kidney-type alkaline phosphatase gene: Cell and tissue specific expression

Vol. 179, No. 3, 1991 September 30, 1991

BIOCHEMICAL

CHARACTERIZATION LIVER/BONE/KIDNEY-TYPE

AND BIOPHYSICAL RESEARCH COMMUNICATIONS Pages 1352-l 360

OF A SECOND PROMOTER FOR THE MOUSE ALKALINE PHOSPHATASE GENE: CELL AND TISSUE SPECIFIC EXPRESSION

Michela Studer, Mineko Terao, Maurizio Gianni and Enrico Garattin? Molecular Biology Unit, Centro Daniela e Catullo Borgomainerio, lstftuto di Ricerche Farmacologiche “Mario Negri” via Eritrea 62, 20157 Milano, Italy

Received

July

29,

1991

The second leader exon and the relative promoter of the mouse liver/bone/kidney-type alkaline phosphatase gene were identified and characterized. The transcription initiation site was determined by Sl mapping analysis. The differential expression of the two alternatively spliced transcripts was assessed in cell lines of different origin and in various tissues by polymerase chain reaction and RNase mapping analysis. The first promoter is active in embryo derived cells, whereas the second promoter is silent in basal conditions but it is activated by dibutyryl CAMP in fibroblastic cells. In the whole animal, the transcript driven by the first promoter is found in most tissues albeit at different levels, while the one 0 1991 Academic driven by the second promoter is specifically expressed at htgh levels only in the heart. Press, Inc.

The gene family coding for alkaline phosphatases

(EC 3.1.3.1) is constituted

of at least three

members in the mouse (1). One gene is expressed mainly in the pre-implantation

embryo (2). The

intestinal gene product is found only in the small and large bowels (3). The third member, which is known either as the tissue non-specific (L/B/K-ALP),

isexpressed

or the liver/bone/kidney-type

alkaline phosphatase

gene

in primordial germ cells as well as in other tissues both in the embryo and in

the adult animal (4.5). The mouse L/B/K-ALP gene has been recently cloned in our laboratory and shown to consist of 12 exons spread over at least 49 kb. The first non-coding

leader exon (referred to

as exon IA in this report) is separated from the second exon by a long intron, more than 32 kb in length (6).

The presence of a second leader exon was first described in the rat liver after bile duct ligation

(7,6) and subsequently the human UB/K-ALP

in the kidney (9). A second leader exon and its promoter were found also in gene in a similar position relative to exon 2, however their nucleotide sequence

is not similar to that of the rat (10,ll).

Recently,

this second leader exon (exon 1B throughout this

report) (12) and its relative promoter (13) were identified in the mouse, however, the physical map of the promoter and the transcription

initiation site were not determined.

In this report, we define the

position of exon 1 B and its relative promoter and map the transcription initiation site. Furthermore, differential usage of the two promoters is studied in cell lines and tissues.

* To whom correspondence

and reprint requests should be sent.

0006-291X/91 $1.50 Copyright 0 1991 by Academic Press, Inc. All rights of reproduction in any form reserved.

1352

the

Vol.

179, No. 3, 1991

MATERIALS

BIOCHEMICAL

AND BIOPHYSICAL

RESEARCH COMMUNICATIONS

AND METHODS

Ceil culture The fibroblastic cell lines, L-M (TK-) and L929 were obtained from the American Type Culture Collection (ATCC, Rockville, MD). NIH3T3 fibroblasts were from Dr. P. Mignatti (University of Pavia, Pavia, Italy). 2.8LM is a murine hepatocytic cell line and it was obtained from Dr. R. Revoltella (Istituto di Mutagenesi e Differenziamento, Pisa, Italy). 616 (subline Fl) melanoma was supplied by Dr. R. Giavazzi (Istituto “Mario Negri Bergamo”, Bergamo, Italy). F9, a kind gift of Dr. B. Terrana (Sclavo Research Laboratories, Siena, Italy) is a totipotent teratocarcinoma cell line capable of differentiating towards the primitive, parfetal and visceral endoderm (14). MBL-1 is an undifferentiated emryonal stem cell line, obtained from Dr. E. Wagner (Instutute for Molecular Pathology, Wien, Austria). L-M (TK-), NIH3T3, L929, F9 and 2.8LM were grown in Dulbecco’s MEM (Gibco Laboratories, Grand Island, NY). MBL-1 cells were grown in the same medium, containing 1,000 units/ml of leukemia inhibitory factor (ESGRO, Amrad, Victoria, Australia) to keep them in an undifferentiated state. B16 Cells were grown in MEM (G&co). Ail the media were supplemented with 10% FCS (G&co). 20% FCS was used for MBL-1 cells. In some experiments, F9 cells were treated with 10e3 M dibutyryl CAMP (SIGMA, St. Louis, MO) or 10-6 M retinoic acid (SIGMA ) for 48 hours. L929 cells were treated with 10‘3 M dibutyryl CAMP for 48 hours. Mapping and characterization of leader exon 16 and its flanking regions The oligonucleotide 5’ TCGATCCAGATGCTGAA 3’ corresponding to position -167/-151 of the alkaline phosphatase cDNA described by Brown et al. (12) was synthesized using an automated DNA synthesizer (Beckman Instruments, Palo Alto, CA). Previously isolated mouse L/B/K- ALP genomic clones (6) were hybridized with the synthetic oligonucleotide. The positive 5.5 kb EcoRl fragment, derived from h phage clone 21, was subcloned in pBluescript (SK) (Stratagene, San Diego, CA). The recombinant plasmid was used to map the position of exonlB by Southern blotting analysis (15). A 1,286 nucleotide long Hincll-Pstl fragment containing exon 1B and part of its 5’ and 3’ flanking regions was further subcloned in pBluescript (SK) and completely sequenced in both directions by the dideoxy-nucleotide chain-termination method (16). Isolation of RNA and measurement of specific ALP transcripts Total and poly(A)+ RNAs were prepared from cells and tissues obtained from C57 BV6.l mice (Charles River, Calco, Italy) according to standard procedures (15) and used for Sl nuclease, Northern blotting and RNase protection analysis. The probe used for Sl mapping analysis was a 283 nucleotide Ball- Mstll fragment (from nucleotide -105 to nucleotide +178 in Fig. 2C) labelled with 32P at the 5’ end of the Mstll site (15). The hybridization was performed according to standard methods at 52 “C overnight. The Sl protected DNA fragments were analyzed on a 12% polyacrylamidel7M urea sequencing gel in parallel with sequencing ladders, obtained by chemical cleavage of the radiolabelled probe (17). The probe used for Northern blotting analysis was a 2 kb EcoRl-Bglll fragment of mouse placental ALP cDNA (4). Gel electrophoresis, blotting and hybridization conditions were as described (15). Preparation of the riboprobes and RNase mapping analysis were performed according to Melton et al. (18) with minor modifications. Appropriate genomic fragments were subcloned in pBluescript (SK) and used as tern lates for transcription with T3 RNA polymerase (Promega Inc., Madison, WI) in the presence of J!ZP - UTP according to the manufacturer instructions. The probe used for the detection of exon 1A transcript was a 223 nucleotide long antisense RNA, consisting of 82 nucleotides of exon 1 A, 89 nucleotides of its 5’ flanking region and 52 nucleotides of polylinker sequence of pBluescript. Hybridization was carried out at 55 “C and RNase digestion was at 37” C for 1 hour with RNase A (8 ug/ml) and RNase Ti (0.4 pgglml). The probe used for the detection of exon 1B was a 312 nucleotide long antisense RNA, consisting of 109 nucleotides of exon lB, 105 nucleotides of its 5’ flanking region and 98 nucleotides of pBluescript. The temperature of hybridization was 52” C and RNase digestion was at 30°C for 1 hour with RNase A (4 ug/ml) and RNase Tl (0.2 f&g/ml). RNase protected bands were electrophoresed on 8% polyacylamidel7M urea sequencing els. RNA size markers were prepared by in vitro transcription of pBluescript (SK) in the presence of 9 2P _UTP, after digestion with appropriate restriction enzymes. Polymerase chain reaction (PCR) amplification PCR amplifications were carried out from total RNA after reverse transcription using the gene AMP kit (Cetus Perkin Elmer, Norwalk, CT). The antisense downstream oligonucleotide was the same for the amplification of both exon 1A and 1B transcripts and is contained in exon 2 (5’ ACGAATCTCAGGGTACA 3’; complementary to nucleotides 164080 of mouse placental ALP cDNA) sense upstream oligonucleotides were specific for exon 1A (5’ (4), whereas CGCCAGAGTACGCTCCCGCC 3’; nucleotides 1120 of the placental ALP cDNA) (4) and 1B (5 AGCATAGGGGACAGGGACCTGT 3’; nucleotides -197/-176 of the L929 ALP CDNA) (12), respectively. The samples were subjected to 28 amplification cycles for exon 1A and 32 cycles for 1353

Vol.

179, No. 3, 1991

BIOCHEMICAL

AND BIOPHYSICAL

RESEARCH COMMUNICATIONS

exon 1 B (94°C for l’, 50°C for 2’ and 72°C for 3’). The assays were performed in conditions of linearity in terms of RNA concentration and during the logarithmic phase of the amplification by Taq pofymerase. After amplification the samples were run on a 1.5% agarose gel, blotted to nylon membranes and hybridized to 32P-labelled oligonucleotides specific for exon 1A (5’ GTCTGlXCGGCTCGCG 3’; complementary to nucleotides 45161 of placental ALP cDNA) (4) and exon 16 (5’ TCGATCCAGATGCTGAA 3’; nucleotides -167/-151 of the L929 ALP cDNA) (12) according to Wood et al. (19). Enzyme assays ALP enzymatic activity was determined in cell and tissue homogenates as already described using p-nitrophenol phosphate as substrate (20). The UB/K-ALP isoenzyme is distinguished from other isoforms by its sensitivity to heat inactivation (21). In our conditions treatment of L/B/K-ALP activity for 10 min at 56” C causes a 70-80% inactivation of the enzymatic activity. Enzymatic activity values were normalized for the protein content. Proteins were determined by the Bradford method (22). RESULTS The position of the second leader exon (1 B) was determined based on the published sequence of the 5’ untranslated

by the use of a specific oligonucleotide

region of the L/B/K- ALP cDNA isolated from

L929 cells after stimulation with CAMP (12). ExonlB and its respective promoter were found in the h phage

clone 21, which was previously

isolated

(6).

As shown

in Fig.1, exon 1B is located

approximately 8.0 kb upstream of the 5’ end of exon 2. The transcription

initiation site of the mRNA derived from exon 1B was determined

by Sl mapping

analysis (Fig. 2A) using poly (A)+ RNA from L929 cells stimulated with dibutyryl CAMP and from the heart. The results obtained with this technique show one major transcription a length of 179 nucleotides observed transcription

downstream.

for exon 1B.

The sequence

However,

minor transcription

of the 5’ flanking

initiation site that defines initiation

region up to nucleotide

initiation site, and part of intron 1B are presented

sites are also -774 from the

in Fig. 28. The promoter

region is

devoid of TATA and CAAT consensus sequences, possibly explaining the presence of multiple minor

I

5 kb

4

21

Fig. Organization of the LIB/K-ALP locus around represent the L/B/K-ALP locus, with transcription proceeding

leader exon 1B.

Thick solid lines

from left to r@It. Exons are shown as boxes underneath the line of the gene and are numbered from 1 to 12. The two alternative leader exons are marked as 1 A and 1 B. The brackets and the dotted line represent a pari of the gene not yet entirely mapped. The position of BamHl sites noted with asterisks is predicted by Southern blotting analysis (G).The thin solid line at the top of the figure represents the insert of the recombinant phage containing exon 1 B. The enlarged scheme gives a more detailed restriction endonuclease map of the region of the gene around exonl B. Sequencing in both directions of the Hincll-Pstl fragment containing exon tB was performed using specific oligonucleotides as primers or from restrictiin sites after cloning of appropriate subfragments.

1354

Vol.

179,

No.

BIOCHEMICAL

3, 1991

AND BIOPHYSICAL RESEARCH COMMUNICATIONS

-

-

Fiq. 2. Determination of the transcription initiation site and primary structure of the 5’ and 3’ flanking region of exon 18. (A) Sl mapping analysis was performed with 5 pg of poly(A+)RNA extracted from L929 cells stimulated with dibutytyl CAMP for 48 hours or from mouse heart. The Sl protected bands were analyzed in parallel with the sequencing ladder of the probe. The position of the major protected fragment is indicated by an arrow. (B) The major putative transcriptional initiation site is numbered as +I and is indicated by a vertical arrow. Upstream sequences are indicated by negative numbers. The sequence of exon 1 B is shown in capital letters, whereas that of the 5’ and 3’ flanking regions is in lower-case letters. Horizontal arrows above the sequence indicate a 9 bp inverted repeat. Nucleotide differences relative to published data (13) are shown above the sequence.

transcription

initiation

contains

sites

a 9 bases

element

(25)

GT/AG

inverted

in the

rule (26).

(23,

Between

repeat.

region

nucieotide

Significantly,

so far sequenced.

in our sequence,

of the mouse L/B/K-ALP polymorphism

24).

the

The

promoter

is devoid

intron-exon

nine nucleotides

second leader

and -357 of the sequence the promoter

-406

donor

are different

exon and

of a CAMP

splicing

relative

site

responsive

conforms

to the published

its 5’ and 3’ flanking

to the structures

regions

(13) . This

might be due to the different strain of mice used in our experiments.

To determine the ceil and tissue distribution of the L/B/K-ALP mRNA, the steady state levels of the transcript were first measured by RNA blotting analysis, not distinguish enzymatic

activity

embryo heat

between

derived labile

enzymatic

ALP activity

[L929,

L-M

L929,

a dramatic

treatment. UBIK-type,

(TK-)

Since

the two alternatively

in the same cells

(F9

enzymatic

cell

lines

spliced and

teratocarcinoma activity

are induced

and

by retinoic

mRNAs

tissues and

mRNA.

was

MBL-1 in the

acid

using a full-length cDNA probe (4) that does derived also

from

determined.

embryonal case

described

1A and

1B.

As shown

stem ceils)

of F9 cells,

as previously

exon

both (27).

The ALP

in Fig. 3A,

contain

high levels

the transcript in fibroblastic

of

and the cell lines

and NIH3T3], ALP mRNA and enzymatic activity are almost undetectable, however, in increase the only

at present

in ALP

enzymatic

ALP transcript

we do not have

activity

present any

in these

explanation

1355

and

mRNA

cells

after

for the

is observed dibutyryi unusual

after CAMP

heat

dibutyryl

treatment

stability

CAMP is of the

of L929

ALP

Vol.

179, No. 3, 1991

BIOCHEMICAL

AND BIOPHYSICAL

A 0

heat stable

RESEARCH COMMUNlCATlONS

B211rl

ALP activity

n heat labile ALP activity

0 H

heat stable ALP actwty heat labile ALP activity

0 ALP mRNA

ALP mRNA

Fia. Cell and tissue distribution of L/&K-ALP transcripts and enzymatic activity. Total RNA (20 i@ane) extracted from various cell lines (A) or from tissues (8) as indicated was fractionated on a l%-formaldheyde/agarose gel, transferred to a nylon membrane and hybridized to 32P-labelled mouse placental ALP cDNA. The size of the band detected corresponds to a length of 2.5 kb. Heat stable enzymatic activity is calculated by subtraction of heat labile (re resenting the activity of the L/B/K-ALP isoenzyme) from total ALP activity. AA = retinoic acid (lo- E M); CAMP = dibutyryl CAMP (10M3 M). Data on enzymatic activity represent the mean of three separate determinations on homogenates obtained from pools of three animals (the S.D. is less than 10% and it is not represented).

activity after dibutyryl CAMP treatment. Hepatocytic cells (2.8LM) contain considerable

amounts of heat

labile ALP activity and transcript, whereas melanoma (I316) cells contain neither enzymatic activity nor specific mRNA. In vivo , as shown in Fig. 38, high levels of UBIK-ALP enzymatic activity and mRNA are observed in the kidney, placenta and ovary. High levels of total ALP enzymatic activity are also observed in the intestine and testis, however, more than 90% and approximately respectively,

is due to a heat sensitive isoenzyme.

.ALP mRNA in these tissues. diaphragm,

Surprisingly,

40% of this enzymatic

activity,

This is consistent with the content of L/B/K-type

high levels of ALP mRNA are found in the heart and

in spite of the fact that total and heat stable ALP enzymatic activity are low.

In fact,

densi-tometric analysis of the ALP mRNA band demonstrates that the heart and the diaphragm express 15 and 22%, respectively, of the amount of transcript present in the kidney. the diaphragm

However, the heart and

have only 2 and 1% , respectively, of ALP enzymatic activity relative to the kidney.

All

the other tissues, including liver, contain low levels of both ALP enzymatic activity and mRNA. To determine which promoter is responsible

for the expression of the L/B/K-ALP gene in the cell

lines and tissues, the amount of exon 1A- and 1 B- derived specific transcripts were assessed by PCR amplification and by RNase mapping analysis. As shown in Fig. 4A, exon 1A promoter

is responsible

for the expression of the ALP gene in embryonal cells (MBL-1, F9 and F9 treated with retinoic acid and dibutyryl CAMP) and in hepatoma cells (2.8LM), whereas exon 18 promoter is active in L929 fibroblastic 1356

Vol.

179, No. 3, 1991

BIOCHEMICAL

AND BIOPHYSICAL

RESEARCH COMMUNICATIONS

-

85

-

Fiq, Expression of exon 1A and B in cell lines. (A) Equal amounts (1 ug) of total RNA from different cell lineswere reverse transcribed and the resutting cDNA was split in two identical aliquots and PCR amplified using an oligonucleotide couple specific for exon 1A and 1 B respectively. The products of the amplification were run on a 1.5% agarose gel, blotted on nylon membranes and hybridized to 32P-labelled synthetic nucleotides specific for exon 1A and IB. The oligonucleotides employed for the hybridization were distinct and internal to the couple of oligonucleotides used for the amplification step. Molecular weight markers are indicated on the left side. (B) and (C) FiNase protection analysis was performed on 100 ug of tRNA, 5 ug of poly(A)+ RNA and100 ug of total RNA extracted from various cell lines as indicated, after hybridization of 32P-UTP labelled RNA probes specific for exon 1A (B) and 1B (C) respectively. The major RNase protected fragments are indicated by arrows. Molecular weight markers are shown on the left. RA = retinoic acid (10e6 M); CAMP = dibutyryl CAMP (10T3 M).

cells upon

induction

cells, however,‘the

with dibutytyl

CAMP. The induction by dibutyryl CAMP is also evident in L-M (TK-)

amount of the transcript is much lower than that of L929.

The results of RNase mapping analysis (Figs. 48 and C) are quantitatively consistent with the data obtained by PCR analysis.

Major RNase protected bands of 82 and 109 nucleotides are observed for

exon 1A and 1B respectively. the two exons as determined

This is the size expected from the major transcription

initiation sites of

by Sl mapping analysis (see Fig. 2A and reference 6). The faint bands

migrating more slowly than the major protected bands of the expected size in MBL-1 and F9 cells may be due to minor transcription

initiation events or to incomplete

notice that these bands are less pronounced artifact).

It is thus evident that whereas

digestion by RNases (for exon lB,

when poly (A)+ RNA is used, suggesting

exon 1A promoter

a technical

is active in basal conditions,

exon 1B

promoter is activated only upon stimulation with dibutyryl CAMP. in the limited number of cell lines so far tested. To know analysis

whether

was performed

exon

1B promoter

on RNA extracted

is expressed from various

1357

in basal tissues.

conditions

in viva.

RNase

mapping

As shown in Figs. 5A and B the exon

Vol.

179, No. 3, 1991

BIOCHEMICAL

AND BIOPHYSICAL

RESEARCH COMMUNICATIONS

-

100

-

85

-

100

* 85 73

-

&g-5. Expression of exon 1A and 1B in mouse tissues. (A) RNase mapping analysis was performed on 100 pg of tRNA or total RNA extracted from various mouse tissues as indicated using a probe specific for exon 1A. The major protected band is indicated by an arrow. Molecular weight markers are shown on the left. (B) RNase mapping analysis was performed on 100 pg of tRNA or total RNA extracted from various tissues as indicated using a probe specific for exon 18. The major protected band is indicated by an arrow. Molecular weight markers are shown on the left.

1A derived

transcript is the one present in all the tissues characterized

gene expression (kidney and placenta).

by relatively high L/B/K-ALP

Low but detectable levels of this transcript are also observed

in the ovary after longer exposure (data not shown).

The only tissue that contains detectable levels of

exon 1B transcript is the heart. DISCUSSION The expression controlled

of the UB/K-ALP

gene is regulated by the presence of two leader exons that are

by distinct promoters, resulting in the synthesis of two alternatively spliced

two transcripts have different 5’ untranslated

mRNAs.

regions but they code for an identical protein.

The

To study

the cell and tissue specific expression of the two promoters in the mouse, exon 1B and its promoter were first characterized. length of exon lB,

Our data on Sl nuclease mapping and RNase protection analysis define the

which is shorter than that of the human (10) and rat (8) homologues.

sequence of its 5’ and 3’ flanking regions

was also determined,

The

confirming and expanding the data

recently published (13). The promoter region is highly similar to that of the rat (8), but not to that of the human

(10).

Cell and tissue distribution experiments conducted by RNase mapping and PCR amplification analysis demonstrate two promoters

that the most generally used leader exon is 1A. The data presented also suggest that the are generally not used contemporaneously 1358

(with the only exception of the diaphragm;

Vol.

179, No. 3, 1991

BIOCHEMICAL

see below, in the discussion) report shows that exonlA activity.

AND BIOPHYSICAL

in the same cells and tissues. is the only one expressed

RESEARCH COMMUNICATIONS

The panel of cell lines surveyed in this

in basal condftions in cells that express ALP

Exon 1A promoter is also active during the induction of ALP mRNA by retinoic acid in F9

teratocarcinoma accumulation

cells.

On the other hand, exonlB

promoter is solely responsible

of ALP mRNA and enzymatic activity in L929 fibroblastic

for the dramatic

cells after treatment with

dibutyryl CAMP. fn viva, exon 1 A promoter is active in the tissues that contain high levels of L/B/K- ALP mRNA and enzymatic activity, such as kidney and placenta. The activity of exon IA promoter in the mouse kidney is at contrast to what was observed in the rat, where this organ was shown to express ALP mRNA transcribed

only from exon E2 (the rat homologue of the mouse exon 16) (8). In the mouse, exon 1B

promoter is instead specifically active in the heart, which expresses relatively high levels of UB/K-ALP mRNA but low levels of enzymatic activity. The usage of this alternative promoter in the heart is not a strict characteristic of this organ or of other mouse striated muscles. In fact, experiments conducted by the sensitive (preventing presence

PCR amplification

technique

on tissues

the detection of specific bands by RNase

where mapping

LIB/K-ALP

transcript

analysis) demonstrate

of exon 1B derived mRNA also in the liver and the testis (data not shown).

preliminary experiments

is very low the specific Moreover,

show the absence of exon 1B derived ALP mRNA in the thigh muscles and

the presence of a mixture of exon 1A and 1B derived ALP mRNA in the diaphragm (data not shown). It remains to be established

which

type of cells in the heart is responsible

for the high expression

of

exon 1 B and if the specific accumulation of exonl B derived transcript is related to the poor translation of the message into ALP protein observed in this organ. It would be also interesting to know whether the activity of exon 1 B promoter in the heart is a peculiarity of the mouse or whether it is a more general phenomenon

and it can be observed in human and in other animal species as well.

ACKNOWLEDGMENTS This work was supported partly by grants from the Consiglff Nazionale delle Ricerche “Progetto Biotecnologie e Biostrumentazione” contract n. 90.00127.PF70 and “Progetto Finalizzato lngegneria Genetica” contract n. 91.0006O.PF99, by grants from the Associazione per la Ricerca contra il Cancro (AIRC) and by Mrs. Gigina Necchi Campiglio and Ms. Nedda Necchi. M.Studer is a recipient of a fellowship from AIRC.

REFERENCES 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14.

Goldstein, D.J., et al. (1980) Proc. Natl. Acad. Sci. U.S.A. 77, 2857-2860. Hahnel. A.C., et al. (1990) Development 110,555-564. Hass, P.E., eta/. (1979) Proc. Natl.Acad.Sci. U.S.A. 76, 1164-1168. Terao, M. and Mintz, B. (1987) Proc. Natl. Acad. Sci. U.S.A. 84,7051-7055. Manes, T. et al. (1990) Genomics 8,541-554. Terao, M., et al. (1990) Biochem. J. 268,641-648 Toh, Y., et al. (1989) J. Biochem. 10561-65. Toh, Y., et a/. (1989) Eur. J. Biochem. 182.231-237. Zernik, J., et al. (1991) Biochem. Biophys. Res. Comm. 176, 1149-l 156. Matsuura, S., et al. (1990) B&hem. Biophys. Res. Comm. 168,993-1000. Kishi, F., eta/. (1989) Nucleic Acids Res. 17, 2129. Brown, N.A., et al. (1990) J. Bfol. Chem. 265, 13181-13189. Toh, Y., et al. (1990) Biochemistry Int. 22,213-218. Strickland, S. and Mahdavi, V. (1978) Cell 15,393-403. 1359

Vol.

15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27.

179, No. 3, 1991

BIOCHEMICAL

AND BICPHYSICAL

RESEARCH COMMUNICATIONS

Maniatis, T., et al. (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Sanger, F., era/. (1977) Proc. Natl. Acad. Sci. U.S.A. 74,5463-5467. Maxam, P.M. and Gilbert, W. (1980) Methods Enzymol. 65,499-560. Melton, D.A., et a/. (1984) Nucleic Acids Res. 12, 7035-7056. Wood, W.I., eta/. (1985) Proc. Natl. Acad. Sci. U.S.A. 82, 1585-1588. Garattini, E., er al. (1986) Arch. Biochem. Biophys. 245,331-337. McComb, R.B., Bowers, G.N., Jr. and Posen, S. (1979) Alkaline Phosphatase, Plenum Publishing Corp, New York. Bradford, M. (1976) Anal. Biochem. 72, 248-254. Smale, S.T., and Baltimore, D. (1989) Cell 57, 103-l 13. Ayer, D.E., and Dynan, W.S. (1988) Mol. Cell. Biol. 8,2021-2033. Montminy, MR., eta/. (1986) Proc. Natl. Acad. Sci. U.S.A. 83,6682-6686. Breathnach, R. and Chambon, P. (1981) Annu. Rev. Biochem. 50,349-383. Gianni, M., et al. (1991) Biochem. J. 274, 673-678.

1360