Methylation-Sensitive Amplification Polymorphism of Epigenetic Changes in Cotton Under Salt Stress

ACTA AGRONOMICA SINICA Volume 35, Issue 4, April 2009 Online English edition of the Chinese language journal Cite this article as: Acta Agron Sin, 2009, 35(4): 588–596.

RESEARCH PAPER

Methylation-Sensitive Amplification Polymorphism of Epigenetic Changes in Cotton Under Salt Stress LI Xue-Lin1,2, LIN Zhong-Xu1, NIE Yi-Chun1, GUO Xiao-Ping1, and ZHANG Xian-Long1,* 1

National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, China

2

College of Agronomy, Henan University of Science and Technology, Luoyang 471003, China

Abstract: The objective of the study was to dissect the cytosine methylation in cotton (Gossypium hirsutum L.) genome and the changes in pattern of cytosine methylation under salt stress. Germinated seeds of an inbred cotton line YZ1 were treated with 100 to 200 mmol L1 of NaCl solution for 3 weeks, and the growth of plantlets were measured. The results showed that 100 mmol L1 NaCl obviously promoted plant height and root length of cotton seedlings, but 200 mmol L1 NaCl significantly inhibited plant growth. When the NaCl concentration was ranging from 100 to 200 mmol L1, the number of lateral root was considerably inhibited by the salt stress. The genomic DNA and total RNA were extracted 3 weeks after NaCl treatment. According to the analysis of methylation-sensitive amplified polymorphism (MSAP), the level of global DNA methylation showed a decreas from 41.2% to 34.5% as the salt concentration increased. There was a significantly negative correlation (r = 0.986, P < 0.05) between the NaCl concentration and the level of DNA methylation in cotton roots. Under the treatments with 100, 150, and 200 mmol L1 NaCl, the ratios of DNA methylation were 6.4%, 7.6%, and 11.3% based on the control (0 mmol L1 NaCl), and the percentages of DNA demethylation were 12.7%, 11.1%, and 8.2%, respectively. The results of reverse transcription PCR (RT-PCR) showed that the highly homologous fragments from the control and the salt treatment expressed in different patterns, suggesting that these genes probably play an important role in cotton adaptation to salt stress. Keywords:

cotton; salt stress; DNA methylation; methylation-sensitive amplified polymorphism; RT-PCR

DNA methylation is one of the important epigenetics in plants, which plays a central role in epigenetic control of gene expression. In plants, methylcytosine usually occurs in both CpG and CpNpG sequences [1]. DNA methylation is the most common DNA modification in plants, but its level varies in different species. For instance, about 30–50% of the whole cytosine residues in nuclear DNA are methylated in higher plants [2]. DNA methylation, especially methylation of cytosine in eukaryotic organisms, is important in regulating gene expression, cell differentiation, and phylogenetic development, associated with numerous biological processes, such as transcriptional silencing of genes (especially transgene silencing) and transposable inactivation of transposons [1, 3–7]. Besides, DNA methylation is also considered to contribute to biodefense because foreign genes present different level and loci of DNA methylation [8].

Methylation-sensitive amplification polymorphism (MSAP) is a modification of amplified fragment ength polymorphism (AFLP) method based on different methylation sensitivities of the restriction enzymes Hpa II and Msp I [9]. Hpa II digests only CCGG site unmethylated or hemimethylated with one strand, and Msp I digests the CCGG and CmCGG sites, but not m CCGG or mCmCGG site. Due to the differential DNA cleavage properties of Msp I and Hpa II, the methylation of cytosine residues in CCGG sequence can be evaluated using the MSAP technique [10]. Of late, MSAP has been applied to evaluate the cytosine methylation of genomic DNA in rice (Oryza sativa L.) [11], Arabidopsis thaliana [12], and Citrus plants [13], and becomes one of the important methods for investigation of the level and pattern of genomic methylation [14]. Salinity is one of the major constraints to agricultural production, which has arisen great interests in studies on plant

Received: 12 October 2008; Accepted: 10 January 2009. * Corresponding author. E-mail: [email protected] Copyright © 2009, Crop Science Society of China and Institute of Crop Sciences, Chinese Academy of Agricultural Sciences. Published by Elsevier BV. All rights reserved. Chinese edition available online at http://www.chinacrops.org/zwxb/ DOI: 10.1016/S1875-2780(08)60073-5

LI Xue-Lin et al. / Acta Agronomica Sinica, 2009, 35(4): 588–596

adaption to salt stress [15]. Plants at different growth stages can process diverse responses to salt stress through adjusting expression patterns of corresponding genes, during which DNA methylation plays a central role [16, 17]. For example, vernalization in wheat (Triticum aestivum L.) is in connection with demethylation of the critical gene or its promoter [18]. In addition, transgene silencing proves to be associated with the DNA methylation of promoters and certain coding regions, which affected the expression of transgenes [19]. In recent years, salt-responsive genes, such as DREB2A, DREB2B, bZIP, MYC/MYB, and SOS have been found in Aradopsis thaliana, and the calcium signal pathway and the patterns of gene regulation are also studied [15, 20–22]. However, very few knowledge is obtained in cotton (Gossypium hirsutum L.) regarding the relationship between the DNA methylation and the regulation of gene expression under salt stress. For the purpose of disclosing the mechanism of salt-induced DNA methylation in cotton, the status of cytosine methylation in the genomic DNA was investigate using MSAP technique, and the pattern alternation of cytosine methylation under salt stress was analyzed. The MSAP fragments were also cloned and sequenced to evaluate the methylation and expression patterns of the genes under salt stress.

1 1.1

Materials and methods Plant materials and salt treatments

Cotton seeds of the inbred pure line “YZ1” was preserved by the authors’ laboratory. In the salt-inhibition test, fresh seeds were sterilized with HgCl2 (0.1%, W/V) and germinated in flasks containing sterilized solid medium at 28°C. The medium was 1/2 MS plus 3% (W/V) glucose I and 0.6% (W/V) agar. After incubation for 2 d, uniformly germinated seeds were selected and transferred to new flasks containing the ladder of NaCl concentration, i.e., 0 (control), 100, 150, and 200 mmol L1, in addition to the medium described earlier. The flasks were then placed in a growth chamber under the conditions of 135 μL of radiation, 14 h day /10 h night of photoperiod, and 28±2°C of temperature. Each treatment had 30 plantlets in 3 replicates. Three weeks after treatment, the plantlets were sampled for further tests. 1.2

Evaluation of cotton growth

Plant height, root length, and number of lateral roots were directly measured with the help of a glass plate and coordinate paper with millimeter scale. Each trait was measured in 30 plantlets as replicates. The data were statistically analyzed in Microsoft Excel. 1.3

Genomic DNA extraction and RNA isolation

The genomic DNA was extracted from the entire roots using the modified hexadecyltrimethylammonium bromide (CTAB)

method [23], and DNA quality was verified with 0.8% agar gels and the DU800 spectrophotometer (Beckman, CA, USA). Total RNA was isolated from both leaves and roots of the control and the 200 mmol L1 NaCl treatment. Each 3 μg of RNA was used to synthesize cDNA according to the method described by Zhu et al [24]. The synthesized cDNA was then diluted to 200 ȝL (template) for reverse transcription PCR (RT-PCR) analysis. 1.4

RT-PCR analysis

In the PCR procedure, template cDNA was 1.5 ȝL, and reaction cycle number was 26 with denature temperature of 60°C. Primers were designed to amplify the genes that were homologous to M2 (F: 5'-GACATCTTGGTCTATTCAGG AG-3'; R: 5'-GAACTCACACTTACTGAACTTAGC-3') and M3 (F: 5'-CTATTCAGGAGATGAGACCG-3'; R: 5'-CATGA CCCAAGAAGCTAACC-3'), and the expected length of the amplified fragments were 111 and 131 bp, respectively. Primers specific to the Gbpolyubiquitin-1 gene were used as a positive control. 1.5

MSAP analysis

According to the method of Zhao et al. [25], the adaptors, preamplification primers, and selective amplification primers are shown in Table 1. The products of MSAP amplification were separated on 6% polyacrylamide gel electrophoresis (PAGE) and visualized following silver staining. The number and type of bands in lanes H (EcoR I/Hpa II) and M (EcoR I/Msp I) were summarized for each treatment. The polymorphic bands were scored ‘1’ for the presence and ‘0’ for the absence. Several polymorphic fragments were excised from the polyacrylamide gels and washed with double distilled water. These fragments were reamplificated and cloned into T-vector (Promega). Both strands of positive fragment were sequenced by AuGCT Biotechnology Co. (Beijing, China). Homology search and sequence analysis were carried out with the online tools at the National Center for Biotechnology Information (NCBI) website (http://www.ncbi.nlm.nih.gov/).

2 2.1

Results Effects of salt stress on plant growth

Plant growth and root elongation were greatly promoted under the treatment with 100 mmol L1 NaCl, but were obviously restrained under the 200 mmol L1 NaCl condition (Fig. 1). Although Na+ is one of the necessary elements for plant growth and development, excess of Na+ may affect cell osmotic potential and cause ion accumulation and toxicity [26]. In addition, the number of lateral root obviously reduced in all NaCl treatments.

LI Xue-Lin et al. / Acta Agronomica Sinica, 2009, 35(4): 588–596

Table 1

Sequences of adaptors and primers for MSAP analysis

Adaptor and primer

EcoR I (5'–3')

Hpa II/Msp I (5'–3')

Adaptor

F: CTCGTAGACTGCGTACC

F: GACGATGAGTCTAGAA

R: CATCTGACGCATGGTTAA

R: CTACTCAGATCTTGC

Preamplification primer

GTAGACTGCGTACCAATTCA (E+A)

GATGAGTCTAGAACGGT (HM+T)

Selective amplification primer

GTAGACTGCGTACCAATTCAAC [E+AAC (E4)]

GATGAGTCTAGAACGGTCA [HM+TCA (HM25)]

GTAGACTGCGTACCAATTCATA [E+ATA (E5)]

GATGAGTCTAGAACGGTCG [HM+TCG (HM27)]

GTAGACTGCGTACCAATTCAGG [E+ACG (E15)]

GATGAGTCTAGAACGGTCC [HM+TCC (HM28)]

GTAGACTGCGTACCAATTCAGC [E+AGC (E16)]

GATGAGTCTAGAACGGTGA [HM+TGA (HM29)] GATGAGTCTAGAACGGTGT [HM+TGT (HM30)]

E: EcoR I adaptor; HM: Hpa II/Msp I adaptor.

A

Type I Type II Type III Hyper-methylated

Fig. 1 Effects of NaCl on growth of cotton seedlings Vertical bars denote the standard deviation (n = 30). Significant differences between treatments are shown with different letters at P < 0.05.

2.2 Dynamic level of DNA methylation induced by salt stress There are 4 theoretical band types (Fig. 2-A) of the products of DNA samples digested by Hpa ǿǿ/EcoR ǿ (H) and Msp ǿ/EcoR ǿ (M), but only 3 types can be detected using PAGE analysis (Fig. 2-B). According to the presence or the absence of the polymorphic methylated fragments, the 3 band types reflected the CpG methylation statuses of the CCGG/GGCC sites. Type ǿ (Hpa II+/Msp I+) denoted no methylated cytosine on double strands of DNA or inner methylated cytosine on a single strand (CCGG/GGCC); type ǿǿ(Hpa II+/Msp I) denoted semimethylation, i.e., outer methylated cytosine on a single strand of DNA (5mCCGG/GGCC); type III (Hpa II/Msp I+) represented full-methylation with inner methylated cytosine on double strands of DNA (C5mCGG/GG5mCC). In the control, out of the 277 total bands with legible and reproducible amplification, 114 were methylated bands (hemiand full-methylation), including 87 full-methylated bands. The percentages of total and fully methylated band were 41.2% and 31.4%, respectively. The total band number was 278, 261, and 258 in the 100, 150 and 200 mmol L1 NaCl treatments; the total methylated

B

Type I Type II

Type III

Fig. 2 Msp I and Hpa II sensitivities to 5’-CCGG methylation status (A, from REBASE) and types of bands from PAGE (B) In panel A, white boxes refer to the double-stranded and 4-base Hpa II/Msp I recognition site (CCGG), and black boxes refer to methylated cytosine; “+” and “” refer to digestion and undigestion, respectively. In panel B, type ǿ shows MSAP band of unmethylated site; type ǿǿ shows MSAP band of hemimethylated site; type ǿǿǿ shows MSAP band of fully-methylated site.

band numbers were 106, 92, and 89; and the full-methylated band numbers were 88, 79, and 76, respectively. Compared with the control, either the band numbers or their percentage for global methylation and full-methylation under salt stress declined obviously, especially in 150 and 200 mmol L1 NaCl treatments. In the 100, 150, and 200 mmol L1 NaCl

LI Xue-Lin et al. / Acta Agronomica Sinica, 2009, 35(4): 588–596

control, with an average of 41 bands (ranging from 25 to 50) per primer combination. Twelve banding patterns involved in polymorphism and monomorphism groups were observed in the products of MSAP between the control and the treatments with NaCl (Fig. 3 and Table 3). The polymorphism group was the CCGG/GGCC site methylated differently between the control and the NaCl treatments, indicating that the methylation level of genomic DNA changed under salt stress. This group was further classified into methylation (type A), demethylation (type B), and uncertain methylation (type C). The monomorphism group, which was designated type D, was the same methylation pattern at the CCGG/GGCC site between the control and the NaCl treatments. The monomorphism group suggests that the methylation status of the bands were produced in the 3 salt stress treatments and the CCGG/GGCC site has no changes under salt stress (Table 3). Although approximately 80% of the CCGG sites were not

treatments, the percentages of global methylation were 38.1%, 35.2%, and 34.5%, and the percentages of full-methylation were 31.4%, 31.7%, and 30.3%, respectively (Table 2). This indicated that there were great differences in the genomic DNA methylation between the control and the salt stress treatments. The pattern of DNA methylation at the CCGG site was mainly full-methylation in cotton roots under salt stress, according to the higher ratio of global methylation than that of hemimethylation. In addition, the methylation level of root genomic DNA in cotton was decline following the increase of NaCl concentrations, and the negative correlation (r = 0.986, P < 0.05) was significant between the methylation level and the NaCl concentration. 2.3 Changes of DNA methylation status induced by NaCl stress Using 7 combinations of selective primer, a total of 286

Table 2 Treatment

Effects of different NaCl concentrations on levels of genomic DNA methylation in cotton seedling roots Number of bands amplified

Type I

Type II

Total ethylated bands

Type III

Total

Number

Percentage of full-methylation (%)

Percentage (%)

Control

163

27

87

277

114

41.2

31.4

T100

172

18

88

278

106

38.1

31.7

T150

169

13

79

261

92

35.2

30.3

T200

169

13

76

258

89

34.5

29.5

Concentrations of NaCl are 0, 100, 150, and 200 for control, T100, T150, and T200, respectively. Total number of ethylated bands is the sum of Type II and Type III, of which Type III is the full-mahylation.

1

2

3

4

1

2

3

4

1

2

3

4

1

2

3

4

B4Ź D3Ź B1Ź A1Ź A4Ź B3Ź D1Ź A2Ź CŹ D2Ź

A3Ź

B2Ź

Fig. 3 Profiles of MSAP between control and NaCl treatments 1 and 2: Digestion with Hpa II/EcoR I and Msp I/EcoR I in control; 3 and 4: Digestion with Hpa II/EcoR I and Msp I/EcoR I in NaCl treatment. Banding patterns marked on the left of gel panels.

LI Xue-Lin et al. / Acta Agronomica Sinica, 2009, 35(4): 588–596

Table 3 Banding pattern

Patterns of DNA methylation in NaCl treatments and control

Digestion H (control)

M (control)

a

Methylation status b

H (NaCl)

M (NaCl)

Control

NaCl treatment

Type A A1 A2 A3 A4

1 1 0 1

1 1 1 0

0 1 0 0

1 0 0 0

CCGG

CCGG

GGCC

GGCC

CCGG

CCGG CCGG

GGCC

GGCC GGCC

CCGG

CCGG

GGCC

GGCC

CCGG CCGG

CCGG

GGCC GGCC

GGCC

CCGG

CCGG

GGCC

GGCC

CCGG

CCGG CCGG

GGCC

GGCC GGCC

CCGG

CCGG

GGCC

GGCC

CCGG

CCGG

GGCC

GGCC

CCGG

CCGG CCGG

GGCC

GGCC GGCC

CCGG

CCGG

GGCC

GGCC

CCGG CCGG

CCGG CCGG

GGCC GGCC

GGCC GGCC

CCGG

CCGG

GGCC

GGCC

Type B

B2 B3 B4 Type C

0 1 0 0 0

1 0 0 0 1

1 1 0 1 1

1 1 1 1 0

Type D D1 D2 D3

b

T100

T150

T200

17 (6.4%)

20 (7.6%)

29 (11.3%)

6

5

9

3

4

6

5

7

9

3

4

5

34 (12.7%) B1

a

Site number c

1 1 0

1 0 1

1 1 0

1 0 1

29 (11.1%)

21 (8.2%)

11

8

6

12

13

9

7

5

4

4

3

2

1 (0.4%)

2 (0.9%)

2 (0.8%)

215 (80.5%)

211 (80.4%)

204 (79.7%)

147

145

150

20

22

19

48

44

35

H and M represent digestion with Hpa ǿǿ/EcoR ǿ and Msp ǿ/EcoR ǿ, respectively. 1: Band presence; 0: Band absence. Methylated cytosine is underlined. c Percentages in parentheses are the proportions of banding types in each treatment.

methylated under NaCl treatments, there were 6.4–11.3% methylated and 8.2–12.7% sites demethylated after treated with 100–200 mmol L1 NaCl (Table 3). In contrast to the control, the ratios of total methylation polymorphism were 19.5%, 19.6%, and 20.3% under the treatment of 100, 150, and 200 mmol L1 NaCl, respectively. The results showed that the level of DNA methylation in cotton roots was significantly promoted after NaCl stress, and the percentage of methylated site showed a raising trend as the increase of NaCl concentration, whereas, the demethylated site appeared in decline when the NaCl concentration larger than 100 mmol L1 (Fig. 4). Although around 80% of the CCGG sites were not methylated under NaCl treatments, there were 6.4–11.3% methylated and 8.2–12.7% sites demethylated after treated with 100–200 mmol L1 NaCl (Table 3). In contrast to the control, the ratios of total methylation polymorphism were 19.5%, 19.6%, and 20.3% under the treatment of 100, 150, and 200 mmol L1 NaCl, respectively. The results showed that the level of DNA methylation in cotton roots was significantly promoted after NaCl stress, and the percentage of methylated

site showed a raising trend as the increase of NaCl concentration, whereas, the demethylated site appeared in decline when the NaCl concentration larger than 100 mmol L1 (Fig. 4). 2.4

Sequence analysis of MSAP fragments

Ten differential fragments between the control and the 200 mmol L1 NaCl treatment were isolated and sequenced, of which 6 fragments were homologous with annotated sequences in GenBank (Table 4). The identity of the differential fragments at DNA methylation sites and some functional genes in cotton suggests that these methylatd fragments are probably involved in regulating the expression of salt-responsive genes or directly expressed in response to salt stress. According to the sequences of GH_TMO and G. barbadense gypsy retrotransposon reverse transcriptase gene that are homologous to fragments M2 and M3, 2 pairs of primers were designed for RT-PCR analysis. In the seedling leaves of cotton, the 2 genes only expressed in low levels in the control, and in the seedling roots, the 2 genes only

LI Xue-Lin et al. / Acta Agronomica Sinica, 2009, 35(4): 588–596

3

Fig. 4

Changing trends of DNA methylation and demethylation in cotton roots under NaCl stress

expressed under salt stress (Fig. 5). Therefore, it is inferred that salt stress induces demethylation of the 2 genes to adapt the environment.

Discussion

The dynamics of DNA methylation level plays an important role in plants to regulate gene, genome defense and the development and differentiation of cells [27, 28]. Generally, the hypermethylation of promoters and coding regions will prevent the integration of transcriptor complex and DNA, resulting in the suppression of gene expression and transgene silencing. However, demethylation is considered to be favorable to gene expression. Therefore, knowledge on the dynamics of genomic DNA methylation is helpful to disclose the mechanism of expression regulation and plant adaption to stresses. Similar to the results on Ceriops tagal [29] and Brassica napus [30], We also found that a low concentration of NaCl (100 mmol L1) stimulated seedling growth in cotton, but high

Table 4 Sequence analysis of MSAP fragments Differential

Length

Pattern b

E/HM a

Homologous sequence in GenBank

E-value

ES806581

GH_TMO G. hirsutum cDNA

3E54

GBU75247

G. barbadense strain Giza 45 gypsy retrotransposon reverse transcriptase gene

5E52

—

CO086416.1

GR_Ea G. raimondii cDNA clone GR_Ea04F21 3', mRNA sequence

3E57

(bp)

M2

120

AGG/TCC

II

ǿ

M3

138

AGG/TCC

II

ǿ

M6

237

AAC/TGC

II

Control

Accession

T200 Number

fragment

M1

156

AGG/TCC

I

Iǿ

EU532253.1

G. barbadense clone I6-1 ISSR marker genomic sequence

1E20

M4

132

AGG/TGA

—

Iǿǿ

CO071702

G. raimondii cDNA clone GR_Ea30D16 3', mRNA sequence

1E18

M5

78

AGC/TGT

I

Iǿ

EE611552

CHW (LMS) silver leaf sunflower Helianthus argophyllus cDNA clone

3E16

CHWL858, mRNA sequence a b

Primer combination used in amplification of the MSAP fragment; E: EcoR I primers; HM: Hpa II/Msp I primers. Banding pattern under 0 (control) and 200 mmol L1 (T200) NaCl treatments; “—” denotes band absence. Band types are referred to Fig. 2-b.

                 

Gbpolyubiquitin-1

Gene homologous to M3 Root T200

Root

Leaf

Control

T200

Control

Marker

T200

Control

T200

Root

Leaf

Control

Fig. 5

T200

T200

Control

Gbpolyubiquitin-1

Gene homologous to M2 Root

Leaf

Control

Marker

T200

Control

Leaf T200

Expressions of genes homologous to M2 and M3 in leaves and roots of cotton under NaCl concentrations of 200 (T200) and 0 mmol L1 (control) Gbpolyubiquitin-1 was amplified as a loading control.

Control

LI Xue-Lin et al. / Acta Agronomica Sinica, 2009, 35(4): 588–596

concentrations had opposite effects. The promotion of plant growth under low salt concentration is mainly due to the fact that Na+ is an essential element for cellular activity, especially in halophyte [31]. However, excess salt causes water deficit of plant cells at primary stage and salt-toxic damage at secondary stage, resulting in abnormal cellular metabolism and growth retardance. In addition, we also found that the numbers of lateral roots decreased significantly under salt stress. This result was in accordance with an earlier report by Spollen et al. [32]. The major reason for lateral root reduction is the repression of the initiation and elongation of lateral roots under water stress [33, 34]. Cytosine in DNA sequence is predominately methylated in higher plants, although the methylation level is different across plant varieties and tissues [27]. In this study, the percentage of MSAP site in cottonwas approximately 41%, which was higher than the results on cotton hybrid reported by Zhao et al. [25]. However, our result was similar as that in Aradopsis thaliana (35–43%) [35]. MSAP only presents cytosine methylation at CG and partial CCG sites, but invalid for testing methylation at other sites, such as CAG, CTG, and CCG sites, which are often methylated in plant genomes. Thus, the level of cytosine methylation in genomic DNA should be higher than the result from the present study. Stress by heavy metals, such as Cd and Pb, increased the level of DNA methylation in rice (Oryza sativa L.) and wheat (Triticum aestivum L.) [36]. Under water deficit condition, an increase level of cytosine methylation was also observed in root tips of pea (Pisum sativum L.) [37]. In this study, the level of genomic DNA methylation in the roots of cotton seedlings declined as the NaCl concentration increased. This result was in agreement with the report in clover (Trifolium repens) stressed by heavy metals [38]. It is inferred that the hypomethylation and gene expression induced by stress might be responsible for the decrease of global DNA methylation [13]. Hypomethylation is a simple and indirect way in response to stresses or a defense mechanism for regulating gene expression accurately. Therefore, the methylation variation of specific sequences is related to the changes of gene expression [39]. We found that the proportion of genomic DNA methylation site in roots of cotton seedlings went up with the increase of salt concentration, whereas the proportion of demethylated site decreased simultaneously (Fig. 5). This changing trend was also observed in Pinus silvestris in response to radiation [39]. In this study, when the cotton seedlings were growing in solution with 100 mmol L1 NaCl, the DNA demethylation level was higher than the methylation level, and the cotton seedlings showed accelerative growth. However, when the NaCl concentration reached 200 mmol L1, there were sharp decrease of demethylation and increase of methylation in seedling roots, and the growth of seedlings was obviously inhibited. This suggests that the alternation of

methylation status at some DNA sites can initiate a mechanism for responding to NaCl stress through regulating gene expression, leading to a relatively favorable condition for plant growth [36]. When plants exposed to a continuous stress, some genes may terminate expressions due to DNA methylation, thus, plants reduce nutrient consumptions and maintain the minimum growth. The genomic methylation is an important regulator for gene expression in plants. For instance, many endogenous genes can be activated by 5-azacytidine, which is an inhibitor of methylation [17]. In this study, 6 MSAP fragments were identified to share high homology with functionally characterized genes in GenBank (Table 4), of which M3 was deduced for coding a reverse transcriptase of retrotransposon. Retrotransposon is one of the most abundant elements in plant genomes. It is important in genomic recombination induced by environmental stresses [40, 41]. In plant genomes, some DNA methylation sites are included in the retrotransposon sequences. These sequences are methylated and silenced to protect the genomes of hosts. Cheng et al. [41] found that the transpositional activity of retrotransposon was negatively associated with the level of DNA methylation. In addition to adapting plant genomes to environmental stresses by transpositions, the transposon has a potential to alter the expression of adjacent genes [42, 43]. In this study, the RT-PCR results indicated that the expression level of the reverse transcriptase of retrotransposon increased in cotton roots under 200 mmol L1 NaCl treatment (Fig. 5), suggesting that the transcriptional activity of retrotransposon was enhanced in cotton roots under salt stress.

4

Conclusions

Cotton seedlings have different responses to different NaCl concentrations. The growth of cotton seedlings was promoted in the treatment of 100 mmol L1 NaCl, but inhibited in the treatment with 150 and 200 mmol L1 NaCl. The number of lateral root declined under salt stress. The methylation level of cotton genomic DNA decreased gradually as the NaCl concentration increased, resulting in some genes initially expressed in response to salt stress.

Acknowledgments This study was supported by the grants of the National High Technology Development Program of China (2006AA00105) and the National Innovation Program of Cotton Industry.

References [1]

Saze H, Mittelsten Scheid O, Paszkowski J. Maintenance of

LI Xue-Lin et al. / Acta Agronomica Sinica, 2009, 35(4): 588–596

[2]

[3] [4] [5]

[6]

[7]

[8]

[9]

[10]

[11] [12]

[13]

[14]

[15] [16]

[17]

[18]

CpG methylation is essential for epigenetic inheritance during plant gametogenesis. Nat Genet, 2003, 34: 65–69 Chan S W L, Henderson I R, Jacobsen S E. Gardening the genome DNA methylation in Arabidopsis thaliana. Nat Rev Genet, 2005, 6: 351–360 Razin A, Cedar H. DNA methylation and gene expression. Microbiol Mol Biol Rev, 1991, 55: 451–458 Li E. Chromatin modification and epigenetic reprogramming in mammalian development. Nat Rev Genet, 2002, 3: 662–673 Jablonka E, Goiten R, Marcus M, Cedar H. DNA hypomethylation causes an increase in DNase I sensitivity and an advance in the timing of replication of the entire X chromosome. Chromosoma, 1985, 93: 152–156 Jullien P E, Kinoshita T, Ohad N, Berger F. Maintenance of DNA methylation during the Arabidopsis life cycle is essential for parental imprinting. Plant Cell, 2006, 18: 1360–1372 Adams K L, Percifield R, Wendel J F. Organ-specific silencing of duplicated genes in a newly synthesized cotton allotetraploid. Genetics, 2004, 168: 2217–2226 Zluvova J, Janousek B, Vyskot B. Immuno-histchemical study of DNA methylation dynamics during plant development. J Exp Bot, 2001, 52: 2263–2273 Jaligot E, Beule T, Rival A. Methylation-sensitive RFLPs: Characterisation of two oil palm markers showing somaclonal variation-associated polymorphism. Theor Appl Genet, 2002, 104: 1263–1269 Mcclelland M, Nelson M, Raschke E. Effect of site-specific modification on resistriction endonuclease and DNA modification methyltransferases. Nucl Acids Res, 1994, 17: 3640–3659 Ashikawa I. Surveying CpG methylation at 5'-CCGG in the genomes of rice cultivars. Plant Mol Biol, 2001, 45: 31–39 Cervera M T, Ruiz-Garcia L, Martinez-Zapater J M. Analysis of DNA methylation in Arabidopsis thaliana based on methylation-sensitive AFLP markers. Mol Genet Genomics, 2002, 268: 543–552 Hao Y J, Deng X X. Stress treatments and DNA methylation affected the somatic embryogenesis of Citrus callus. Acta Bot Sin, 2002, 44: 673–677 Portis E, Acquadro A, Comino C, Lanteri S. Analysis of DNA methylation during germination pepper (Capsicum annuum L.) seeds using methylation-sensitive amplification polymorphism (MSAP). Plant Sci, 2004, 166: 169–178 Xiong L M, Karen S S, Zhu J K. Cell signaling during cold, drought, and salt stress. Plant Cell, 2002, 14(suppl): 165–183 Richards E J, Peacock W J, Dennis E S. DNA methylation, a key regulator of plant development and other processes. Curr Opin Genet Dev, 2000, 10: 217–223 Xiao W, Custard K D, Brown R C, Lemmon B E, Harada J J, Goldberg R B, Fischer R L. DNA methylation is critical for Arabidopsis embryogenesis and seed viability. Plant Cell, 2006, 18: 805–814 Finnegan E J, Genger R K, Kovac K, Kovac K, Peacock W J, Dennis E S. DNA methylation and the promotion of flowering by vernalization. Proc Natl Acad Sci USA, 1998, 95: 5824–5829

[19] Wassenegger M, Pelissier T. A model for RNA-mediated gene silencing in higher plants. Plant Mol Biol, 1998, 37: 349–362 [20] Edward K, Catherine A, Jim H, Mark A, Marc R. Cell-type-specific calcium responses to drought, salt and cold in the Arabidopsis root. Plant J, 2000, 23: 267–278 [21] Hu H H, Dai M Q, Yao J L, Xiao B Z, Li X H, Zhang Q F, Xiong L Z. Overexpressing a NAM, ATAF, and CUC (NAC) transcription factor enhances drought resistance and salt tolerance in rice. Proc Natl Acad Sci USA, 2006, 103: 12987–12992 [22] He X J, Mu R L, Cao W H, Zhang Z G, Zhang J S, Chen S Y. AtNAC2, a transcription factor downstream of ethylene and auxin signaling pathways, is involved in salt stress response and lateral root development. Plant J, 2005, 44: 903–916 [23] Lin Z X, Zhang X L, Nie Y C, He D H, Wu M Q. Construction of a genetic linkage map for cotton based on SRAP. Chin Sci Bull, 2003, 48: 2063–2067 [24] Zhu L F, Tu L L, Zeng F C, Liu D Q, Zhang X L. An improved simple protocol for isolation of high quality RNA from Gossypium spp. suitable for cDNA library construction. Acta Agron Sin, 2005, 31: 1657–1659 (in Chinese with English abstract) [25] Zhao Y, Yu S, Xing C, Fan S, Song M. Analysis of DNA methylation in cotton hybrids and their parents. Mol Biol, 2008, 42: 169–178 [26] Ye W W, Pang N C, Wang J J, Fan B X. Characteristics of absorbing, accumulating and distribution of Na+ under the salinity stress on cotton. Cotton Sci, 2006, 18: 279–283 (in Chinese with English abstract) [27] Richards E J. DNA methylation and plant development. Trends Genet, 1997, 13: 319–323 [28] Yoder J A, Walsh C P, Bester T H. Cytosine methylation and the ecology of intragenomic parasites. Trends Genet, 1997, 13: 335–340 [29] Khan M A. Experimental assessment of salinity tolerance of Ceriops tagal seedlings and saplings from the Indus delta. Pakistan Aquatic Bot, 2001, 70: 259–268 [30] Lu G Y, Wu X M, Chen B Y, Gao G Z, Xu K. Evaluation of genetic and epigenetic modification in rapeseed (Brassica napus) induced by salt stress. J Integr Plant Biol, 2007, 49: 1599–1607 [31] Parida A K, Das A B. Salt tolerance and salinity effects on plants: A review. Ecotoxicol Environ Saf, 2005, 60: 324–349 [32] Spollen W G, Sharp R E, Saab I N, Wu Y. Regulation of cell expansion in roots and shoots at low water potentials. In: Smith J A C, Griffiths H eds. Water Deficits: Plant Responses from Cell to Community. Oxford: BIOS Scientific Publishers, 1993. pp 37–52 [33] Van der Weele C M, Spollen W G, Sharp R E, Baskin T I. Growth of Arabidopsis thaliana seedlings under water deficit studied by control of water potential in nutrient-agar media. J Exp Bot, 2000, 51: 1555–1562 [34] Deak K I, Malamy J. Osmotic regulation of root system architecture. Plant J, 2005, 43: 17–28 [35] Cervera M T, Ruiz-Garcia L, Martinez-Zapater J M. Analysis of DNA methylation in Arabidopsis thaliana based on methylation-sensitive AFLP markers. Mol Genet Genomics,

LI Xue-Lin et al. / Acta Agronomica Sinica, 2009, 35(4): 588–596

2002, 268(4): 543–552 [36] Ge C L, Yang X Y, Liu X N, Sun J H, Luo S S, Wang Z G. Effect of heavy metal on levels of methylation in DNA of rice and wheat. J Plant Physiol Mol Biol, 2002, 28: 363–368 (in Chinese with English abstract) [37] Labra M, Ghiani A, Citterio S, Sgorbati S, Sala F, Vannini C, Ruffini-Castiglione M, Bracale M. Analysis of cytosine methylaion pattern in response to water deficit in pea root tips. Plant Biol, 2002, 4: 694–699 [38] Aina R, Sgorbati S, Santagostino A, Labra A, Ghiani A, Citterio S. Specific hypomethylation of DNA is induced by heavy metals in white clover and industrial hemp. Physiol Plant, 2004, 121: 472–480 [39] Kovalchuk O, Burke P, Arkhipov A, Kuchma N, Jill James S,

[40] [41]

[42]

[43]

Kovalchuk I, Pogribny I. Genome hypermethylation in Pinus silvestris of Chernobyl: A mechanism for radiation adaptation? Mutation Res, 2003, 529: 13–20 Kumar A, Bennetzen J L. Plant retrotransposons. Annu Rev Genet, 1999, 33: 479–532 Feschotte C, Jiang N, Wessler R S. Plant retrotransposable elements: Where genetics meets genomics. Nat Rev Genet, 2002, 3: 329–341 Cheng C, Daigen M, Hirochika H. Epigenetic regulation of the rice retrotransposon Tos17. Mol Genet Genomics, 2006, 276: 378–390 Kashkush K, Feldman M, Levy A A. Transcriptional activation of retrotransposons alters the expression of adjacent genes in wheat. Nat Genet, 2003, 33: 102–106