“Low-risk” and “High-risk” HPV-infection and K-ras Gene Point Mutations in Human Cervical Cancer

PATHOLOGY

Original Paper

RESEARCH AND PRACTICE © Urban & Fischer Verlag http://www.urbanfischer.de/journals/prp

“Low-risk” and “High-risk” HPV-infection and K-ras Gene Point Mutations in Human Cervical Cancer: A Study of 31 Cases Agnieszka Stenzel1, Andrzej Semczuk2, Krystyna Róz·y´nska1, Jerzy Jakowicki2, Jacek Wojcierowski1 1

2

Department of Human Genetics, Lublin University School of Medicine, and 2nd Department of Gynecological Surgery, Lublin University School of Medicine, Lublin, Poland

Summary To analyze the coexistence of human papilloma virus (HPV) infection and K-ras gene activation in cervical neoplasia, we investigated 31 (seven pre-invasive and 24 invasive) cervical carcinomas for “low-risk” (types 6 and 11) and “high-risk” (types 16 and 18) HPVs and Kras point mutations using PCR-based technology. “Lowrisk” HPVs were not detected in the group investigated; however, 20 of 31 (64%) cases were HPV 16 positive, while HPV 18 was found in only three (9.7%) samples (HPV 6/11 v. HPV 16/18, p < 0.0001; HPV 16 v. HPV 18, p < 0.0001; Fisher’s exact test). There was a K-ras codon 12 point mutation in two of 31 (6.4%) neoplasms, with none of the cases showing a K-ras codon 13 point mutation. Two moderately differentiated squamous carcinomas showed K-ras exon 2 gene alterations. Interestingly, none of the pre-invasive cervical carcinomas displayed K-ras gene point mutations. The mean patient age did not differ significantly in the number of HPVpositive and –negative cases. A coexistence of “highrisk” human papillomavirus DNA with K-ras gene alterations was observed in three of 31 (9.7%) neoplasms (one IIA and two IB moderately differentiated cervical carcinomas). Our results suggest that “high-risk” HPVs coexist with K-ras gene alterations in a subset of moderately differentiated carcinomas of the cervix uteri. Abbreviations: FIGO – International Federation of Gynecology and Obstetrics; ORF – Open Reading Frame; PCR – Polymerase Chain Reaction; RFLP – Restriction-Fragment-Length Polymorphism; SSCP – Single-Strand Conformation Polymorphism Pathol. Res. Pract. 197: 597–603 (2001)

Key words: HPV – Cervical cancer – K-ras – Point mutation

Introduction Human papillomaviruses (HPVs) are the most common sexually transmitted viruses worldwide [32]. The classification of female genital tract HPVs into “low-risk” and “high-risk” is based on their association with preneoplastic and malignant cervical lesions [37]. “Lowrisk” HPV types-6 and –11 were most frequently found in condylomatas and low-grade cervical intraepithelial neoplasia (CIN1). However, CIN2, CIN3 and invasive cervical carcinomas were commonly infected by HPV types –16, –18, –31, –33, –35, –39, –56 and –58 (“highrisk” viruses) [8, 22]. Epidemiological data confirmed the association between papillomavirus infection and the development of cervical cancer in humans [5, 37]. The most significant HPVs are those of the anogenitalmucosal type, those having the highest potential for oncogenicity, with “high risk” types –16 and –18 being the most prevalent viruses in cervical cancer reported to date [22, 32]. The HPV oncoproteins E6 and E7, in particular, present in most human cervical cancers and in HPV- infected cells, are responsible for deregulating the cell-cycle Address for correspondence: Andrzej Semczuk, 2nd Department of Gynecological Surgery, Lublin University School of Medicine, 8 Jaczewski street, 20-958 Lublin, Poland. Tel.: ++ 48 81-7425 426 , Fax: ++ 48 81-7475 710. E-mail: [email protected] 0344-0338/01/197/9-597 $15.00/0

598 · A. Stenzel et al.

control machinery. The E6-oncoprotein binds to p53 and degradates it in a ubiquitin-dependent manner [24]. This interference abolishes the cell-cycle control function, thus exempting it from DNA damage repair. E7 binds to the retinoblastoma protein, forming a complex releasing the active E2F-transcription factor [3]. The continuous expression of the E6 and E7 oncogenes of the “high risk” HPVs initiates neoplastic transformation and maintenance of the malignant cell phenotype. The development of cancer in humans is a multifactorial event consisting of oncogene and growth factor activations as well as tumor suppressor gene inactivation [36]. Genes controlling cellular growth and differentiation, the ras gene family, have been widely studied in various human malignant tumors and cell-lines [for review see 19]. Interestingly, it has been hypothesized that ras genes may cooperate with the oncogenic sequences of human genital papillomaviruses, inducing a transformed phenotype of epithelial cells in vitro [31]. Using the human keratinocyte cell line (HPK-1A) harboring HPV 16 integration, Durst et al. [9] reported the enhanced tumorigenic property of this cell line after a Kirsten sarcoma virus transfection. It has also been reported that rhesus papillomavirus type 1 cooperates with activated ras oncogenes in transforming primary epithelial rat cells at a level comparable to HPV 16 [25]. K-ras gene point mutations have previously been studied in precancerous and invasive cervical carcinomas obtained from different geographical regions [7, 10, 12, 13, 16, 18, 23]. Others also suggested that ras mutations might play an important role in neoplastic transformation in human uterine cervix [35]. To discover whether these two alterations coexist in cervical neoplasia, we investigated 31 (seven pre-invasive and 24 invasive) human cervical carcinomas for “low-risk” (types 6 and 11) and “high-risk”(types 16 and 18) HPVs and K-ras (exon 1 and exon 2) gene alterations using PCR-based technology.

Materials and Methods Patients Tissue samples were collected from 31 patients who had undergone surgery for carcinoma of the uterine cervix at the 2nd Department of Gynecological Surgery, Lublin University School of Medicine, Lublin, Poland, between 1997–1999. The mean patients’ age was 49,3 years (range, 29–81 years). Tumors were staged according to the criteria of the International Federation of Gynecology and Obstetrics [4]. Seven (23%) cases were classified as carcinoma in situ (CIS, stage 0), 15 (48%) were stage I, eight (26%) were stage II, and one (3%) was stage IV. All cervical cancers were classified according to the histological typing of the WHO staging system [26]: twenty-nine (94%) were squamous carcinomas, and two (6%) were adenocarcinomas of the uterine cervix.

Material obtained at biopsy or during surgical excision was subdivided into two parts. One portion was histologically assessed at the Department of Pathology, Lublin University School of Medicine, Lublin, Poland, while the second one was immediately immersed at liquid nitrogen and stored at –80 °C. DNA isolation Tumor tissue was homogenized in a glass homogenizer with DNA I buffer (10 mM Tris HCl pH 7.0, 10 mM EDTA, 1% SDS) for 15 min at room temperature, and aliquot was incubated with proteinase K (2.5 µl/ml of DNA buffer) at 37 °C overnight. The sample was incubated for 8 min to inactivate proteinase K. After phenol-chloroform extraction and ethanol precipitation, DNA was pelleted by centrifugation for 15 min at 14 000 rpm. The pellet was dried and DNA was resuspended in 50 µl of double sterile H2O overnight at 4 °C and stored at –20 °C. “Low-risk” and “high-risk” HPVs detection We applied Burnett’s [2] PCR-reaction with two sets of specific primers for detecting “low-risk” types 6 and 11 HPV sequences. The primer sequences used in these experiments are shown in Table 1. Briefly, 100 ng of DNA was subjected to 35-cycles of amplification in a buffer containing 200 µM of each dNTP (Pharmacia, USA), 50 pmol of each primer, 10× PCR-buffer and 2.5U of Taq DNA polymerase (Promega, USA). After 5 min of denaturation at 95 °C, 2.5U of next Taq DNA polymerase was added (“hotstart”) and samples were subjected to 45 amplification cycles at 94 °C for 60 sec, 52 °C for 30 sec, 72 °C for 60 sec, and in a final step at 72 °C for 10 min. PCR-products were purified and digested with restriction endonuclease Nde I (Promega, USA), cutting the sequence 5’...CA/TATG...3’ and 3’...GTAT/AC...5’. We applied 5U of Nde I to PCR-amplified products using a commercially available buffer (Promega, USA) in a total volume of 20 µl. The samples were digested for 3 hours at 37 °C. The digested fragments were separated by electrophoresis on a 3% agarose gel, stained with ethidium bromide, and photographed on an ultraviolet transilluminator. To analyze “high-risk” HPV types 16 and 18, we used the PCR-technique as reported by Iwasaka et al. [16], with two sets of specific primers for HPV 16 and HPV 18 E7 ORFs (Table 1), using 100 ng of DNA and DNA amplification kit (Gene Amp® PCR Core Reagents, Perkin Elmer, USA). The amplification protocol has already been described [29]. Samples were subjected to 35 amplification cycles in an automatized thermocycler (Gene Amp® PCR System 2400, Perkin Elmer, USA). The cycling parameters were as follows: initial step- 95 °C for 4 min, 94 °C for 1 min, 55 °C for 2 min, 72 °C for 2 min, and final step at 72 °C for 7 min. The amplification products were purified, analyzed by electrophoresis on 3% agarose gels, visualized by ethidium bromide staining, and photographed under UV light. Positive controls were obtained from human cervical carcinoma cell lines, HeLa and Caski, known to contain nearly 10 copies of HPV type 18 and nearly 500 copies of HPV type 16, respectively. Placental tissue negative for HPV infection was used as a negative control.

Analysis of HPV DNA and K-ras Gene Point Mutations in Cervical Carcinomas · 599 Table 1. PCR-primer sequence used in the experiments Primer sequence

PCR-product (bp)

HPV 6

F 5’ CACCTAAAGGTCCTGTTT 3’ R 5’ GAACCGCGCCTTGGTTAG 3’

230

HPV 11

F 5’ CGCAGAGATATATGCATATG 3’ R 5’AGTTCTAAGCAACAGGCACA 3’

89

HPV 16

F 5’ GCAACCAGAGACAACTGATC 3’ R 5’ATTGTAATGGGCTCTGTCCG 3’

115

HPV 18

F 5’ TCACGAGCAATTAAGCGACT 3’ R 5’ CTGAGCTTTCTACTACTAGC 3’

158

K-ras exon 1

F 5’ACTGAATATAAACTTGTGGTAGTTGGACCT 3’ R 3’ TCAAAGAATGGTCCTGGACC 3’

157

K-ras exon 2

F 5’AATCCAGACTGTGTTTCT 3’ R 5’ACTCCTTAATGTCAGCTT 3’

242

F: Forward, R: Reverse.

K-ras exon 1 point mutations

Statistical analysis

The PCR-RFLP technique as described by Jiang et al. [17] and Semczuk et al. [28] was used for detecting K-ras exon 1 (codons 12 and 13) point mutations in human cervical carcinomas. Primers yielding a 157-bp fragment of exon 1 of the Kras gene were applied for these experiments (Table 1). Briefly, 500 ng of DNA was amplified for 35 cycles in a reaction mixture using the following parameters: initial step at 95 °C for 5 min, 95 °C for 30 sec, 56 °C for 30 sec, 72 °C for 40 sec, and final step at 72 °C for 10 min. PCR-products were purified and analyzed on a 3% agarose gel to confirm successful amplification. The aliquot amount of amplimers was digested with restriction endonuclease – BstN I (for codon 12) or Hph I (for codon 13), as recommended by the manufacturer (MBI Fermentas, Lithuania). K-ras codon 12 or 13 point mutations were assessed by the presence of specific bands separated and visualized electrophoretically after ethidium bromide staining. Human endometrial carcinomas carrying K-ras codon 12 point mutation [28] and human placental tissue were used as positive and negative controls, respectively.

Fisher’s exact test and Mann-Whitney-U test were used for analysis. Statistical significance was achieved at p < 0.05.

K-ras exon 2 point mutations The PCR-SSCP technique was used to detect K-ras exon 2 point mutations in 31 human cervical carcinomas. The primers spanning a fragment (242–bp) of the K-ras exon 2 are presented in Table 1. Amplification was done with the presence of (32P dCTP (Amersham, UK) for 30 cycles using the following parameters: 95 °C- 4 min, 95 °C – 45 sec, 60 °C – 30 sec, 72 °C – 30 sec, and a final step at 72 °C – 5 min. PCR-products were purified, denaturated in formamide, immediately chilled on ice, and loaded on a 8% non-denaturating poliacrylamide gel. After electrophoresis, the gel was autoradiographed for 24 hours at –20 °C. Human endometrial carcinoma harboring K-ras codon 61 point mutation [30] and human placental tissue were used as positive and negative controls, respectively.

Results The PCR-amplification technique was applied to analyze “low-risk” (types 6 and 11) and “high-risk” (types 16 and 18) human papillomaviruses in 31 human cervical carcinomas using PCR-based technology. “Lowrisk” HPVs were not detected in the group investigated; however, 20 of 31 (64%) cases were HPV 16-positive (Fig. 1), while the HPV 18 sequence was found in only three of 31 (9.7%) specimens (HPV 6/11 v. HPV 16/18, p < 0.0001; HPV 16 v. HPV 18, p < 0.0001; Fisher’s exact test). All the positive cases were repeatedly tested to ensure the reproducibility of the results. Both “high-risk” HPVs were detected in two squamous cell carcinomas of the uterine cervix. The frequency of “high-risk” HPV infection in relation to the histological type of cervical cancer is summarized in Table 2. Although “high-risk” HPV-positive patients tended to be older than women negative for the human papillomavirus infection, the difference was not statistically significant (p = 0.755; Mann-Whitney-U test; Table 3). All cervical neoplasms were also screened for K-ras exon 1 and exon 2 point mutations using the PCR-RFLP and the PCR-SSCP techniques, respectively. We found K-ras codon 12 point mutations in two of 31 (6.4%) neoplasms (Fig. 2), while K-ras codon 13 point mutations occurred in none of the cases. Two moderately differentiated IB squamous-cell carcinomas of the uterine

600 · A. Stenzel et al.

Fig. 2. Analysis of K-ras codon 12 point mutations in cervical neoplasms after BstNI-digestion. Lanes 1, 3, and 4 – negative cases, Lane 2 – positive case, Lane 5 – positive control (endometrial cancer harboring K-ras codon 12 point mutation [28]), M represents DNA molecular marker – pUC19 DNA/MspI (MBI Fermentas, Lithuania), bp –base pairs.

Fig. 1. Detection of “high-risk” HPV type 16 in cervical carcinomas on a 3% agarose gel after ethidium bromide staining. Lanes 1– 6 positive cases, Lane 7 negative case, Lane 8 positive control (cell line), M represents DNA molecular marker – pUC19 DNA/MspI (MBI Fermentas, Lithuania), bp – base pairs.

cervix showed K-ras exon 2 alterations using the PCRSSCP technique. Interestingly, none of the pre-invasive lesions harbored K-ras gene point mutations. The mean age of women with K-ras point mutations was not other than that of patients harboring the wild-type gene (p = 0.842; Mann-Whitney-U test; Table 3).

Finally, the coexistence of “high-risk”human papillomavirus DNA infection and K-ras gene activation was evident in three of 31 (9.7%) cases, all of which presented moderately differentiated (G2) invasive cervical carcinomas, two of them being at an early (IB) clinical stage of disease. Table 4 summarizes the detailed clinicopathological variables of cervical cancer patients showing this coexistence.

Table 2. HPV DNA in relation to the histological type of cervical cancer Histological type

HPV-type –––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––– n n (%) ––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––– 6 11 16 18

K-ras –––––––––––––––––––––– HPVpoint positive mutation –––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––– n (%) n (%)

Squamous pre-invasive invasive Adenocarcinoma

7 22 2

– – –

– – –

5 (71) 14(64) 1(50)

1 (14) 1 (4) 1(50)

6 (86) 15 (68) 2 (100)

– 3 (14) 1 (50)

Total

31

–

–

20 (64)

3 (9.7)

23 (74)#

4 (12)

* Two invasive squamous cervical carcinomas harbored both HPV 16 and HPV 18 sequences. Therefore, 21 out of 31 (64%) cervical carcinomas showed “high-risk” HPV-sequences.

Analysis of HPV DNA and K-ras Gene Point Mutations in Cervical Carcinomas · 601 Table 3. Patient age in HPV-positive/negative and K-ras-positive/negative cervical carcinomas n

HPV-positive HPV-negative K-ras-positive K-ras-negative

21 10 4 27

Patient age (years)* mean

range

SD

50.6 46.7 46.8 49.7

29–81 32–65 40–59 29–81

14.8 9.1 8.4 13.9

*There was no significant difference between the groups (p > 0.05; Mann-Whitney-U test).

Discussion Premalignant and malignant lesions of the uterine cervix have been extensively studied to evaluate the influence of various genetic abnormalities on molecular carcinogenesis [22]. It is well-known that “high-risk” HPVs have a high oncogenic potential and that they are associated with cervical neoplasia in humans [1, 5, 32]. Moreover, E6 and E7 oncoproteins interact with the regulatory proteins of tumor suppressor genes p53 and RB, deregulating the cell-cycle machinery. In our study, assessing the prevalence of “low-risk” and “high-risk” human papilomaviruses in pre-invasive and invasive cervical carcinomas, we found that none of the cases was positive for HPV types -6 and -11. However, 64% of the specimens harbored the HPV 16 sequence, while less than 10% of the neoplasms showed HPV 18 DNA (Table 2). Our data are in line with previously published reports [7, 10, 14, 34], and with the results achieved by the multicenter study on the frequency of HPV-infection in cervical cancer [1]. Interestingly, the prevalence of human papillomavirus types is influenced by geographical factors [1]. For example, Greek researchers [7] found that HPV 18 occurred more frequently than HPV 16 in cytologically stained cervical smears (66% and 7%, respectively). They hypothesized that the phylogenetic root of HPV 18 lies in Africa, the continent near the geographic area where they conducted their research. Moreover, Hording et al [15] reported

twice as much HPV 18 as HPV 16 in their cervical neoplasias investigated. However, testing only histologically confirmed adenocarcinomas of the uterine cervix, they found that these had a significantly higher incidence of HPV 18 than HPV 16 infection and showed more aggressive clinical behavior. Apart from the HPV’s geographical preferences, there are other factors that may also be responsible for the variations in the prevalence of HPV types in cervical neoplastic lesions worldwide [7, 11]: the sensitivity of the virus detection system, the number of cases studied, the differences in the histological types of cancer (squamous cell carcinoma v. adenocarcinoma), and the heterogeneity of the virus-replication process. It is well known that, apart from rare cases, HPV infection alone does not suffice to cause tumorigenic convertion within normal cervical epithelium [8]. Thus, in addition to the human papilomavirus infection, other genetic abnormalities and cellular events are necessary to support the multifactorial process of neoplasmic transformation within the uterine cervix. Recently, much emphasis has been placed on the ras gene family, consisting of three well-known genes: K-ras, H-ras and N-ras [19]. The activation of ras genes has been widely studied in human neoplasms and cell-lines, including cervical cancer [19]. ras genes probably cooperate with HPVs in inducing the transcriptional activity of the viral promoter as a consequence of AP-1 activity modulation, followed by increased levels of E6- and E7-viral oncoproteins [21]. Previously, our data showed K-ras exon 1 point mutations in 14%–15% of human endometrial carcinomas [27–28]; furthermore, a poorer outcome for endometrial cancer patients harboring K-ras gene alterations has also been demonstrated [28]. However, none of the HPV-positive carcinomas of the uterine corpus had Kras codon 12 point mutations [29]. Studying cervical carcinomas, three of 31 (9.7%) neoplasms showed both “high-risk” HPV infection and K-ras gene alterations. In the literature, the prevalence and the distribution of both genetic events ranged between 3% to 24% in cervical neoplastic lesions [18, 20, 33]. Analyzing K-ras gene point mutations and HPV DNA integration in adenocarcinomas of the uterine cervix (n = 25) and uterine

Table 4. Clinical characteristics of cervical cancer patients harboring “high-risk” HPV infection and K-ras gene activation Case

Age (years)

Clinical stage*

Histological type

Histological grade#

HPV-positive ––––––––––––––––––––––––––––––––– 6 11 16 18

K-ras positive –––––––––––––––––––––––– exon 1 exon 2

1 2 3

40 43 59

IB IB IIA

Squamous ca Squamous ca Adenocarcinoma

G2 G2 G2

– – –

– – +

– – –

+ + –

*According to the FIGO classification [4], #According to the WHO staging system [26].

– – +

+ + –

602 · A. Stenzel et al.

isthmus (n = 8), Japanese researchers [18] revealed the co-existence of these two abnormalities in one cervical (HPV 16/K-ras codon 12) and two isthmical (HPV 16 and 18/K-ras codon 12) cases. In a study by Koulos et al. [20], one of four cases with K-ras codon 12 point mutation showed HPV type 16 DNA integration. It is worth pointing out that 13 of 58 (19.4%) G2- or G3graded cervical adenocarcinomas carried human papilloma virus integration and K-ras gene point mutations [33]. Our data are in line with Tenti and co-workers [33], who suggested that HPV infection with ras gene activation tends to affect histologically less differentiated cervical carcinomas (Table 4). In another study, nine of 35 (25%) human cervical lesions were both positive for ras mutations and high-risk HPV DNA [6], suggesting that the combination of both molecular events may play an important role in the development of a subset of cervical carcinomas in humans. Interestingly, even in normal and pre-neoplastic cervical lesions, K-ras codon 12-positive cases showed a significantly higher prevalence for the “high-risk” HPV than the “low-risk” (HPV type 6) infected samples [12, 23]. Finally, we observed K-ras exon 2 abnormal migration patterns in two of 31 (6.5%) cervical carcinomas, both at the IB clinical stage of disease. Previously, eight of 33 (24.2%) selected patients suffering from IB cervical cancer harbored ras exon 2 point mutations [13]. However, there were no ras point mutations at codons 12 and 13 in the group investigated [13]. Further research is necessary to confirm the results achieved; however, ras exon 2 gene alterations may represent an intrinsic “hot-spot” area for the group of early-stage carcinomas of the uterine cervix.

4. 5. 6.

7.

8.

9.

10.

11.

12.

13. Acknowledgements. The authors would like to thank the staff at the Department of Pathology, Lublin University School of Medicine, Lublin, Poland for classifying the samples according to the WHO staging system and Mr B. Wuesthoff for editing the manuscript. Dr A. Stenzel was provided a grant by the Lublin University School of Medicine, Lublin, Poland.

References 1. Bosch FX, Manos MM, Munoz N, Sherman M, Jansen AM, Peto J, Schiffman MH, Moreno V, Kurman R, Shah KV (1995) Prevalence of human papillomavirus in cervical cancer: a worldwide perspective: International biological study on cervical cancer (IBSCC) Study group. J Natl Cancer Inst 87: 796–802 2. Burnett AF, Barnes WA, Johnson JC, Grendys E, Willett GD, Barter JF, Doniger J (1992) Prognostic significance of polymerase chain reaction detected human papillomavirus of tumors and lymph nodes in surgically treated stage IB cervical cancer. Gynecol Oncol 47: 343–347 3. Chellappan S, Kraus VB, Kroger B, Munger K, Howley PM, Phelps WC, Nevins JR (1992) Adenovirus E1A,

14.

15.

16.

17.

18.

simian virus 40 tumor antigen, and human papillomavirus E7 protein share the capacity to disrupt the interaction between the transcription factor E2F and the retinoblastoma gene product. Proc Natl Acad Sci USA 89: 4549–4553 Creasman WT (1989) Announcement, FIGO stages, 1988 revision, 35: 125–127 Dallenbach-Hellweg G (1997) Histopathology of functional and neoplastic changes in cervix and endometrium. Verh Dtsch Ges Path 81: 240–244 Dokianakis DN, Sourvinos G, Sakkas S, Athanasiadou E, Spandidos DA (1998) Detection of HPV and ras gene mutations in cervical smears from female genital lesions. Oncol Rep 5: 1195–1198 Dokionakis DN, Papaefthimiou M, Tsiveleka A, Spandidos DA (1999) High prevalence of HPV 18 in correlation with ras gene mutations and clinicopathological parameters in cervical cancer studied from stained cervical smears. Oncol Rep 6: 1327–1331 Durst M, Gissmann L, Ikenberg H, Zur Hausen H (1983) A papillomavirus DNA from a cervical carcinoma and its prevalence in cancer biopsy samples from different geographic regions. Proc Natl Acad Sci USA 80: 3812–3815 Durst M, Gallahan D, Jay G, Rhim JS (1989) Glucocorticoid-enhanced neoplastic trasformation of human keratinocytes by human papillomavirus type 16 and an activated ras oncogene. Virology 173: 767–771 Falcinelli C, Luzi P, Alberti P, Cosmi EV, Anceschi MM (1993) Human papilloma virus infection and Ki-ras oncogene in paraffin–embedded squamous carcinomas of the cervix. Gynecol Obstet Invest 36: 185–188 Ferguson AW, Svoboda-Newman SM, Frank TS (1998) Analysis of human papillomavirus infection and molecular alterations in adenocarcinoma of the cervix. Mod Pathol 11: 11–18 Golijow CD, Mouron SA, Gomez MA, Dulout FN (1999) Differences in K-ras codon 12 mutation frequency between “high-risk” and “low-risk” HPV-infected samples. Gynecol Oncol 75: 108–112 Grendys EC Jr, Barnes WA, Weitzel J, Sparkowski J, Schlegel R (1997) Identification of H, K, and N-ras point mutations in stage IB cervical carcinoma. Gynecol Oncol 65: 343–347 Hachisuga T, Matsuo N, Iwasaka T, Sugimori H, Tsuneyoshi M (1996) Human papilloma virus and p53 overexpression in carcinomas of the uterine cervix, lower uterine segment and endometrium. Pathology 28: 28–31 Hording U, Daugaard S, Visfeldt J (1997) Adenocarcinoma of the cervix and adenocarcinoma of the endometrium: distinction with PCR-mediated detection of HPV DNA. APMIS 105: 313–316 Iwasaka T, Yokoyama M, Oh-uchida M, Matsuo N, Hara K, Fukuyama K, Hachisuga T, Fukuda K, Sugimori H (1992) Detection of human papillomavirus genome and analysis of expression of c-myc and Ha-ras oncogenes in invasive cervical carcinomas. Gynecol Oncol 46: 298–303 Jiang W, Kahn SM, Guillem JG, Lu S-H, Weinstein IB (1989) Rapid detection of ras oncogenes in human tumors: applications to colon, esophageal and gastric cancer. Oncogene 4: 923–928 Jiko K, Tsuda H, Sato S, Hirohashi S (1994) Pathogenetic significance of p53 and c-Ki-ras gene mutations and

Analysis of HPV DNA and K-ras Gene Point Mutations in Cervical Carcinomas · 603

19. 20.

21.

22.

23.

24.

25.

26.

27.

human papillomavirus DNA integration in adenocarcinoma of the uterine cervix and uterine isthmus. Int J Cancer 59: 601–606 Kiaris H, Spandidos DA (1995) Mutations of the ras genes in human tumours (Review). Int J Oncol 7: 413–421 Koulos JP, Wright TC, Mitchell MF, Silva E, Atkinson E, Richart RM (1993) Relationships between C-Ki-ras mutations, HPV types, and prognostic indicators in invasive endocervical adenocarcinomas. Gynecol Oncol 48: 364–369 Medina-Martinez O, Vallejo V, Guido MC, Garcia-Carranca A (1997) Ha-ras oncogene-induced transcription of human papillomavirus type 18 E6 and E7 oncogenes. Mol Carcinog 19: 83–90 Milde-Langosch K, Riethdorf S, Loning T (2000) Association of human papillomavirus infection with carcinoma of the cervix uteri and its precursor lesions: theoretical and practical implications. Virchows Arch 437: 227–233 Mouron SA, Abba MC, Guerci A, Gomez MA, Dulout FN, Golijow CD (2000) Association between activated Kras and c-erbB-2 oncogenes with “high-risk” and “lowrisk” human papilloma virus types in preinvasive cervical lesions. Mutat Res 469: 127–134 Scheffner M, Werness BA, Huibregtse JM, Levine AJ, Howley PM (1990) The E6 oncoprotein encoded by human papilomavirus types 16 and 18 promotes the degradation of p53. Cell 63: 1129–1136 Schneider JF, McGlennen RC, LaBresh KV, Ostrow RS, Faras AJ (1991) Rhesus papillomavirus type 1 cooperates with activated ras in transforming primary epithelial rat cells independent of dexamethasone. J Virol 65: 3354–3358 Scully RE, Bonfiglio TA, Kurman RJ, Silverberg SG, Wilkinson EJ (1994) WHO International Classification of Tumours: Histological Typing of Female Genital Tract Tumours, Springer-Verlag, Berlin, Heidelberg, New York, London, Paris, Tokyo, Hong Kong, Barcelona, Budapest Semczuk A, Berbec H, Kostuch M, Kotarski J, Wojcierowski J (1997) Detection of K-ras mutations in cancerous lesions of human endometrium. Eur J Gynaecol Oncol 18: 80–83

28. Semczuk A, Berbec H, Kostuch M, Cybulski M, Wojcierowski J, Baranowski W (1998) K-ras gene point mutations in human endometrial carcinomas: correlation with clinicopathological features and patient’s outcome. J Cancer Res Clin Oncol 124: 695–700 29. Semczuk A, Stenzel A, Baranowski W, Rozynska K, Cybulski M, Kostuch M, Jakowicki J, Wojcierowski J (2000) Detection of human papillomavirus types 16 and 18 in human neoplastic endometrium: Lack of correlation with established prognostic factors. Oncol Rep 7: 905–910 30. Semczuk A, Schneider-Stock R, Berbec H, Marzec B, Jakowicki JA, Roessner A (2001) K-ras exon 2 gene point mutations in endometrial cancer. Cancer Lett 164: 207–212 31. Storey A, Banks L (1993) Human papillomavirus type 16 E6 gene cooperates with EJ-ras to immortalize primary mouse cells. Oncogene 8: 919–924 32. Swygart C (1997) Human papillomavirus: disease and laboratory diagnosis. Br J Biomed Sci 54: 299–303 33. Tenti P, Romagnoli S, Silini E, Pellegata NS, Zappatore R, Spinillo A, Zara C, Ranzani GN, Carnevali L (1995) Analysis and clinical implications of K-ras gene mutations and infection with human papillomavirus types 16 and 18 in primary adenocarcinoma of the uterine cervix. Int J Cancer 64: 9–13 34. Willis G, Jennings B, Ball RY, New NE, Gibson I (1992): Analysis of ras point mutations and human papillomavirus 16 and 18 in cervical carcinomata and their metastases. Gynecol Oncol 49: 359–364 35. Wong YF, Chung TK, Cheung TH, Lam SK, Xu YG, Chang AM (1995) Frequent ras gene mutations in squamous cell cervical cancer. Cancer Lett 95: 29–32 36. Vogelstein B, Kinzler KW (1993) The multistep nature of cancer. TIG 9: 138–141 37. Zur Hausen H, de Villiers EM (1994) Human papillomaviruses. Annu Rev Microbiol 48: 427–447

Received: February 27, 2001 Accepted in revised version: June 14, 2001