Baldet, T., 2012. Trends in insecticide resistance in natural populations of malaria vectors in Burkina Faso, West Africa: 10 years’ surveys. In Insecticides—Pest Engineering. Edited by Perveen F. ISBN: 978-953-307-895-3. Rijeka and Shanghai: InTech., 479–502. De Barro, P., Ahmed, M., 2011. Genetic networking of the Bemisia tabaci cryptic species complex reveals pattern of biological invasions. PLoS ONE 6, e25579. De Barro, P.J., Liu, S.S., Boykin, L.M., Dinsdale, B., 2011. Bemisia tabaci: a statement of species status. Annu. Rev. Entomol. 56, 1–19.

Please cite this article in press as: Gnankiné, O., et al., Insecticide resistance in Bemisia tabaci Gennadius (Homoptera: Aleyrodidae) and Anopheles gambiae Giles (Diptera: Culicidae) could compromise the sustainability of malaria vector control strategies in West Africa. Acta Trop. (2013), http://dx.doi.org/10.1016/j.actatropica.2013.06.004

G Model ACTROP-3105; No. of Pages 11 10

ARTICLE IN PRESS O. Gnankiné et al. / Acta Tropica xxx (2013) xxx–xxx

Della Torre, A., Fanello, C., Akogbeto, M.J., Dossou-Yovo, G., Favia, V., Petrarca, M., Coluzzi, M., 2001. Molecular evidence of incipient speciation within Anopheles gambiae s.s. in West Africa. Insect. Mol. Biol. 10, 9–18. Della Torre, A., Tu, Z., Petrarca, V., 2005. On the distribution and genetic differentiation of Anopheles gambiae s.s. molecular forms. Insect. Biochem. Mol. Biol. 35, 7055–7069. Diabaté, A., Baldet, T., Chandre, F., Akogbeto, M., Darriet, F., Brengues, C., Guillet, P., Hemingway, J., Small, G.J., Hougard, J.M., 2002a. The role of agricultural use of insecticides in resistance to pyrethroids in Anopheles gambiae s.l. in Burkina Faso. Am. J. Trop. Med. Hyg. 67, 617–622. Diabaté, A., Baldet, T., Chandre, F., Guiguemde, R.T., Brengues, C., Guillet, P., Hemingway, J., Hougard, J.M., 2002b. First report of the kdr mutation in Anopheles gambiae M form from Burkina Faso, West Africa. Parassitologia 44, 157–158. Diabaté, A., Baldet, T., Chandre, C., Dabire, K.R., Kengne, P., Guiguemde, T.R., Simard, F., Guillet, P., Hemingway, J., Hougard, J.M., 2003. Kdr mutation, a genetic marker to assess events of introgression between the molecular M and S forms of Anopheles gambiae (Diptera: Culicidae) in the tropical savannah area of West Africa. J. Med. Entomol. 40, 195–198. Diabaté, A., Baldet, T., Chandre, F., Dabiré, K.R., Simard, F., Ouédraogo, J.B., Guillet, P., Hougard, J.M., 2004. First report of kdr mutation in Anopheles arabiensis from Burkina Faso, West Africa. J. Am. Mosq. Control Assoc. 20, 195–196. Diabaté, A., Dabire, R.K., Millogo, N., Lehmann, T., 2007. Evaluating the effect of postmating isolation between molecular forms of Anopheles gambiae (Diptera: Culicidae). J. Med. Entomol. 44, 60–64. Dittrich, V., Ernst, G.H., Ruesh, O., Solang, U.K., 1990. Resistance mechanisms in sweet-potato whitefly (Homoptera: Aleyrodidae) populations from Sudan, Turkey, Guatemala, and Nicaragua. J. Econ. Entomol. 83, 1665–1670. Djègbè, I., Boussari, O., Sidick, A., Martin, T., Ranson, H., Chandre, F., Akogbéto, M., Corbel, V., 2011. Dynamics of insecticide resistance in malaria vectors in Benin: first evidence of the presence of L1014S kdr mutation in Anopheles gambiae from West Africa. Malaria J. 10, 261. Djogbenou, L., Chandre, F., Berthomieu, A., Dabiré, R., Koffi, A., Haoues, A., Weill, M., 2008a. Evidence of introgression of the ace-1(R) mutation and of the ace-1 duplication in West African Anopheles gambiae s. s. PLoS ONE 3 (5), e2172. Djogbénou, L., Dabiré, R., Diabaté, A., Kengne, P., Akogbéto, M., Hougard, J.M., Chandre, F., 2008b. Identification and geographic distribution of the Ace-1R mutation in the malaria vector Anopheles gambiae in south-western Burkina Faso, West Africa. Am. J. Trop. Med. Hyg. 78, 298–302. Djogbénou, L., Labbé, P., Chandre, F., Pasteur, N., Weill, M., 2010. Ace-1 duplication in Anopheles gambiae: a challenge for malaria control. Malaria J. 8, 70. Djogbenou, L., Pasteur, N., Akogbéto, M., Weill, M., Chandre, F., 2011. Insecticide resistance in the Anopheles gambiae complex in Benin: a nationwide survey. Med. Vet. Entomol. 25, 256–267. Etang, J., Fonjo, E., Chandre, F., Morlais, I., Brengues, C., Nwane, P., Chouaibou, M., Ndjemai, H., Simard, F., 2006. Short report First report of knockdown mutations in the malaria vector Anopheles gambiae from Cameroon. Am. J. Trop. Med. Hyg. 74, 795–797. Fanello, C., Akogbeto, M., Della-Torre, A., 2000. Distribution of the knockdown resistance gene (kdr) in Anopheles gambiae s.l. from Benin. Trans. R. Soc. Trop. Med. Hyg. 94, 132. Favia, G., Lanfrancotti, A., Spanos, L., Siden-Kiamos, I., Louis, C., 2001. Molecular characterization of ribosomal DNA polymorphisms discriminating among chromosomal forms of Anopheles gambiae s.s. Insect. Mol. Biol. 10, 19–23. Fossog, B.T., Kopya, E., Ndo, C., Menze-Djantio, B., Costantini, C., Njiokou, F., AwonoAmbene, P., Antonio-Nkondjio, C., 2012. Water quality and Anopheles gambiae larval tolerance to pyrethroids in the cities of Douala and Yaoundé (Cameroon). J. Trop. Med., 10, Article ID 429817, doi:10.1155/2012/429817. Frohlich, D.R., Torres-Jerez, I.I., Bedford, I.D., Markham, P.G., Brown, J.K.A., 1999. Phylogeographical analysis of the Bemisia tabaci species complex based on mitochondrial DNA markers. Mol. Ecol. 8, 1683–1691. Georghiou, G.P., 1982. The implication of agricultural insecticides in the development of resistance by mosquitoes with emphasis on Central America. In: In Proceedings of an International Workshop on Resistance to Insecticides Used in Public Health and Agriculture, 22–26 February. Sri Lanka: National Science Council, pp. 95–121. Gillies, M.T., Coetzee, M., 1987. A supplement to the Anophelinae of Africa south of the Sahara (Afrotropical Region). In: Publications of the South African Institute for Medical Research (SAIMR), vol. 55., pp. 1–143. Gnankiné, O., Traoré, D., Dakouo, D., Sanon, A., Ouedraogo A.P., 2002. Evolution de la sensibilité des adultes de Bemisia tabaci (Homoptera: Aleyrodidae) vis-à-vis de quelques insecticides dans l’ouest du Burkina Faso. Rev. Science et technique, Série Sciences Naturelles et Agronomie 26, 157-170. Gnankiné, O., Traore, D., Sanon, A., Traore, N.S., Ouedraogo, A.P., 2007. Traitements insecticides et dynamique des populations de Bemisia tabaci en culture cotonnière au Burkina Faso. Cah. Agric. 16, 101–109. Gnankiné, O., 2011. Caracterisation moleculaire des populations de Bemisia tabaci (Homoptera: Aleyrodidae) et diffusion de la résistance aux insecticides en Afrique de l’ouest. In: Rapport de stage Nov 2010–Mars 2011. Université Claude Bernard de Lyon 1, UMR-CNRS, pp. 22. Gnankiné, O., Mouton, L., Henri, H., Terraz, G., Houndeté, T., Martin, T., Vavre, F., Fleury, F., 2013a. Distribution of Bemisia tabaci (Homoptera: Aleyrodidae) biotypes and their associated symbiotic bacteria on host plants in West Africa. Insect. Conserv. Diver. 6, 411–421. Gnankiné, O., Ketoh, G., Martin, T., 2013b. Dynamics of the invasive Bemisia tabaci (Homoptera: Aleyrodidae) Mediterranean (MED) species in two West African countries. Int. J. Trop. Insect. Sci. 33, 99–106.

Greenplate, J.T., Mullins, J.W., Penn, S.R., Dahhm, A., Reich, B.J., Osborn, J.A., Rahn, P.R., Ruschke, L., Shappley, Z.W., 2003. Partial characterization of cotton plants expressing two toxin proteins from Bacillus thuringiensis: relative toxin contribution, toxin interaction, and resistance management. J. Appl. Entomol. 127, 340–347. Gueguen, G., Vavre, F., Gnankine, O., Peterschmitt, M., Charif, D., Chiel, E., Gottlieb, Y., Ghanim, M., Zchori-Fein, E., Fleury, F., 2010. Endosymbiont metacommunities, mtDNA diversity and the evolution of the Bemisia tabaci (Hemiptera Aleyrodidae) species complex. Mol. Ecol. 19, 4365–4378. Hemingway, J., 1983. Biochemical studies on malathion resistance in Anopheles arabiensis from Sudan. Trans. R. Soc. Trop. Med. Hyg. 77, 477–480. Hemingway, J., 1998. Techniques to Detect Insecticide Resistance Mechanisms (Field and Laboratory Manual), Document WHO/CDS/CPC/MAL/98. 6. World Health Organization, Geneva, Switzerland, pp. 42. Himler, A.G., Adachi-Hagimori, T., Bergen, J.E., Kozuch, A., Kelly, S.E., Tabashnik, B.E., Chiel, E., Duckwort, V.E., Dennehy, T.J., Zchori-Fein, E., Hunter, M.S., 2011. Rapid spread of a bacterial symbiont in an invasive whitefly is driven by fitness benefits and female bias. Science 272, 254–256. Hoffmann, A.A., Montgomery, B.L., Popovici, J., Iturbe-Ormaetxe, I., Johnson, P.H., Muzzi, F., Greenfield, M., Durkan, M., Leong, Y.S., Dong, Y., Cook, H., Axford, J., Callahan, A.G., Kenny, N., Omodei, C., Mcgraw, E.A., Ryan, P.A., Ritchie, S.A., Turelli, M., O’Neill, S.L., 2011. Successful establishment of Wolbachia in Aedes populations to suppress dengue transmission. Nature 476, 454–457. Horowitz, A.R., Denholm, I., Gorman, K., Cenis, J.L., Kontsedalov, S., Ishaaya, I., 2003. Biotype Q of Bemisia tabaci identified in Israel. Phytoparasitica 31, 94–98. Horowitz, A.R., Kontsedalov, S., Khasdan, V., Ishaaya, I., 2005. Biotypes B and Q of Bemisia tabaci and their relevance to neonicotinoid and pyriproxyfen resistance. Arch. Insect. Biochem. Physiol. 58, 216–225. Houndété, T.A., Kétoh, G.K., Hema, O.S.A., Brévault, T., Glitho, I.A., Martin, T., 2010. Insecticide resistance in field populations of Bemisia tabaci (Hemiptera Aleyrodidae) in West Africa. Pest. Manage Sci. 66, 1181–1185. Hughes, G.L., Koga, R., Xue, P., Fukatsu, T., Rasgon, J., 2011. Wolbachia infections are virulent and inhibit the human malaria parasite Plasmodium falciparum in Anopheles gambiae. PLoS Pathogen 7, e1002043. Jones, D.R., 2003. Plant viruses transmitted by whiteflies. Eur. J. Plant Pathol. 109, 195–219. Karunker, I., Benting, J., Lueke, B., Ponge, T., Nauen, R., Roditakis, E., Vontas, J., Gorman, K., Ian Denholm, I., Morin, S., 2008. Overexpression of cytochrome P450 CYP6CM1 is associated with high resistance to imidacloprid in the B and Q biotypes of Bemisia tabaci (Hemiptera: Aleyrodidae). Insect. Biochem. Mol. Biol. 38, 634–644. Kawada, H., Dida, G.O., Ohashi, K., Komagata, O., Kasai, S., Tomita, T., Sonye, G., Maekawa, Y., Mwatele, C., Njenga, S.M., Mwandawiro, C., Minakawa, N., Takagi, M., 2011. Multimodal pyrethroid resistance in malaria vectors, Anopheles gambiae s.s., Anopheles arabiensis, and Anopheles funestus s.s. in Western Kenya. PLoS ONE 6 (8), e22574, doi:10.1371/journal.pone.0022574. Kelly-Hope, L., Ranson, H., Hemingway, J., 2008. Lessons from the past: managing insecticide resistance in malaria control and eradication programs. Lancet. Infect. Dis. 8, 387–389. Khasdan, V., Levin, I., Rosner, A., Morin, S., Kontsedalov, S., Maslenin, L., Horowitz, A.R., 2005. DNA markers for identifying biotypes B and Q of Bemisia tabaci (Hemiptera Aleyrodidae) and studying population dynamics. Bull. Entomol. Res. 95, 605–613. Martin, T., Chandre, F., Ochou Ochou, G., Vaissayre, M., Fournier, D., 2002. Pyrethroid resistance mechanisms in the cotton bollworn Helicoverpa armigera (Lepidoptera Noctuidae) from West Africa. Pestic. Biochem. Physiol. 74, 17–26. Martin, T., Ochou Ochou, G., Hala N‘klo, F., Vassal, J.M., Vaissayre, M., 2000. Pyrethroid resistance in the cotton bollworm Helicoverpa armigera (Hübner), in West Africa. Pestic. Manage. Sci. 56, 549–554. Martin, T., Ochou, O.G., Djihinto, A., Traore, D., Togola, M., Vassal, J.M., Vaissayre, M., Fournier, D., 2005. Controlling an insecticide-resistant bollworm in West Africa. Agric. Ecosyst. Environ. 107, 409–411. Martinez-Torres, D., Chandre, F., Williamson, M.S., Darriet, F., Bergé, J.B., Devonshire, A.L., Guillet, P., Pasteur, N., Pauron, D., 1998. Molecular characterization of pyrethroid knockdown resistance (kdr) in the major malaria vector Anopheles gambiae s.s. Insect. Mol. Biol. 7, 179–184. McKenzie, Hodges, C.L., Osborne, G., Byrne, L.S., Shatters, F.J., R.G.Jr., 2009. Distribution of Bemisia tabaci (Hemiptera: Aleyrodidae) biotypes in Florida—investigating the Q invasion. J. Econ. Entomol. 102, 670–676. Mouchet, J., 1988. Mini-review agriculture and vector resistance. Insect. Sci. Appl. 9, 291–302. Musa, D.P., Ren, S.X., 2005. Development and reproduction of Bemisia tabaci (Homoptera: Aleyrodidae) on three bean species. Insect Sci. 12, 25–30. N’Guessan, R., Corbel, V., Akogbeto, M., Rowlands, M., 2007. Reduced efficacy of insecticide-treated nets and indoor residual spraying for malaria control in pyrethroid resistance area, Benin. Emerg. Infect. Dis. 13, 199–206. Namountougou, M., Diabaté, A., Etang, J., Bass, C., Sawadogo, S.P., Gnankine, O., Baldet, T., Martin, T., Chandre, F., Simard, F., Dabire, R.K., 2013. First report of the L1014S kdr mutation in wild populations of Anopheles gambiae M and S molecular forms in Burkina Faso (West Africa). Acta. Trop. 125, 123–127. Namountougou, M., Simard, F., Baldet, T., Diabaté, A., Ouédraogo, J.B., Martin, T., Dabire, K.R., 2012. Multiple Insecticide Resistance in Anopheles gambiae s.l. populations from Burkina Faso, West Africa. PLoS ONE 7, e48412, doi:10.1371/journal.pone.0048412.

Please cite this article in press as: Gnankiné, O., et al., Insecticide resistance in Bemisia tabaci Gennadius (Homoptera: Aleyrodidae) and Anopheles gambiae Giles (Diptera: Culicidae) could compromise the sustainability of malaria vector control strategies in West Africa. Acta Trop. (2013), http://dx.doi.org/10.1016/j.actatropica.2013.06.004

G Model ACTROP-3105; No. of Pages 11

ARTICLE IN PRESS O. Gnankiné et al. / Acta Tropica xxx (2013) xxx–xxx

Nazni, W.A., Lee, H.L., Azahari, A.H., 2005. Adult and larval insecticide susceptibility status of Culex quinquefasciatus (Say) mosquitoes in Kuala Lumpur, Malaysia. Trop. Biomed. 22, 63–68. Ochou, O.G., Martin, T., 2003. Activity spectrum of Spinosad and Indoxacarb rationale for a differential resistance management strategy in West Africa. Resistance Pest. Manage. Newslett. 12, 75–81. Otoidobiga, L.C., Vincent, C., Stewart, K.R., 2002. Susceptibility of field populations of adult Bemisa tabaci Gennadius (Homoptera Aleyrodidae) and Eretmocerus sp. (Hymenoptera: Aphelinidae) to cotton insecticides in Burkina Faso (West Africa). Pest. Manage Sci. 59, 97–106. Pascual, S., Callejas, C., 2004. Intra- and interspecific competition between biotypes B and Q of Bemisia tabaci (Hemiptera Aleyrodidae) from Spain. Bull. Entomol. Res. 94, 369–375. Perring, T.M., 2001. The Bemisia tabaci species complex. Crop Prot. 20, 725–737. Plapp, F.W., Mcwhorter, G.M., Vance, W.H., 1987. Monitoring for pyrethroid resistance in the tobacco budworm in Texas. In Proceedings, Beltwide Cotton Production Research Conferences. Memphis, TN: National Cotton Council of America, 324–326. Pray, C.E., Huang, J., Hu, R., Rozelle, S., 2002. Five years of Bt cotton in China – the benefits continue. Plant J. 31, 423–430. Raghavendra, R., Barik, T.K., Reddy, B.P.N., Sharma, P., Dash, A.P., 2011. Malaria vector control: from past to future. Parasitol. Res. 108, 757–779. Roditakis, E., Grispou, M., Morou, E., Kristoffersen, J., Roditakis, N., Nauen, R., Vontas, J., Tsagkarakou, A., 2009. Current status of insecticide resistance in Q biotype Bemisia tabaci populations from Crete. Pest. Manage. Sci 65, 313–322. Rowland, M., Hackete, B., Stribley, M., 1991. Evaluation of insecticides in field control simulators and standard laboratory bioassays against resistant and susceptible Bemisia tabaci (Homoptera Aleyrodidae) from Sudan. Bull. Entomol. Res. 81, 189–199. Scott, J.A., Brogdon, W.G., Collins, F.H., 1993. Identification of single specimens of Anopheles gambiae complex by polymerase chain reaction. Am. J. Trop. Med. Hyg. 49, 520–529. Shchukin, A., Wool, D., 1994. Pyrethroid resistance and esterase activity in selected laboratory populations of sweetpotato whitefly Bemisia tabaci (Homoptera Aleyrodidae). Eur. J. Entomol. 91, 285–295. Simard, F., Ayala, D., Kamdem, G., Pombi, M., Etouna, J., Ose, K., Fotsing, J-M., Fontenille, D., Besansky, N.J., Costantini, C., 2009. Ecological niche partitioning between Anopheles gambiae molecular forms in Cameroon: the ecological side of speciation. BMC Ecol. 9, 17.

11

Simon, B., Cenis, J.L., Demichelis, S., Rapisarda, C., Caciagli, P., Bosco, D., 2003. Survey of Bemisia tabaci (Hemiptera Aleyrodidae) biotypes in Italy with the description of a new biotype (T) from Euphorbia characias. Bull. Entomol. Res. 93, 259–264. Sivasupramaniam, S., Johnson, S., Watson, T.F., Osman, A.A., Jassim, R., 1997. A glassvial technique for monitoring resistance of the silverleaf whitefly (Homoptera: Aleyrodidae) to selected insecticides in Arizona. J. Econ. Entomol. 90, 66–74. Touré, Y.T., Petrarca, V., Traore, S.F., Coulibaly, A., Maiga, H.M., Sankare, O., Sow, M., Di Deco, M.A., Coluzzi, M., 1998. The distribution and inversion polymorphism of chromosomally recognized taxa of the Anopheles gambiae complex in Mali, West Africa. Parassitologia 40, 477–511. Tsagkarakou, A., Nikou, D., Roditakis, E., Sharvit, M., Morin, S., Vontas, J., 2009. Molecular diagnostics for detecting pyrethroid and organophosphate resistance mutations in the Q biotype of the whitefly Bemisia tabaci (Hemiptera Aleyrodidae). Pestic. Biochem. Physiol. 94, 49–54. Verhaeghen, K., Van-Bortel, W., Roelants, P., Backeljau, T., Coosemans, M., 2006. Detection of the East and West African kdr mutation in Anopheles gambiae and Anopheles arabiensis from Uganda using a new assay based on FRET/Melt curve analysis. Malaria J. 5, 16. Weill, M., Chandre, F., Brengues, C., Manguin, S., Akogbeto, M., Pasteur, N., Guillet, P., Raymond, M., 2000. The kdr mutation occurs in the Mopti form of Anopheles gambiae s.s. through introgression. Insect. Mol. Biol. 9, 451–455. Weill, M., Malcolm, C., Chandre, F., Mogensen, K., Berthomieu, A., Marquin, M., Raymond, M., 2004. The unique mutation in ace-1 giving high insecticide resistance is easily detectable in mosquito vectors. Insect. Mol. Biol. 13, 1–7. WHO, 1998. Test procedures for insecticides resistance monitoring in malaria vectors, bioefficacy and persistence of insecticides treated surfaces, No. WHO/CDS/MAL. Geneva: World Health Organization, 46 pp. WHO, 2011. The technical basis for coordinated action against insecticide resistance: preserving the effectiveness of modern malaria vector control, meeting report. Geneva, World Health Organization, 36 pp. Xu, J., De Barro, P.J., Liu, S.S., 2010. Reproductive incompatibility among genetic groups of Bemisia tabaci supports the proposition that the whitefly is a cryptic species complex. Bull. Entomol. Res. 100, 359–366. Yadouleton, A.W., Martin, T., Padonou, G., Chandre, F., Asidi, A., Djogbenou, L., Dabiré, R., Aïkpon, R., Boko, M., Glitho, I., Akogbeto, M., 2011. Cotton pest management practices and the selection of pyrethroid resistance in Anopheles gambiae population in Northern Benin. Parasit. Vectors 4, 60.

Please cite this article in press as: Gnankiné, O., et al., Insecticide resistance in Bemisia tabaci Gennadius (Homoptera: Aleyrodidae) and Anopheles gambiae Giles (Diptera: Culicidae) could compromise the sustainability of malaria vector control strategies in West Africa. Acta Trop. (2013), http://dx.doi.org/10.1016/j.actatropica.2013.06.004