- Email: [email protected]
Isolation of a strain of Trichoderma reesei with improved glucoamylase secretion by flow cytometric sorting
Enzyme and Microbial Technology 47 (2010) 342–347
Contents lists available at ScienceDirect
Enzyme and Microbial Technology journal homepage: www.elsevier.com/locate/emt
Isolation of a strain of Trichoderma reesei with improved glucoamylase secretion by flow cytometric sorting William Throndset a,b,∗ , Ben Bower a , Rodante Caguiat a , Toby Baldwin a , Mick Ward a a b
Genencor, A Danisco Division, 925 Page Mill Road, Palo Alto, CA 94304, USA University of Manchester, Faculty of Life Sciences, Manchester, UK
a r t i c l e
i n f o
Article history: Received 5 May 2010 Received in revised form 3 September 2010 Accepted 6 September 2010 Keywords: Trichoderma reesei Flow cytometry Glucoamylase GFP Screening Biofuels High-speed sorting Fungi Comparative genome hybridization
a b s t r a c t A single copy of the Renilla reniformis green fluorescent protein (GFP) gene under control of the cellobiohydrolase I (cbh1) promoter was inserted into a strain of Trichoderma reesei at the pyr4 locus by homologous recombination. The parent strain contained two copies (a tandem repeat) of the native glucoamylase (GA) gene integrated at a different locus, and controlled by a separate copy of the cbh1 promoter. A large positive correlation (r = 0.54) was observed between GFP expression and GA activity in ∼1900 randomly mutagenised germlings cultured in microtiter plates. The GFP-expressing strain was randomly mutagenised and screened using fluorescence activated cell sorting. Single germinating spores expressing GFP under conditions of carbon catabolite repression were sorted into individual wells of ten 96-well microtiter plates, cultured for 6 days, and assayed for GA activity. The strain producing the highest titres of GA from each of three rounds was re-screened by FACS. A variant (R3-14) was isolated that produced about 35% more total protein at 70% greater specific productivity in 14L fed-batch fermentation. The genome of strain R3-14 was analysed using comparative genome hybridization and large duplications totalling more than 750 kbp were identified on scaffolds 13, 2, 33 and 38 comprising 189 open reading frames. These included several putative transcriptional regulators, carbohydrate hydrolysing enzymes, and sugar transporters. © 2010 Elsevier Inc. All rights reserved.
1. Introduction The soft-rot fungus Trichoderma reesei (Hypocrea jecorina) is widely used in industry because of its ability to secrete large quantities of hydrolytic enzymes. Higher-yielding strains were initially derived from the wild type strain QM6a by classical mutagenesis and screening [15,18]. These improved strains have been widely used for production of native cellulases, and further manipulated using recombinant DNA technology [19]. The cbh1 promoter (Pcbh1) has been used for targeted overproduction of both homologous and heterologous proteins [11,23]. A similar technique has been used to increase production of glucoamylase P of Hormoconis resinae in T. reesei [10]. The glucoamylase family of enzymes (␣-1,4-glucan glucohydrolases, E.C.3.2.1.3.) is starch hydrolyzing exo-acting carbohydrases produced by plants, bacteria, and fungi that catalyze the removal of successive glucose units from the non-reducing ends of starch molecules. They are widely used in a variety of applications requiring the hydrolysis of starch where complete degradation to glucose
∗ Corresponding author at: Genencor, A Danisco Division, 925 Page Mill Road, Palo Alto, CA 94304, USA. Tel.: +1 650 846 4035; fax: +1 650 621 8061. E-mail address: [email protected] (W. Throndset). 0141-0229/$ – see front matter © 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.enzmictec.2010.09.005
is required. Glucose produced by glucoamylases can be used to manufacture high-fructose corn syrup, crystallized, or used in fermentations to produce end-products such as citric acid, ascorbic acid, glutamic acid, and 1,3 propanediol, among others. Glucoamylases are also used in the production of ethanol for fuel and for personal consumption, and in the preparation of animal feeds as feed additives [5]. The structure for T. reesei (H. jecorina) glucoamylase has been determined in two crystal forms, including the catalytic domain (CD), the starch binding domain (SBD) and linker region [2]. The catalytic domain was found to be essentially identical to other glucoamylases while performance differences were hypothesised to be attributable to the amino acid side chains involved in the specific interaction between the CD, the linker, and the SBD [2]. We recently demonstrated the utility of using high speed cell sorting to isolate a strain of T. reesei with improved ability to hydrolyse biomass [22]. The screening procedure was based upon the observation that when GFP transcription is driven by the cbh1 promoter, expression of the molecule in fungal germlings is regulated in a carbon-dependent fashion [21]. In this study, our aim was to apply a strategy to improve the production of a single homologous protein (glucoamylase) by inserting a DNA construct containing Pcbh1, GFP, and a selectable marker (amdS) for utilisation of acetamide as the sole nitrogen source
W. Throndset et al. / Enzyme and Microbial Technology 47 (2010) 342–347
(pyr4-amdS-hrGFP) at a known locus (pyr4) in the genome to simplify subsequent removal by homologous recombination with a deletion vector containing a different selectable marker. The parent strain contained a tandem duplication of a DNA construct consisting of a copy of the cbh1 promoter attached to the native T. reesei glucoamylase (Pcbh1:gla1) integrated at a different (random) locus than the GFP construct. We hypothesised that a correlation between intracellular expression of GFP and secretion of GA might exist in a population of randomly mutated strains, which would enable enrichment by flow cytometric sorting based on GFP expression for strains with improved ability to secrete glucoamylase. 2. Materials and methods 2.1. Strain creation and culture conditions The T. reesei strain used in this study (29-9) was derived from RL-P37 (NRRL 15709) which had been deleted for the genes encoding the major exo and endoacting cellobiohydrolases CBHI (cel7a), CBHII (cel6a), EGI (cel7b) and EGII (cel5a) and transformed with a vector containing the cbh1 promoter driving the transcription of a tandem repeat of the native T. reesei glucoamylase gene (Pcbh1:gla1). The parent strain was transformed with a vector (pyr4-amdS-hrGFP) containing the humanised Renilla reniformis GFP gene (phrGFP; Stratagene, La Jolla, CA), and the amdS gene from Aspergillus nidulans (acetamide utilisation), resulting in strain GFP18 [12,13]. To create the vector, a fragment containing the amdS marker, and a second fragment containing the T. reesei cbh1 promoter (PcbhI), GFP, and the T. reesei cbh1I terminator (Tcbh1I), were ligated into a vector containing pyr4 5 and 3 flanking sequences. The amdS gene was excised from amdS-pCR Blunt TOPO using AscI and XbaI and ligated into a vector containing the pyr4 flanking sequences using the same restriction sites. The Pcbh1-gfp-Tcbh1 cassette was amplified from pTrex2g/hrGFP using the forward primer 5 GCGCTCTAGAGGGACTTTGATGGTCATC3 and the reverse primer 5 GCGCTCTAGAGCAAGCTTGAGATCCGTT3 . The PCR amplification conditions consisted of an initial denaturation step at 95 ◦ C for 2 min, followed by 32 cycles of denaturation at 94 ◦ C for 30 s, annealing at 60 ◦ C for 40 s, and extension at 72 ◦ C for 3 min. The reaction ended with a final extension step at 72 ◦ C for 10 min. The resulting PCR fragment of 2979 bp was purified using Qiagen’s PCR Purification Kit (Qiagen, Valencia, CA) and cloned into pCR-BLUNT II-TOPO (Invitrogen, Carlsbad, CA), and transformed into E. coli Top 10 competent cells (Invitrogen). The resulting clones were confirmed by sequencing. The GFP cassette was then excised from the TOPO vector using XbaI and cloned into the vector containing the pyr4 flanking sequences and the previously cloned amdS marker, using the same restriction sites. The -pyr4-amdS-hrGFP construct was introduced into protoplasts of the parent strain (29-9) using PEG transformation as described by Penttila et al. under conditions when acetamide was the sole nitrogen source [19]. The pyr4(−) variant was obtained by selection on FOA plates as described by Boeke et al. [1]. The resulting transformants were serially transferred onto new plates with Vogel’s agar to check for stable morphology. The expression of GFP in stable transformants was confirmed by growing germlings in 250 ml shake flasks containing 0.2% (vol/vol) lactose, and visualizing mycelia using fluorescence microscopy. A strain that expressed GFP (GFP-18) was chosen, and maintained on potato dextrose agar (PDA) plates for all subsequent experiments. 2.2. Correlation between GFP and glucoamylase Mutagenized spores (see Section 2.3 below) from a PDA plate of strain GFP were harvested and cultured overnight in glycine minimal medium containing 5% glucose–sophorose. Strains were passed through a 40 M mesh and randomly sorted using a forward versus side scatter gate (no GFP selection) into individual wells of twenty 96-well microtiter plates. After culturing for 6 days at 28 ◦ C, the microtiter plates were analysed for GFP expression on a microtiter plate reader (Molecular Devices, Sunnyvale, CA), with 485 nm excitation and 525 nm emission. Glucoamylase activity was measured on culture supernatants from the wells of the same plates using an assay based on the ability of GA to catalyze the hydrolysis of p-nitrophenyl-alpha-d-glucopyranoside (pNPG) to glucose and p-nitrophenol. At an alkaline pH, the nitrophenol forms a yellow colour that is proportional to glucoamylase activity and is monitored at 405 nm and compared against an enzyme standard measured as a GAU [6]. Briefly, 50 L of culture supernatants were combined with 50 L of a solution of 0.1 M sodium acetate, pH 4.3 containing 1.1 mg/mL of pNPG in microtiter plate wells and allowed to react for 5 min at room temperature. An equal volume of sodium borate (0.1 M, pH 9.2) was added and the plates were assayed for GA levels by measuring endpoint absorbance at 405 nm on a microtiter plate reader (SpectraMax M2, Molecular Devices, Sunnyvale, CA). Levels of GFP and GA for approximately 1900 strains were correlated using the pairwise correlation function in JMP statistical software (SAS Institute Inc.), which returns the Pearson product–moment correlation coefficient between two arrays of data.
343
2.3. FACS screening Prior to the first round of sorting, spores (∼5 × 108 ) from a PDA plate of strain 29-9 were suspended into 40 mL of sterile deionized water. The volume was split into two 100 mm Petri dishes and placed on a magnetic stirrer inside a Stratalinker 1800 UV Crosslinker (Stratagene, La Jolla, CA). The two 20 mL volumes of spores were irradiated while stirring with 50,000 and 100,000 J of 254 nm light, respectively, for 30 s. The aliquots were recombined and a small volume was used for serial dilutions onto PDA plates to determine the kill percentage (ca. 90%). The remaining spores were plated on several 150 mm (diameter) PDA plates and allowed to resporulate for 7–10 days. Spores were harvested and inoculated into liquid minimal medium containing 5% (w/v) glucose–sophorose and incubated at 28 ◦ C with vigorous shaking overnight (14–16 h) [7]. High-speed sorting was performed on a MoFlo sorter at an event rate of 15,000 events per second, at 60 psi with a 70 m nozzle. The germlings with the brightest (top 0.01%) GFP signal were sorted into individual wells of ten 96-well microtiter plates. After culturing for 6 days at 28 ◦ C, the 10 plates from the FACS screen were analysed for glucoamylase activity as described in Section 2.1. The top 10 strains from the 96-well plates in each round were replated on PDA, allowed to conidiate, and cultured as described above but for 96 h in 24-well plates (Falcon, BD Biosciences, San Jose, CA), containing 1 mL of medium per well. The top 3 strains from 24-well microtitre plate cultures, plus parent, were cultured in 250 mL shake flasks in 50 mL media while shaking at 28 ◦ C for 96 h. The top strain (GA18-9) from this round was subjected to mutagenesis with N-methyl-N -nitro-Nnitrosoguanidine (NTG; Sigma–Aldrich, St. Louis, MO). For NTG mutagenesis, spores (∼5 × 108 ) from a PDA plate were suspended in glycine minimal medium containing 1.6% glucose–sophorose, 10 g/mL NTG and placed in an incubator for 1.5 h at 28 ◦ C with shaking at 250 rpm. Spores were washed 3× in phosphate buffered saline (PBS). Spores were resuspended in a small volume of PBS and an aliquot of mutated spores was used to determine kill percentage by dilution plating (ca. 95%), while the rest was spread onto several 150 mm (diameter) PDA plates, harvested after 7–10 days, cultured and sorted as described above. A final round of sorting was performed on the best from the round of NTG mutagenesis screening, strain GA18-9-1, using the same conditions except that no mutagenesis was performed. 2.4. Comparative genome hybridization Genomic DNA from strains in this study was prepared from mycelia grown 24 h in YEG medium (5 g yeast extract, 20 g glucose per 1 L water). Mycelia were washed in deionized water, pelleted, frozen in liquid nitrogen and ground by mortar and pestle with 5 g of clean sand. The lysed pellets were extracted for DNA using the Easy-DNA Kit (Invitrogen). DNA was further purified by caesium chloride centrifugation. Briefly, the DNA from the Easy-DNA Kit was resuspended in 5 mL of deionized water, to which was added 5.2 g CsCl and 200 L of 200 mg/mL ethidium bromide. The samples were centrifuged at 448,800 × g (70,000 rpm) in an ultracentrifuge with a Sorvall T1270 rotor for 20 h at 4 ◦ C. The DNA band was extracted by pipetting while visualizing under UV light and suspended in 10 mL deionized water. One millilitre of 3 M KOAc was added followed by 20 mL cold ethanol. This was pelleted at 27,000 × g (13,000 rpm) in a Sorvall SLA-600TC rotor for 30 min at 4 ◦ C. The pellet was washed in 70% ethanol, resuspended in 1 mL diH2 O and 100 mL 3 M KOAc and 700 mL isopropanol was added. The DNA was pelleted and resuspended in 200 mL TE pH 8.0 (10 mM Tris, 1 mM EDTA). A nanodrop spectrophotometer (ThermoFisher Scientific, Waltham, MA) revealed 260/280 nm values > 1.9, and 260/230 nm values > 2.25 for all samples, which exceeded quality requirements for comparative genome hybridization. T. reesei genome arrays were designed and built by Roche NimbleGen Inc. (Madison, WI) based on the public genome sequence of T. reesei QM6a (US Department of Energy Joint Genome Institute) [9,17]. Single 385K feature arrays using 50–75 mer oligonucleotides were used with oligos spaced across the genome. The median gap between oligo start points was 85 nucleotides, providing 20 Mb of coverage for the 34 Mb T. reesei (QM6a) genome. Test and reference gDNAs were independently labelled with fluorescent dyes (Cy3 and Cy5, respectively), cohybridized to a NimbleGen 385K Whole-Genome Tiling array, and scanned using a 5 M scanner. Genomic DNA from strain 29-9 (reference) was compared to GFP18 (test). GFP-18 (reference) was compared to R3-14 (test). Log2-ratio values of the probe signal intensities (Cy3/Cy5) were calculated and plotted versus genomic position using Roche NimbleGen NimbleScan software. Data were displayed in Roche NimbleGen SignalMap software. The T. reesei (QM6a) sequence is arranged on 89 scaffolds (sets of ordered and oriented contigs) and is annotated on the Joint Genomes Institute (JGI) Website of the Department of Energy [9,17]. Segments of the comparative genome arrays with evident deletions or insertions were analysed using the BROWSE feature on the JGI website and individual genes were queried from the manually curated ExonGene catalog on the same website. 2.5. Deletion of pyr4-amdS-hrGFP The deletion vector amdS-hrGFP@pyr4 was constructed from three DNA fragments. PCR was used to amplify a ∼1 kb region of genomic DNA from the 5 (upstream) region of the pyr4 gene of T. reesei using the forward primer (including an AsiSI restriction site; bold) 5 GTGTGCGATCGCTCCGCGAATGCTGGGTGCTATT3 and the reverse primer (including an XbaI site; bold) 5 CTTCTCTAGACCTCCCCTCCCTTCTCCTCCTATC3 . The PCR amplification conditions consisted of an initial denat-
344
W. Throndset et al. / Enzyme and Microbial Technology 47 (2010) 342–347
Fig. 1. Targeted insertion and subsequent deletion of GFP. The pyr4-amdS-hrgfp integration vector construct was targeted to the native pyr4 locus with ∼1 kb of 5 and 3 regions of homology (flank) to the up- and downsream regions of the pyr4 gene. In a small percentage of transformants, homologous recombination resulted in insertion of the amdS and gfp genes at the pyr4 locus and deletion of the native pyr4 gene (A). Strains expressed green fluorescence when grown on lactose plates, were able to utilise acetimide and were uridine auxotrophs. For deletion of gfp after screening, a vector containing the 5 and 3 flanking regions from pyr4 and the acetolactate synthase (als) gene was used for homologous recombination, resulting in chlorimuron ethyl resistant strains no longer able to utilise acetimide as a nitrogen source, and lacking green fluorescence (B). The final step is isolation of strain that has spontaneously looped out the als marker via the pyr4 repeat sequence on the GFP deletion vector. uration step at 94 ◦ C for 30 s, followed by 29 cycles of denaturation at 94 ◦ C for 30 s, annealing at 59 ◦ C for 30 s, and extension at 72 ◦ C for 30 s, and ending with a final extension at 72 ◦ C for 5 min. The resulting PCR fragment of 1048 bp was purified using a PCR purification kit (Qiagen). A vector, containing the acetolactate synthase (als) gene from T. reesei as a selectable marker [3], based in the Puc19 plasmid, was transformed into E. coli Top 10 competent cells (Invitrogen). Plasmid DNA was digested with AsiSI, PCR column purified, then digested with AscI and DraI. A 4104 bp band was gel purified as above. The pyr4-amdS-hrGFP vector in Puc19 was cloned into Topo Blunt II (Invitrogen), plasmid DNA from a resulting clone of pyr4-amdS-hrGFP was digested with both XbaI and AsiSI and a 7088 bp band was gel purified. After dephosphorylating this fragment using shrimp alkaline phosphatise (SAP; Roche, Mannheim, Germany), a two-step ligation was performed. First the 7 kb fragment of the pyr4-amdS-hrGFP vector was ligated to the 1 kb flanking region of pyr4. Restriction enzyme digestion with EcoRI confirmed the correct ligation. Plasmid DNA from Top 10 cells containing the ligation was digested with AscI and AsiSI and a 7 kb fragment was PCR column purified as above. This 7 kb fragment was again dephosphorylated with SAP followed by ligation to the 4.1 kb als fragment, resulting in the deletion vector amdS-hrGFP@pyr4. A schematic
of transformation of strain 29-9 with pyr4-amdS-hrGFP to create strain GFP-18, followed by curing R3-14 with amdS-hrGFP@pyr4, and its subsequent loop-out is shown in Fig. 1.
3. Results 3.1. Correlation between GFP and glucoamylase Individual germinating spores from strain GFP-18 were randomly sorted after mutagenesis and overnight culture in liquid medium into twenty 96-well microtiter plates by drawing a large sort region around the entire population of germlings on a forward versus side scatter bivariate plot. After culture of the plates, levels of GFP and GA for all colonies were measured and then correlated using the Pearson product–moment (pairwise correlations) in JMP statistical software (SAS Institute Inc., Cary, NC) (Fig. 2). A large positive correlation (r = 0.54, p = .0001, 95% CI 0.50–0.57) was shown between GFP expression and GA secretion. This result confirmed that sorting based on high GFP expression enriches the population of sorted strains for variants with increased ability to secrete glucoamylase. 3.2. Screening
Fig. 2. Correlation of GFP expression and GA activity in ca. 1900 strains of Trichoderma reesei. Individual germinating spores were sorted into wells of twenty 96-well microtiter plates and cultured for 6 days at 28 ◦ C. GFP expression and GA activity were measured from each strain (black dots) and plotted against each other. The Pearson product–moment correlation coefficient was calculated between the two arrays of data (r = 0.54). The center black line is the linear curve fit, and the dotted lines are drawn at 95% confidence levels. The cluster of dots between the orgin and 500 units (X&Y) represent empty wells, and were not included in the calculation of the correlation coefficient.
UV mutagenised spores of strain GFP-18 were germinated in glycine minimal medium containing 5% glucose–sophorose medium and subjected to flow cytometric screening after 14 h. Individual germlings were sorted into microtiter plate wells and after colony development were analysed for GFP expression and GA activity using a plate scanning fluorimeter. Fig. 3 shows the rank order plot of colonies based upon relative GA activity following flow cytometric sorting and culture. After the first round of screening, a strain (GA18-9) was isolated that showed approximately 50% more GA activity than the parent strain in shake flasks (Fig. 4), but no improvement in 14L fedbatch fermentation (data not shown). GA18-9 was subjected to NTG mutagenesis and re-screened, resulting in strain GA18-9-1. Strain GA18-9-1 was resorted and screened in microtiter plates
W. Throndset et al. / Enzyme and Microbial Technology 47 (2010) 342–347
Fig. 3. Glucoamylase activity of sorted strains cultured in microtiter plates. Approximately 960 sorted strains were cultured for 6 days at 28 ◦ C and glucoamylase activity was compared. Each circle represents the glucoamylase activity of culture broth of a 6-day culture of a colony originating from a single germinating spore FACS-sorted on the basis of high GFP expression. The top 40 strains from this plot were cultured in 24-well plates, and the top 5 producers from these plates in 250 mL shake-flasks to determine which strain would be begin the next round of sorting.
345
Fig. 5. Glucoamylase activity in concentrated fermentation broth. The parent strain (gray; GFP-18) was compared to the round 2 and 3 winners (GA18-9-1; vertical stripes, and R3-14; diagonal stripes). Culture broth from the end of production phase (203h) in 14L fed-batch fermentations was compared for glucoamylase activity using pNPG.
Fig. 6. Specific production of glucoamylase by FACS-screened strains in 14L fermentation. The unscreened control (parent strain GFP-18) was compared to round 2 and 3 winners GA18-9-1 and R3-14 for specific production rate (MU of glucoamylase per kilogram dry weight per hour). Strain R3-14 demonstrated an increase of 70% compared to the unscreened control strain.
3.3. Comparative genome hybridization
Fig. 4. Comparison of the top strain from round 1 versus control. The top strain from round one (GA18-9) was compared to the parent strain GFP-18 (control) after culturing for 96 h at 28 ◦ C while shaking in glycine minimal medium containing 1.6% (v/v) glucose–sophorose. Culture supernatants were subjected to analysis for GA activity using pNPG.
and shake flasks resulting in strain R3-14. Strains GFP-18, GA189-1 and R3-14 were compared in 14L fed batch fermentations with a glucose–sophorose feed [7,8]. Fig. 5 shows enzymatic activity of concentrated fermentation broth, while specific productivity is compared in Fig. 6. Strain R3-14 showed a 34% improvement of enzyme activity of concentrated fermentation broth compared to strain GFP-18. Specific productivity by strain R3-14 was also more efficient; the strain produced 70% more glucoamylase activity units per kilogram dry weight per hour than GFP-18.
Genomic DNA from strain 29-9 (reference) was compared to GFP-18 (test) and showed changes associated with insertion of pyr4-amdS-hrGFP. GFP-18 (reference) was compared to R3-14 (test). Duplications occurred on scaffold 13, 2, 33, and 38 (Fig. 7). The duplications on scaffolds 13, 2, 33 and 38 totalled more than 750 kbp, and were comprised of 186 putative ORFs. The duplication on scaffold 13 was the largest of the set, approximately 390 kbp, with 101 ORFs. On scaffold 2, a duplication of approximately 55 kbp contained 19 ORFs. Two duplications on scaffold 33 totalled 194 kbp and 57 ORFs. A duplication from position ∼5800 to ∼94,500 was followed by ∼5 kb of non-duplicated DNA, followed by a second duplication from position ∼101,000 to ∼204,500. There is a possibility that these duplications are actually contiguous, with intervening sequence similar to another section of DNA elsewhere in the genome. A similar pattern emerged on scaffold 38, which had three duplications totalling 109 kbp but only 9 ORFs. An 8 kb duplication spanned from position ∼3000 to ∼11,500, followed by
Fig. 7. Rainbow plot of Trichoderma reesei scaffolds 1-89. Comparative genomic hybridization between GFP-18 and R3-14 shows duplicated regions on scaffolds 13, 2, 33, and 38 of strain R3-14. The entire 384k feature array spanning the 33 Mbp genome of T. reesei is shown with scaffolds labeled on top and duplications on bottom.
346
W. Throndset et al. / Enzyme and Microbial Technology 47 (2010) 342–347
Table 1 Duplications in strain R3-14. Scaffold number
Approximate size of duplication(s) (bp)
Number of putative ORFs
13 2 33 38
393,000 55,000 194,000 109,000
101 19 57 9
a ∼5 kb non-duplicated region, followed by a second duplication of ∼3 kb, followed by a non-duplicated region of ∼6.5 kb and then the third and largest duplication from position ∼26,500 to ∼123,675, roughly 97 kbp (Table 1). Table 2 lists a selection of the putative genes, their protein ID, the BLOSUM62 score and Best Hit species. A complete list of genetic changes can be seen in the Supplementary material. Eleven of the putative genes contained in the duplications are putative carbohydrate hydrolysing enzymes, including an ␣-glucanase, endo- and exo--glucanases, ␣- and -glucosidases, xylanase, an ␣-mannanase, and two polygalacturonases. 4. Discussion During the past 10 years United States production of bioethanol has increased more than sixfold from 5.3 to 34 billion litres [14]. Increased demand for fuel ethanol has in turn driven demand for biomass hydrolysing enzymes including glucoamylase. For enzyme producers, several options exist for meeting the needs of increased enzyme demand. The first is to increase capacity by building additional plants. The second is to discover or invent an enzyme product with higher specific activity so that less enzyme can be used to accomplish equivalent end-product formation. Finally, the host organism can be genetically altered to produce more enzyme per unit of volume, i.e. increased volumetric productivity. In fact, for industrial enzyme producing companies to meet current demands all three approaches combined are often needed. The work described in this study addresses the latter two aspects, using an enzyme with higher specific activity, and improving the production host. The native glucoamylase from T. reesei performs with approximately 2-fold higher specific activity than Aspergillus niger glucoamylase [2]. To increase volumetric productivity of GLA1 we performed whole cell mutagenesis and screening using highspeed fluorescence activated cell sorting based on GFP expression driven by the cbh1 promoter, in a strain created to produce GLA1 driven by a separate copy of the cbh1 promoter. Prior to the screen, a positive correlation was established between GFP expression and glucoamylase secretion. Germinating spores with high GFP expression were sorted and yielded a population containing individual strains with improved ability to secrete glucoamylase. For example, after a single round of screening, a strain (GFP-18-9) was isolated
that produced 50% more glucoamylase activity in shake flasks. After additional mutagenesis and screening, a strain (R3-14) was isolated that produced 70% higher specific productivity in a 14L fed-batch fermenter than the parent did. This strain was characterized by comparative genomic hybridization to determine if any underlying deletions or insertions could be discerned when compared to the parent strain GFP-18. In total, 186 putative ORFs were duplicated in strain R3-14 when compared to the parent strain. Such a large number of changes make attribution of the characteristic of improved specific productivity to a particular mutation or mutations exceptionally difficult. Nonetheless, it would be tempting to speculate that the duplication of several sugar transporters, carbohydrate hydrolysing enzymes and transcription factors might be responsible for improvement of specific production of glucoamylase in this strain. In a previous study, we showed that a strain with improved ability to hydrolyse biomass could be isolated in a similar screen [22]. The present study differed from the previous to the extent that we were seeking to target improved secretion of a single native protein, Trichoderma glucoamylase. The major cellulases and endoglucanases had been deleted from the strain prior to beginning the screening process, yielding a starting strain with relatively low levels of so-called “side activities.” The strain was already capable of producing high levels of GLA1, so further improvement, to the degree we observed, was somewhat unexpected. Strain R3-14 differed from other strains characterized by CGH after mutagenesis and screening. Mutations in other strains we characterized by CGH were predominantly deletions (data not shown), whereas in R3-14 over 750 kbp of DNA was duplicated. This may be due in part the method of isolation of strains, by sorting for high GFP expression. Additional gene products may be needed for strains to increase levels of enzyme production that are already very high. The GLA1 enzyme product is obtained by concentrating fermentation broth and results in an enzyme mixture comprised mostly of GLA1 but also contains enzymes with other activities, which may contribute to starch hydrolysis and be detected in the pNPG assay. However, the background pNPG activity of the parent strain is quite low, so changes resulting in higher GA activity are more likely specifically due to upregulation of activity on the cbh1 promoter. Our CHG analysis confirmed that strain R3-14 is deleted for the 85 kb (29 gene-encoding) region on scaffold 15 identified by Siedl et al. in strain RutC30 and RutNG14, the common ancestor between RutC30 and our isolate R3-14 [20]. This 85 kb deletion and the approximately 750 kb of duplicated sequence we identified here, taken together with previous discoveries related to extensive changes in genome alteration of industrially relevant fungi, reaffirms the remarkably immense tolerance filamentous fungi demonstrate for genetic rearrangement [4,16]. We have established that a positive correlation exists between an intracellular reporter protein and a secreted enzyme, when
Table 2 Select putative duplications identified in strain R3-14 using a NimbleGen array. Protein ID
Gene (Best Hit)
Score
Best Hit Species
63978 108671 108672 63966 64322 122511 108776 112124 112140 70186 82227 82235 112392
Fungal transcriptional regulatory protein, N-term -glycosidase , GH Fam 3-like Mutanase, ␣-1,3-glucanase; two C-terminal CBM24 modules, GH Fam 71 Sugar transporter Transport protein particle [TRAPP] componenet, Bet3 O-glycosyl hydrolase Endo -1,3-glucanase, GH Fam 55 Exo--1,3-glucanase Exo-polyglacturonase Polyglacturonase GH Fam 28 Cel3c ␣-glucosidase Endo-1,4--xylanase 1 precursor (Xyn1), candidate chitinase GH Fam 18
1390 1036 2103 1855 892 869 3515 388 1157 1116 4330 3018 555
Magnaporthe grisea 7–15 Flavobacterium johnsoniae Trichoderma asperellum Gibberella zeae PH-1 Gibberella zeae PH-1 Gibberella zeae PH-1 Hypocrea virens Aspergillus fumigatus Af293 Fusarium oxysporum f. sp. radicis-lycopersici Aspergillus oryzae Hypocrea jecorina Acremonium implicatum Hypocrea jecorina
W. Throndset et al. / Enzyme and Microbial Technology 47 (2010) 342–347
expressed under control of separate copies of the same promoter. Sorting germinating spores based on GFP expression enables rapid isolation of a large number of potentially improved strains, which can be grown in a microtiter plate format and analysed in secondary screens for enzyme production. This technology could be applied to many enzymes, in Trichoderma and other species of filamentous fungi, using the cellobiohydrolase I promoter or others, for native or heterologous gene products. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.enzmictec.2010.09.005. References [1] Boeke JD, LaCroute F, Fink GR. A positive selection for mutants lacking orotidine-5’-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance. Mol Gen Genet 1984;197(345-L 346). [2] Bott R, Saldajeno M, Cuevas W, Ward D, Scheffers M, Aehle W, et al. Threedimensional structure of an intact glycoside hydrolase family 15 glucoamylase from Hypocrea jecorina. Biochemistry 2008;47:5746–54. [3] Bower BS, Dunn-Coleman N, Leiva N. Acetolactate synthase (ALS) selectable marker from Trichoderma reesei World Intellectual Property Organization. Danisco US Inc., Genencor Division, International Bureau; 2008. [4] Carter GL, Allison D, Rey MW, Dunn-Coleman NS. Chromosomal genetic analysis of the electrophoretic karyotype of Trichoderma reesei: mapping of the cellulase and xylanase genes. Mol Microbiol 1992;6:2167–74. [5] Dunn-Coleman N, Neefe-Kruithof P, Pilgrim CE, Van Solingen P, Ward M. Trichoderma reesei glucoamylase and homologs thereof United States Patent Office. Palo Alto, CA, USA: Genencor International Inc.; 2009. [6] Elder MT, Montgomery RS. Glucoamylase activity in industrial enzyme preparations using colorimetric enzymatic method: collaborative study. J AOAC Int 1995;78:398–401. [7] England GR. Induction of gene expression using a high concentration sugar mixture United States Patent Application Publication. Genencor, International, USA; 2004, p 19.
347
[8] Foreman PK, Brown D, Dankmeyer L, Dean R, Diener S, Dunn-Coleman NS, et al. Transcriptional regulation of biomass-degrading enzymes in the filamentous fungus Trichoderma reesei. J Biol Chem 2003;278:31988–97. [9] http://www.jgi.doe.gov/. [10] Joutsjoki VV. Construction by one-step gene replacement of Trichoderma reesei strains that produce the glucoamylase P of Hormoconis resinae. Curr Genet 1994;26:422–9. [11] Karhunen T, Mantyla A, Nevalainen KM, Suominen PL. High frequency one-step gene replacement in Trichoderma reesei. I. Endoglucanase I overproduction. Mol Gen Genet 1993;241:515–22. [12] Kelly JM, Hynes MJ. Transformation of Aspergillus niger by the amdS gene of Aspergillus nidulans. EMBO J 1985;4:475–9. [13] Kubicek CP. Royal Society of Chemistry (Great Britain): Trichoderma reesei cellulases: biochemistry, genetics, physiology and application. Cambridge: Royal Society of Chemistry; 1990. p. 200–10. [14] Licht F. Changing the climate: Ethanol Industry Outlook 2008. Washington, DC: Renewable Fuels Association; 2008. [15] Mandels M, Weber J, Parizek R. Enhanced cellulase production by a mutant of Trichoderma viride. Appl Microbiol 1971;21:152–4. [16] Mantyla AL, Rossi KH, Vanhanen SA, Penttila ME, Suominen PL, Nevalainen KM. Electrophoretic karyotyping of wild-type and mutant Trichoderma longibrachiatum (reesei) strains. Curr Genet 1992;21:471–7. [17] Martinez D, Berka RM, Henrissat B, Saloheimo M, Arvas M, Baker SE, et al. Genome sequencing and analysis of the biomass-degrading fungus Trichoderma reesei (syn. Hypocrea jecorina). Nat Biotechnol 2008;26:553–60. [18] Montenecourt BS, Eveleigh DE. Preparation of mutants of Trichoderma reesei with enhanced cellulase production. Appl Environ Microbiol 1977;34:777–82. [19] Penttila M, Nevalainen H, Ratto M, Salminen E, Knowles J. A versatile transformation system for the cellulolytic filamentous fungus Trichoderma reesei. Gene 1987;61:155–64. [20] Seidl V, Gamauf C, Druzhinina IS, Seiboth B, Hartl L, Kubicek CP. The Hypocrea jecorina (Trichoderma reesei) hypercellulolytic mutant RUT C30 lacks a 85 kb (29 gene-encoding) region of the wild-type genome. BMC Genomics 2008;9:327. [21] Throndset W, Kim S, Bower B. Strain improvement of Trichoderma using green fluorescent protein and fluorescence activated cell sorting. In: Dunlap J, Govers F, editors. Fungal Genetics. Asilomar, CA: Genetics Society of America; 2009. [22] Throndset W, Kim S, Bower B, Lantz S, Keleman B, Pepsin M, Chow N, Mitchinson C, Ward M. Flow cytometric sorting of the filamentous fungus Trichoderma reesei for improved strains. Enzyme Microb Technol 2010;47:335–41. [23] Uusitalo JM, Nevalainen KM, Harkki AM, Knowles JK, Penttila ME. Enzyme production by recombinant Trichoderma reesei strains. J Biotechnol 1991;17:35–49.
Contents lists available at ScienceDirect
Enzyme and Microbial Technology journal homepage: www.elsevier.com/locate/emt
Isolation of a strain of Trichoderma reesei with improved glucoamylase secretion by flow cytometric sorting William Throndset a,b,∗ , Ben Bower a , Rodante Caguiat a , Toby Baldwin a , Mick Ward a a b
Genencor, A Danisco Division, 925 Page Mill Road, Palo Alto, CA 94304, USA University of Manchester, Faculty of Life Sciences, Manchester, UK
a r t i c l e
i n f o
Article history: Received 5 May 2010 Received in revised form 3 September 2010 Accepted 6 September 2010 Keywords: Trichoderma reesei Flow cytometry Glucoamylase GFP Screening Biofuels High-speed sorting Fungi Comparative genome hybridization
a b s t r a c t A single copy of the Renilla reniformis green fluorescent protein (GFP) gene under control of the cellobiohydrolase I (cbh1) promoter was inserted into a strain of Trichoderma reesei at the pyr4 locus by homologous recombination. The parent strain contained two copies (a tandem repeat) of the native glucoamylase (GA) gene integrated at a different locus, and controlled by a separate copy of the cbh1 promoter. A large positive correlation (r = 0.54) was observed between GFP expression and GA activity in ∼1900 randomly mutagenised germlings cultured in microtiter plates. The GFP-expressing strain was randomly mutagenised and screened using fluorescence activated cell sorting. Single germinating spores expressing GFP under conditions of carbon catabolite repression were sorted into individual wells of ten 96-well microtiter plates, cultured for 6 days, and assayed for GA activity. The strain producing the highest titres of GA from each of three rounds was re-screened by FACS. A variant (R3-14) was isolated that produced about 35% more total protein at 70% greater specific productivity in 14L fed-batch fermentation. The genome of strain R3-14 was analysed using comparative genome hybridization and large duplications totalling more than 750 kbp were identified on scaffolds 13, 2, 33 and 38 comprising 189 open reading frames. These included several putative transcriptional regulators, carbohydrate hydrolysing enzymes, and sugar transporters. © 2010 Elsevier Inc. All rights reserved.
1. Introduction The soft-rot fungus Trichoderma reesei (Hypocrea jecorina) is widely used in industry because of its ability to secrete large quantities of hydrolytic enzymes. Higher-yielding strains were initially derived from the wild type strain QM6a by classical mutagenesis and screening [15,18]. These improved strains have been widely used for production of native cellulases, and further manipulated using recombinant DNA technology [19]. The cbh1 promoter (Pcbh1) has been used for targeted overproduction of both homologous and heterologous proteins [11,23]. A similar technique has been used to increase production of glucoamylase P of Hormoconis resinae in T. reesei [10]. The glucoamylase family of enzymes (␣-1,4-glucan glucohydrolases, E.C.3.2.1.3.) is starch hydrolyzing exo-acting carbohydrases produced by plants, bacteria, and fungi that catalyze the removal of successive glucose units from the non-reducing ends of starch molecules. They are widely used in a variety of applications requiring the hydrolysis of starch where complete degradation to glucose
∗ Corresponding author at: Genencor, A Danisco Division, 925 Page Mill Road, Palo Alto, CA 94304, USA. Tel.: +1 650 846 4035; fax: +1 650 621 8061. E-mail address: [email protected] (W. Throndset). 0141-0229/$ – see front matter © 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.enzmictec.2010.09.005
is required. Glucose produced by glucoamylases can be used to manufacture high-fructose corn syrup, crystallized, or used in fermentations to produce end-products such as citric acid, ascorbic acid, glutamic acid, and 1,3 propanediol, among others. Glucoamylases are also used in the production of ethanol for fuel and for personal consumption, and in the preparation of animal feeds as feed additives [5]. The structure for T. reesei (H. jecorina) glucoamylase has been determined in two crystal forms, including the catalytic domain (CD), the starch binding domain (SBD) and linker region [2]. The catalytic domain was found to be essentially identical to other glucoamylases while performance differences were hypothesised to be attributable to the amino acid side chains involved in the specific interaction between the CD, the linker, and the SBD [2]. We recently demonstrated the utility of using high speed cell sorting to isolate a strain of T. reesei with improved ability to hydrolyse biomass [22]. The screening procedure was based upon the observation that when GFP transcription is driven by the cbh1 promoter, expression of the molecule in fungal germlings is regulated in a carbon-dependent fashion [21]. In this study, our aim was to apply a strategy to improve the production of a single homologous protein (glucoamylase) by inserting a DNA construct containing Pcbh1, GFP, and a selectable marker (amdS) for utilisation of acetamide as the sole nitrogen source
W. Throndset et al. / Enzyme and Microbial Technology 47 (2010) 342–347
(pyr4-amdS-hrGFP) at a known locus (pyr4) in the genome to simplify subsequent removal by homologous recombination with a deletion vector containing a different selectable marker. The parent strain contained a tandem duplication of a DNA construct consisting of a copy of the cbh1 promoter attached to the native T. reesei glucoamylase (Pcbh1:gla1) integrated at a different (random) locus than the GFP construct. We hypothesised that a correlation between intracellular expression of GFP and secretion of GA might exist in a population of randomly mutated strains, which would enable enrichment by flow cytometric sorting based on GFP expression for strains with improved ability to secrete glucoamylase. 2. Materials and methods 2.1. Strain creation and culture conditions The T. reesei strain used in this study (29-9) was derived from RL-P37 (NRRL 15709) which had been deleted for the genes encoding the major exo and endoacting cellobiohydrolases CBHI (cel7a), CBHII (cel6a), EGI (cel7b) and EGII (cel5a) and transformed with a vector containing the cbh1 promoter driving the transcription of a tandem repeat of the native T. reesei glucoamylase gene (Pcbh1:gla1). The parent strain was transformed with a vector (pyr4-amdS-hrGFP) containing the humanised Renilla reniformis GFP gene (phrGFP; Stratagene, La Jolla, CA), and the amdS gene from Aspergillus nidulans (acetamide utilisation), resulting in strain GFP18 [12,13]. To create the vector, a fragment containing the amdS marker, and a second fragment containing the T. reesei cbh1 promoter (PcbhI), GFP, and the T. reesei cbh1I terminator (Tcbh1I), were ligated into a vector containing pyr4 5 and 3 flanking sequences. The amdS gene was excised from amdS-pCR Blunt TOPO using AscI and XbaI and ligated into a vector containing the pyr4 flanking sequences using the same restriction sites. The Pcbh1-gfp-Tcbh1 cassette was amplified from pTrex2g/hrGFP using the forward primer 5 GCGCTCTAGAGGGACTTTGATGGTCATC3 and the reverse primer 5 GCGCTCTAGAGCAAGCTTGAGATCCGTT3 . The PCR amplification conditions consisted of an initial denaturation step at 95 ◦ C for 2 min, followed by 32 cycles of denaturation at 94 ◦ C for 30 s, annealing at 60 ◦ C for 40 s, and extension at 72 ◦ C for 3 min. The reaction ended with a final extension step at 72 ◦ C for 10 min. The resulting PCR fragment of 2979 bp was purified using Qiagen’s PCR Purification Kit (Qiagen, Valencia, CA) and cloned into pCR-BLUNT II-TOPO (Invitrogen, Carlsbad, CA), and transformed into E. coli Top 10 competent cells (Invitrogen). The resulting clones were confirmed by sequencing. The GFP cassette was then excised from the TOPO vector using XbaI and cloned into the vector containing the pyr4 flanking sequences and the previously cloned amdS marker, using the same restriction sites. The -pyr4-amdS-hrGFP construct was introduced into protoplasts of the parent strain (29-9) using PEG transformation as described by Penttila et al. under conditions when acetamide was the sole nitrogen source [19]. The pyr4(−) variant was obtained by selection on FOA plates as described by Boeke et al. [1]. The resulting transformants were serially transferred onto new plates with Vogel’s agar to check for stable morphology. The expression of GFP in stable transformants was confirmed by growing germlings in 250 ml shake flasks containing 0.2% (vol/vol) lactose, and visualizing mycelia using fluorescence microscopy. A strain that expressed GFP (GFP-18) was chosen, and maintained on potato dextrose agar (PDA) plates for all subsequent experiments. 2.2. Correlation between GFP and glucoamylase Mutagenized spores (see Section 2.3 below) from a PDA plate of strain GFP were harvested and cultured overnight in glycine minimal medium containing 5% glucose–sophorose. Strains were passed through a 40 M mesh and randomly sorted using a forward versus side scatter gate (no GFP selection) into individual wells of twenty 96-well microtiter plates. After culturing for 6 days at 28 ◦ C, the microtiter plates were analysed for GFP expression on a microtiter plate reader (Molecular Devices, Sunnyvale, CA), with 485 nm excitation and 525 nm emission. Glucoamylase activity was measured on culture supernatants from the wells of the same plates using an assay based on the ability of GA to catalyze the hydrolysis of p-nitrophenyl-alpha-d-glucopyranoside (pNPG) to glucose and p-nitrophenol. At an alkaline pH, the nitrophenol forms a yellow colour that is proportional to glucoamylase activity and is monitored at 405 nm and compared against an enzyme standard measured as a GAU [6]. Briefly, 50 L of culture supernatants were combined with 50 L of a solution of 0.1 M sodium acetate, pH 4.3 containing 1.1 mg/mL of pNPG in microtiter plate wells and allowed to react for 5 min at room temperature. An equal volume of sodium borate (0.1 M, pH 9.2) was added and the plates were assayed for GA levels by measuring endpoint absorbance at 405 nm on a microtiter plate reader (SpectraMax M2, Molecular Devices, Sunnyvale, CA). Levels of GFP and GA for approximately 1900 strains were correlated using the pairwise correlation function in JMP statistical software (SAS Institute Inc.), which returns the Pearson product–moment correlation coefficient between two arrays of data.
343
2.3. FACS screening Prior to the first round of sorting, spores (∼5 × 108 ) from a PDA plate of strain 29-9 were suspended into 40 mL of sterile deionized water. The volume was split into two 100 mm Petri dishes and placed on a magnetic stirrer inside a Stratalinker 1800 UV Crosslinker (Stratagene, La Jolla, CA). The two 20 mL volumes of spores were irradiated while stirring with 50,000 and 100,000 J of 254 nm light, respectively, for 30 s. The aliquots were recombined and a small volume was used for serial dilutions onto PDA plates to determine the kill percentage (ca. 90%). The remaining spores were plated on several 150 mm (diameter) PDA plates and allowed to resporulate for 7–10 days. Spores were harvested and inoculated into liquid minimal medium containing 5% (w/v) glucose–sophorose and incubated at 28 ◦ C with vigorous shaking overnight (14–16 h) [7]. High-speed sorting was performed on a MoFlo sorter at an event rate of 15,000 events per second, at 60 psi with a 70 m nozzle. The germlings with the brightest (top 0.01%) GFP signal were sorted into individual wells of ten 96-well microtiter plates. After culturing for 6 days at 28 ◦ C, the 10 plates from the FACS screen were analysed for glucoamylase activity as described in Section 2.1. The top 10 strains from the 96-well plates in each round were replated on PDA, allowed to conidiate, and cultured as described above but for 96 h in 24-well plates (Falcon, BD Biosciences, San Jose, CA), containing 1 mL of medium per well. The top 3 strains from 24-well microtitre plate cultures, plus parent, were cultured in 250 mL shake flasks in 50 mL media while shaking at 28 ◦ C for 96 h. The top strain (GA18-9) from this round was subjected to mutagenesis with N-methyl-N -nitro-Nnitrosoguanidine (NTG; Sigma–Aldrich, St. Louis, MO). For NTG mutagenesis, spores (∼5 × 108 ) from a PDA plate were suspended in glycine minimal medium containing 1.6% glucose–sophorose, 10 g/mL NTG and placed in an incubator for 1.5 h at 28 ◦ C with shaking at 250 rpm. Spores were washed 3× in phosphate buffered saline (PBS). Spores were resuspended in a small volume of PBS and an aliquot of mutated spores was used to determine kill percentage by dilution plating (ca. 95%), while the rest was spread onto several 150 mm (diameter) PDA plates, harvested after 7–10 days, cultured and sorted as described above. A final round of sorting was performed on the best from the round of NTG mutagenesis screening, strain GA18-9-1, using the same conditions except that no mutagenesis was performed. 2.4. Comparative genome hybridization Genomic DNA from strains in this study was prepared from mycelia grown 24 h in YEG medium (5 g yeast extract, 20 g glucose per 1 L water). Mycelia were washed in deionized water, pelleted, frozen in liquid nitrogen and ground by mortar and pestle with 5 g of clean sand. The lysed pellets were extracted for DNA using the Easy-DNA Kit (Invitrogen). DNA was further purified by caesium chloride centrifugation. Briefly, the DNA from the Easy-DNA Kit was resuspended in 5 mL of deionized water, to which was added 5.2 g CsCl and 200 L of 200 mg/mL ethidium bromide. The samples were centrifuged at 448,800 × g (70,000 rpm) in an ultracentrifuge with a Sorvall T1270 rotor for 20 h at 4 ◦ C. The DNA band was extracted by pipetting while visualizing under UV light and suspended in 10 mL deionized water. One millilitre of 3 M KOAc was added followed by 20 mL cold ethanol. This was pelleted at 27,000 × g (13,000 rpm) in a Sorvall SLA-600TC rotor for 30 min at 4 ◦ C. The pellet was washed in 70% ethanol, resuspended in 1 mL diH2 O and 100 mL 3 M KOAc and 700 mL isopropanol was added. The DNA was pelleted and resuspended in 200 mL TE pH 8.0 (10 mM Tris, 1 mM EDTA). A nanodrop spectrophotometer (ThermoFisher Scientific, Waltham, MA) revealed 260/280 nm values > 1.9, and 260/230 nm values > 2.25 for all samples, which exceeded quality requirements for comparative genome hybridization. T. reesei genome arrays were designed and built by Roche NimbleGen Inc. (Madison, WI) based on the public genome sequence of T. reesei QM6a (US Department of Energy Joint Genome Institute) [9,17]. Single 385K feature arrays using 50–75 mer oligonucleotides were used with oligos spaced across the genome. The median gap between oligo start points was 85 nucleotides, providing 20 Mb of coverage for the 34 Mb T. reesei (QM6a) genome. Test and reference gDNAs were independently labelled with fluorescent dyes (Cy3 and Cy5, respectively), cohybridized to a NimbleGen 385K Whole-Genome Tiling array, and scanned using a 5 M scanner. Genomic DNA from strain 29-9 (reference) was compared to GFP18 (test). GFP-18 (reference) was compared to R3-14 (test). Log2-ratio values of the probe signal intensities (Cy3/Cy5) were calculated and plotted versus genomic position using Roche NimbleGen NimbleScan software. Data were displayed in Roche NimbleGen SignalMap software. The T. reesei (QM6a) sequence is arranged on 89 scaffolds (sets of ordered and oriented contigs) and is annotated on the Joint Genomes Institute (JGI) Website of the Department of Energy [9,17]. Segments of the comparative genome arrays with evident deletions or insertions were analysed using the BROWSE feature on the JGI website and individual genes were queried from the manually curated ExonGene catalog on the same website. 2.5. Deletion of pyr4-amdS-hrGFP The deletion vector amdS-hrGFP@pyr4 was constructed from three DNA fragments. PCR was used to amplify a ∼1 kb region of genomic DNA from the 5 (upstream) region of the pyr4 gene of T. reesei using the forward primer (including an AsiSI restriction site; bold) 5 GTGTGCGATCGCTCCGCGAATGCTGGGTGCTATT3 and the reverse primer (including an XbaI site; bold) 5 CTTCTCTAGACCTCCCCTCCCTTCTCCTCCTATC3 . The PCR amplification conditions consisted of an initial denat-
344
W. Throndset et al. / Enzyme and Microbial Technology 47 (2010) 342–347
Fig. 1. Targeted insertion and subsequent deletion of GFP. The pyr4-amdS-hrgfp integration vector construct was targeted to the native pyr4 locus with ∼1 kb of 5 and 3 regions of homology (flank) to the up- and downsream regions of the pyr4 gene. In a small percentage of transformants, homologous recombination resulted in insertion of the amdS and gfp genes at the pyr4 locus and deletion of the native pyr4 gene (A). Strains expressed green fluorescence when grown on lactose plates, were able to utilise acetimide and were uridine auxotrophs. For deletion of gfp after screening, a vector containing the 5 and 3 flanking regions from pyr4 and the acetolactate synthase (als) gene was used for homologous recombination, resulting in chlorimuron ethyl resistant strains no longer able to utilise acetimide as a nitrogen source, and lacking green fluorescence (B). The final step is isolation of strain that has spontaneously looped out the als marker via the pyr4 repeat sequence on the GFP deletion vector. uration step at 94 ◦ C for 30 s, followed by 29 cycles of denaturation at 94 ◦ C for 30 s, annealing at 59 ◦ C for 30 s, and extension at 72 ◦ C for 30 s, and ending with a final extension at 72 ◦ C for 5 min. The resulting PCR fragment of 1048 bp was purified using a PCR purification kit (Qiagen). A vector, containing the acetolactate synthase (als) gene from T. reesei as a selectable marker [3], based in the Puc19 plasmid, was transformed into E. coli Top 10 competent cells (Invitrogen). Plasmid DNA was digested with AsiSI, PCR column purified, then digested with AscI and DraI. A 4104 bp band was gel purified as above. The pyr4-amdS-hrGFP vector in Puc19 was cloned into Topo Blunt II (Invitrogen), plasmid DNA from a resulting clone of pyr4-amdS-hrGFP was digested with both XbaI and AsiSI and a 7088 bp band was gel purified. After dephosphorylating this fragment using shrimp alkaline phosphatise (SAP; Roche, Mannheim, Germany), a two-step ligation was performed. First the 7 kb fragment of the pyr4-amdS-hrGFP vector was ligated to the 1 kb flanking region of pyr4. Restriction enzyme digestion with EcoRI confirmed the correct ligation. Plasmid DNA from Top 10 cells containing the ligation was digested with AscI and AsiSI and a 7 kb fragment was PCR column purified as above. This 7 kb fragment was again dephosphorylated with SAP followed by ligation to the 4.1 kb als fragment, resulting in the deletion vector amdS-hrGFP@pyr4. A schematic
of transformation of strain 29-9 with pyr4-amdS-hrGFP to create strain GFP-18, followed by curing R3-14 with amdS-hrGFP@pyr4, and its subsequent loop-out is shown in Fig. 1.
3. Results 3.1. Correlation between GFP and glucoamylase Individual germinating spores from strain GFP-18 were randomly sorted after mutagenesis and overnight culture in liquid medium into twenty 96-well microtiter plates by drawing a large sort region around the entire population of germlings on a forward versus side scatter bivariate plot. After culture of the plates, levels of GFP and GA for all colonies were measured and then correlated using the Pearson product–moment (pairwise correlations) in JMP statistical software (SAS Institute Inc., Cary, NC) (Fig. 2). A large positive correlation (r = 0.54, p = .0001, 95% CI 0.50–0.57) was shown between GFP expression and GA secretion. This result confirmed that sorting based on high GFP expression enriches the population of sorted strains for variants with increased ability to secrete glucoamylase. 3.2. Screening
Fig. 2. Correlation of GFP expression and GA activity in ca. 1900 strains of Trichoderma reesei. Individual germinating spores were sorted into wells of twenty 96-well microtiter plates and cultured for 6 days at 28 ◦ C. GFP expression and GA activity were measured from each strain (black dots) and plotted against each other. The Pearson product–moment correlation coefficient was calculated between the two arrays of data (r = 0.54). The center black line is the linear curve fit, and the dotted lines are drawn at 95% confidence levels. The cluster of dots between the orgin and 500 units (X&Y) represent empty wells, and were not included in the calculation of the correlation coefficient.
UV mutagenised spores of strain GFP-18 were germinated in glycine minimal medium containing 5% glucose–sophorose medium and subjected to flow cytometric screening after 14 h. Individual germlings were sorted into microtiter plate wells and after colony development were analysed for GFP expression and GA activity using a plate scanning fluorimeter. Fig. 3 shows the rank order plot of colonies based upon relative GA activity following flow cytometric sorting and culture. After the first round of screening, a strain (GA18-9) was isolated that showed approximately 50% more GA activity than the parent strain in shake flasks (Fig. 4), but no improvement in 14L fedbatch fermentation (data not shown). GA18-9 was subjected to NTG mutagenesis and re-screened, resulting in strain GA18-9-1. Strain GA18-9-1 was resorted and screened in microtiter plates
W. Throndset et al. / Enzyme and Microbial Technology 47 (2010) 342–347
Fig. 3. Glucoamylase activity of sorted strains cultured in microtiter plates. Approximately 960 sorted strains were cultured for 6 days at 28 ◦ C and glucoamylase activity was compared. Each circle represents the glucoamylase activity of culture broth of a 6-day culture of a colony originating from a single germinating spore FACS-sorted on the basis of high GFP expression. The top 40 strains from this plot were cultured in 24-well plates, and the top 5 producers from these plates in 250 mL shake-flasks to determine which strain would be begin the next round of sorting.
345
Fig. 5. Glucoamylase activity in concentrated fermentation broth. The parent strain (gray; GFP-18) was compared to the round 2 and 3 winners (GA18-9-1; vertical stripes, and R3-14; diagonal stripes). Culture broth from the end of production phase (203h) in 14L fed-batch fermentations was compared for glucoamylase activity using pNPG.
Fig. 6. Specific production of glucoamylase by FACS-screened strains in 14L fermentation. The unscreened control (parent strain GFP-18) was compared to round 2 and 3 winners GA18-9-1 and R3-14 for specific production rate (MU of glucoamylase per kilogram dry weight per hour). Strain R3-14 demonstrated an increase of 70% compared to the unscreened control strain.
3.3. Comparative genome hybridization
Fig. 4. Comparison of the top strain from round 1 versus control. The top strain from round one (GA18-9) was compared to the parent strain GFP-18 (control) after culturing for 96 h at 28 ◦ C while shaking in glycine minimal medium containing 1.6% (v/v) glucose–sophorose. Culture supernatants were subjected to analysis for GA activity using pNPG.
and shake flasks resulting in strain R3-14. Strains GFP-18, GA189-1 and R3-14 were compared in 14L fed batch fermentations with a glucose–sophorose feed [7,8]. Fig. 5 shows enzymatic activity of concentrated fermentation broth, while specific productivity is compared in Fig. 6. Strain R3-14 showed a 34% improvement of enzyme activity of concentrated fermentation broth compared to strain GFP-18. Specific productivity by strain R3-14 was also more efficient; the strain produced 70% more glucoamylase activity units per kilogram dry weight per hour than GFP-18.
Genomic DNA from strain 29-9 (reference) was compared to GFP-18 (test) and showed changes associated with insertion of pyr4-amdS-hrGFP. GFP-18 (reference) was compared to R3-14 (test). Duplications occurred on scaffold 13, 2, 33, and 38 (Fig. 7). The duplications on scaffolds 13, 2, 33 and 38 totalled more than 750 kbp, and were comprised of 186 putative ORFs. The duplication on scaffold 13 was the largest of the set, approximately 390 kbp, with 101 ORFs. On scaffold 2, a duplication of approximately 55 kbp contained 19 ORFs. Two duplications on scaffold 33 totalled 194 kbp and 57 ORFs. A duplication from position ∼5800 to ∼94,500 was followed by ∼5 kb of non-duplicated DNA, followed by a second duplication from position ∼101,000 to ∼204,500. There is a possibility that these duplications are actually contiguous, with intervening sequence similar to another section of DNA elsewhere in the genome. A similar pattern emerged on scaffold 38, which had three duplications totalling 109 kbp but only 9 ORFs. An 8 kb duplication spanned from position ∼3000 to ∼11,500, followed by
Fig. 7. Rainbow plot of Trichoderma reesei scaffolds 1-89. Comparative genomic hybridization between GFP-18 and R3-14 shows duplicated regions on scaffolds 13, 2, 33, and 38 of strain R3-14. The entire 384k feature array spanning the 33 Mbp genome of T. reesei is shown with scaffolds labeled on top and duplications on bottom.
346
W. Throndset et al. / Enzyme and Microbial Technology 47 (2010) 342–347
Table 1 Duplications in strain R3-14. Scaffold number
Approximate size of duplication(s) (bp)
Number of putative ORFs
13 2 33 38
393,000 55,000 194,000 109,000
101 19 57 9
a ∼5 kb non-duplicated region, followed by a second duplication of ∼3 kb, followed by a non-duplicated region of ∼6.5 kb and then the third and largest duplication from position ∼26,500 to ∼123,675, roughly 97 kbp (Table 1). Table 2 lists a selection of the putative genes, their protein ID, the BLOSUM62 score and Best Hit species. A complete list of genetic changes can be seen in the Supplementary material. Eleven of the putative genes contained in the duplications are putative carbohydrate hydrolysing enzymes, including an ␣-glucanase, endo- and exo--glucanases, ␣- and -glucosidases, xylanase, an ␣-mannanase, and two polygalacturonases. 4. Discussion During the past 10 years United States production of bioethanol has increased more than sixfold from 5.3 to 34 billion litres [14]. Increased demand for fuel ethanol has in turn driven demand for biomass hydrolysing enzymes including glucoamylase. For enzyme producers, several options exist for meeting the needs of increased enzyme demand. The first is to increase capacity by building additional plants. The second is to discover or invent an enzyme product with higher specific activity so that less enzyme can be used to accomplish equivalent end-product formation. Finally, the host organism can be genetically altered to produce more enzyme per unit of volume, i.e. increased volumetric productivity. In fact, for industrial enzyme producing companies to meet current demands all three approaches combined are often needed. The work described in this study addresses the latter two aspects, using an enzyme with higher specific activity, and improving the production host. The native glucoamylase from T. reesei performs with approximately 2-fold higher specific activity than Aspergillus niger glucoamylase [2]. To increase volumetric productivity of GLA1 we performed whole cell mutagenesis and screening using highspeed fluorescence activated cell sorting based on GFP expression driven by the cbh1 promoter, in a strain created to produce GLA1 driven by a separate copy of the cbh1 promoter. Prior to the screen, a positive correlation was established between GFP expression and glucoamylase secretion. Germinating spores with high GFP expression were sorted and yielded a population containing individual strains with improved ability to secrete glucoamylase. For example, after a single round of screening, a strain (GFP-18-9) was isolated
that produced 50% more glucoamylase activity in shake flasks. After additional mutagenesis and screening, a strain (R3-14) was isolated that produced 70% higher specific productivity in a 14L fed-batch fermenter than the parent did. This strain was characterized by comparative genomic hybridization to determine if any underlying deletions or insertions could be discerned when compared to the parent strain GFP-18. In total, 186 putative ORFs were duplicated in strain R3-14 when compared to the parent strain. Such a large number of changes make attribution of the characteristic of improved specific productivity to a particular mutation or mutations exceptionally difficult. Nonetheless, it would be tempting to speculate that the duplication of several sugar transporters, carbohydrate hydrolysing enzymes and transcription factors might be responsible for improvement of specific production of glucoamylase in this strain. In a previous study, we showed that a strain with improved ability to hydrolyse biomass could be isolated in a similar screen [22]. The present study differed from the previous to the extent that we were seeking to target improved secretion of a single native protein, Trichoderma glucoamylase. The major cellulases and endoglucanases had been deleted from the strain prior to beginning the screening process, yielding a starting strain with relatively low levels of so-called “side activities.” The strain was already capable of producing high levels of GLA1, so further improvement, to the degree we observed, was somewhat unexpected. Strain R3-14 differed from other strains characterized by CGH after mutagenesis and screening. Mutations in other strains we characterized by CGH were predominantly deletions (data not shown), whereas in R3-14 over 750 kbp of DNA was duplicated. This may be due in part the method of isolation of strains, by sorting for high GFP expression. Additional gene products may be needed for strains to increase levels of enzyme production that are already very high. The GLA1 enzyme product is obtained by concentrating fermentation broth and results in an enzyme mixture comprised mostly of GLA1 but also contains enzymes with other activities, which may contribute to starch hydrolysis and be detected in the pNPG assay. However, the background pNPG activity of the parent strain is quite low, so changes resulting in higher GA activity are more likely specifically due to upregulation of activity on the cbh1 promoter. Our CHG analysis confirmed that strain R3-14 is deleted for the 85 kb (29 gene-encoding) region on scaffold 15 identified by Siedl et al. in strain RutC30 and RutNG14, the common ancestor between RutC30 and our isolate R3-14 [20]. This 85 kb deletion and the approximately 750 kb of duplicated sequence we identified here, taken together with previous discoveries related to extensive changes in genome alteration of industrially relevant fungi, reaffirms the remarkably immense tolerance filamentous fungi demonstrate for genetic rearrangement [4,16]. We have established that a positive correlation exists between an intracellular reporter protein and a secreted enzyme, when
Table 2 Select putative duplications identified in strain R3-14 using a NimbleGen array. Protein ID
Gene (Best Hit)
Score
Best Hit Species
63978 108671 108672 63966 64322 122511 108776 112124 112140 70186 82227 82235 112392
Fungal transcriptional regulatory protein, N-term -glycosidase , GH Fam 3-like Mutanase, ␣-1,3-glucanase; two C-terminal CBM24 modules, GH Fam 71 Sugar transporter Transport protein particle [TRAPP] componenet, Bet3 O-glycosyl hydrolase Endo -1,3-glucanase, GH Fam 55 Exo--1,3-glucanase Exo-polyglacturonase Polyglacturonase GH Fam 28 Cel3c ␣-glucosidase Endo-1,4--xylanase 1 precursor (Xyn1), candidate chitinase GH Fam 18
1390 1036 2103 1855 892 869 3515 388 1157 1116 4330 3018 555
Magnaporthe grisea 7–15 Flavobacterium johnsoniae Trichoderma asperellum Gibberella zeae PH-1 Gibberella zeae PH-1 Gibberella zeae PH-1 Hypocrea virens Aspergillus fumigatus Af293 Fusarium oxysporum f. sp. radicis-lycopersici Aspergillus oryzae Hypocrea jecorina Acremonium implicatum Hypocrea jecorina
W. Throndset et al. / Enzyme and Microbial Technology 47 (2010) 342–347
expressed under control of separate copies of the same promoter. Sorting germinating spores based on GFP expression enables rapid isolation of a large number of potentially improved strains, which can be grown in a microtiter plate format and analysed in secondary screens for enzyme production. This technology could be applied to many enzymes, in Trichoderma and other species of filamentous fungi, using the cellobiohydrolase I promoter or others, for native or heterologous gene products. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.enzmictec.2010.09.005. References [1] Boeke JD, LaCroute F, Fink GR. A positive selection for mutants lacking orotidine-5’-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance. Mol Gen Genet 1984;197(345-L 346). [2] Bott R, Saldajeno M, Cuevas W, Ward D, Scheffers M, Aehle W, et al. Threedimensional structure of an intact glycoside hydrolase family 15 glucoamylase from Hypocrea jecorina. Biochemistry 2008;47:5746–54. [3] Bower BS, Dunn-Coleman N, Leiva N. Acetolactate synthase (ALS) selectable marker from Trichoderma reesei World Intellectual Property Organization. Danisco US Inc., Genencor Division, International Bureau; 2008. [4] Carter GL, Allison D, Rey MW, Dunn-Coleman NS. Chromosomal genetic analysis of the electrophoretic karyotype of Trichoderma reesei: mapping of the cellulase and xylanase genes. Mol Microbiol 1992;6:2167–74. [5] Dunn-Coleman N, Neefe-Kruithof P, Pilgrim CE, Van Solingen P, Ward M. Trichoderma reesei glucoamylase and homologs thereof United States Patent Office. Palo Alto, CA, USA: Genencor International Inc.; 2009. [6] Elder MT, Montgomery RS. Glucoamylase activity in industrial enzyme preparations using colorimetric enzymatic method: collaborative study. J AOAC Int 1995;78:398–401. [7] England GR. Induction of gene expression using a high concentration sugar mixture United States Patent Application Publication. Genencor, International, USA; 2004, p 19.
347
[8] Foreman PK, Brown D, Dankmeyer L, Dean R, Diener S, Dunn-Coleman NS, et al. Transcriptional regulation of biomass-degrading enzymes in the filamentous fungus Trichoderma reesei. J Biol Chem 2003;278:31988–97. [9] http://www.jgi.doe.gov/. [10] Joutsjoki VV. Construction by one-step gene replacement of Trichoderma reesei strains that produce the glucoamylase P of Hormoconis resinae. Curr Genet 1994;26:422–9. [11] Karhunen T, Mantyla A, Nevalainen KM, Suominen PL. High frequency one-step gene replacement in Trichoderma reesei. I. Endoglucanase I overproduction. Mol Gen Genet 1993;241:515–22. [12] Kelly JM, Hynes MJ. Transformation of Aspergillus niger by the amdS gene of Aspergillus nidulans. EMBO J 1985;4:475–9. [13] Kubicek CP. Royal Society of Chemistry (Great Britain): Trichoderma reesei cellulases: biochemistry, genetics, physiology and application. Cambridge: Royal Society of Chemistry; 1990. p. 200–10. [14] Licht F. Changing the climate: Ethanol Industry Outlook 2008. Washington, DC: Renewable Fuels Association; 2008. [15] Mandels M, Weber J, Parizek R. Enhanced cellulase production by a mutant of Trichoderma viride. Appl Microbiol 1971;21:152–4. [16] Mantyla AL, Rossi KH, Vanhanen SA, Penttila ME, Suominen PL, Nevalainen KM. Electrophoretic karyotyping of wild-type and mutant Trichoderma longibrachiatum (reesei) strains. Curr Genet 1992;21:471–7. [17] Martinez D, Berka RM, Henrissat B, Saloheimo M, Arvas M, Baker SE, et al. Genome sequencing and analysis of the biomass-degrading fungus Trichoderma reesei (syn. Hypocrea jecorina). Nat Biotechnol 2008;26:553–60. [18] Montenecourt BS, Eveleigh DE. Preparation of mutants of Trichoderma reesei with enhanced cellulase production. Appl Environ Microbiol 1977;34:777–82. [19] Penttila M, Nevalainen H, Ratto M, Salminen E, Knowles J. A versatile transformation system for the cellulolytic filamentous fungus Trichoderma reesei. Gene 1987;61:155–64. [20] Seidl V, Gamauf C, Druzhinina IS, Seiboth B, Hartl L, Kubicek CP. The Hypocrea jecorina (Trichoderma reesei) hypercellulolytic mutant RUT C30 lacks a 85 kb (29 gene-encoding) region of the wild-type genome. BMC Genomics 2008;9:327. [21] Throndset W, Kim S, Bower B. Strain improvement of Trichoderma using green fluorescent protein and fluorescence activated cell sorting. In: Dunlap J, Govers F, editors. Fungal Genetics. Asilomar, CA: Genetics Society of America; 2009. [22] Throndset W, Kim S, Bower B, Lantz S, Keleman B, Pepsin M, Chow N, Mitchinson C, Ward M. Flow cytometric sorting of the filamentous fungus Trichoderma reesei for improved strains. Enzyme Microb Technol 2010;47:335–41. [23] Uusitalo JM, Nevalainen KM, Harkki AM, Knowles JK, Penttila ME. Enzyme production by recombinant Trichoderma reesei strains. J Biotechnol 1991;17:35–49.