- Email: [email protected]
Molecular characterization of Mycobacterium bovis isolates from patients with tuberculosis in Baja California, Mexico
Infection, Genetics and Evolution 27 (2014) 1–5
Contents lists available at ScienceDirect
Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid
Molecular characterization of Mycobacterium bovis isolates from patients with tuberculosis in Baja California, Mexico Rafael Laniado-Laborín a,b,⇑, Raquel Muñiz-Salazar c,3, Rosa Alejandra García-Ortiz c,3, Adriana Carolina Vargas-Ojeda b,2, Cecilia Villa-Rosas a,1, Lorena Oceguera-Palao a,1 a b c
Facultad de Medicina y Psicología, Universidad Autónoma de Baja California, Calzada Tecnológico 14418, Mesa de Otay, 22390 Tijuana, Baja California, Mexico Clínica de Tuberculosis, Hospital General Tijuana, ISESALUD, Avenida Centenario 10851, Zona Rio, 22320 Tijuana, Baja California, Mexico Escuela de Ciencias de la Salud, Universidad Autónoma de Baja California, Blvd. Zertuche y Blvd. de los Lagos s/n, Fracc. Valle Dorado, 22890 Ensenada, Baja California, Mexico
a r t i c l e
i n f o
Article history: Received 7 January 2014 Received in revised form 23 June 2014 Accepted 25 June 2014 Available online 2 July 2014 Keywords: MIRU-VNTR Pyrazinamide Human–human transmission Bovis
a b s t r a c t The incidence of tuberculosis (TB) from Mycobacterium bovis in humans is likely to be underestimated and in some cases even ignored in most developing countries. This may be due to the difficulty of differentiating TB caused by either Mycobacterium tuberculosis or M. bovis. Our objectives were to determine the prevalence of M. bovis human disease among the patients referred for study to the Tuberculosis Laboratory of the Tijuana General Hospital in Baja California, Mexico and to characterize molecularly the clinical isolates using 8 loci of MIRU-VNTR. A cross-sectional analysis of all culture-proven cases of tuberculosis was conducted during the period from January 1, 2011 through June 30, 2013. Clinical isolates that exhibited resistance to pyrazinamide (Z) were submitted for molecular analysis. A total of 2699 clinical samples were cultured during the study period and 600 (22%) that tested positive were processed for drug susceptibility for first line drugs. Sixty-four (10.7%) of the tested isolates tested were resistant to Z, and 27 (4.5%) of those were subsequently identified molecularly as M. bovis. Three of the M. bovis isolates were polyresistant to Z, isoniazid (H), ethambutol (E) and rifampicin (R) (Z + H + E, Z + E and Z + R); the rest were only resistant only to Z. VNTR typing, based on the 8 VNTR loci commonly tested for M. bovis, detected 12 allelic profiles (genotypes). The real burden of M. bovis cases among the total reported human tuberculosis cases can only be known from especially designed studies in which, during a specific period, all specimens submitted to tuberculosis diagnosis in one or more laboratories are cultured on the appropriate media and the isolated mycobacteria are analyzed to differentiate M. bovis from M. tuberculosis and other Mycobacterium species. Ó 2014 Elsevier B.V. All rights reserved.
1. Introduction In most industrialized countries, Mycobacterium bovis plays a minor role in human disease due to the success of control measures such as milk pasteurization, meat inspection and the ⇑ Corresponding author. Address: Facultad de Medicina y Psicología, Universidad Autónoma de Baja California, Calzada Tecnológico 14418, Mesa de Otay, 22390 Tijuana, Baja California, Mexico. Tel.: +52 1 664 3687041, +52 664 9797500, +52 664 6343792. E-mail addresses: [email protected] (R. Laniado-Laborín), ramusal@uabc. edu.mx (R. Muñiz-Salazar), [email protected] (R.A. García-Ortiz), [email protected] (A.C. Vargas-Ojeda), [email protected] (C. Villa-Rosas), [email protected] (L. Oceguera-Palao). 1 Tel.: +52 664 9797500. 2 Tel.: +52 664 6343792. 3 Tel.: +52 646 1750707. http://dx.doi.org/10.1016/j.meegid.2014.06.020 1567-1348/Ó 2014 Elsevier B.V. All rights reserved.
compulsory herd testing (Hughes et al., 2003). Currently, human disease caused by M. bovis in developed countries is estimated to be around 1% of all tuberculosis (TB) cases, and sporadic cases occur either in elderly people by reactivation of ancient infections or in immigrants from countries where bovine TB has not been eradicated (Center for Disease Control and Prevention, 2005; Gibson et al., 2004; Hughes et al., 2003; Matos et al., 2010; Michel et al., 2010; Müller et al., 2013; Roring et al., 2004; Stone et al., 2012). The real incidence of TB from M. bovis in humans is likely to be underestimated and in some cases even ignored for most of the countries in the Latin America and the Caribbean Region (de Kantor et al., 2010) and its incidence is thought to account for up to 10% of cases of human TB (Etchechoury et al., 2010; Zumárraga et al., 2013) and no assessment of the global consequences of zoonotic TB has already been done. This may have
2
R. Laniado-Laborín et al. / Infection, Genetics and Evolution 27 (2014) 1–5
been partially caused by the difficulty of distinguishing TB caused by M. tuberculosis or M. bovis, which requires mycobacterial culture and the subsequent use of biochemical or molecular (e.g., genotyping) diagnostic methods. Furthermore, in low-income countries, facilities to identify the causative agent of TB are largely absent (Müller et al., 2013). The main mode of transmission of M. bovis to humans is believed to be from cattle via consumption of unpasteurized dairy products. Less frequently, aerosol inhalation following close contact with infectious cattle, e.g., on farms, abattoirs, or from other animals, includes household pets (Mandal et al., 2011). In fact, inter-human transmission of M. bovis, thought to be infrequent, has been reported world-wide (Evans et al., 2007; Sunder et al., 2009). Our objectives were to determine the prevalence of M. bovis human disease among the patients referred for study to the Tuberculosis Laboratory of the Tijuana General Hospital in Baja California, Mexico and to characterize molecularly the clinical isolates using 8 loci of MIRU-VNTR. 2. Materials and methods
M. tuberculosis H37Rv and M. bovis AN5 as controls. In addition, a negative control (nanopure water) was run for each set of PCR reactions and genotyped to check for contamination. 2.2.2. MIRU-VNTR genotyping All clinical isolates were genotyped using 9 loci of MIRUs-VNTR (ETR-A, ETR-B, ETR-D, ETR-E, QUB11a, QUB11b, QUB3232, QUB26, MIRU26), which were amplified using the recommended PCR conditions (Allix et al., 2006; Frothingham and Meeker-O’Connell, 1998; Roring et al., 2004; Skuce et al., 2002; Supply et al., 2001, 2006). We used M. tuberculosis H37Rv and M. bovis AN5 as controls. The forward primers were fluorescent-labeled with FAM, VIC, PET and NED (Applied Biosystems Inc.). All amplifications were performed on a Mycycler BIORAD thermal cycler. To ensure reproducibility and consistency in PCR amplification, approximately 5% of samples were re-amplified. In addition, a negative control (nanopure water) was run for each set of PCR reactions and genotyped to check for contamination. Amplified products were run on an ABI 310 automated DNA sequencer, and microsatellite alleles were visualized and scored in the program GeneMarker 1.97 (Softgenetics).
2.1. Patients and clinical isolates The study consisted of a cross-sectional analysis of all the culture-proven cases of tuberculosis reported by the Tuberculosis Laboratory of the Tijuana General Hospital, Mexico during the period January 1st 2011 to June 30th 2013. The TB laboratory serves as a reference laboratory for the northwest region of the state of Baja California (population in the region >2.2 million) (INEGI, 2013). All the clinical samples (sputum) were routinely cultured in liquid media BBL Mycobacteria Growth Indicator Tube (BBL™, MGIT™, Beckton Dickinson) and solid media (Löwenstein-Jensen and Stonebrinck medium, Beckton Dickenson). Drug susceptibility for first line antituberculosis drugs (isoniazid [H], rifampin [R], ethambutol [E], pyrazinamide [Z] and streptomycin [S]) was tested with the MGIT system (BACTEC™ MGIT™ 960 Mycobacterial Detection System). Identification is done only to determine whether or not the mycobacteria belongs to the M. tuberculosis complex, and additional tests to identify M. bovis are not routinely done for clinical purposes. Strains that tested resistant to Z were sent to the Molecular Epidemiology and Ecology Laboratory at the Health Sciences School, Universidad Autónoma de Baja California for molecular analysis.
2.2.3. pncA gene sequencing The complete gene pncA and the promoter (nucleotides 80 to 590) were amplified using primers: PR9-F 50 GGCGTCATGGACCCTATATC30 and PR10-R 30 CAACAGTTCATCCCGGTTC50 (Sekiguchi et al., 2007). PCR reactions were performed from 10 mM Tris pH 8, 1.5 mM MgCl2, 0.2 mM of each dNTPs, 10 lM of each primer, 1.25 U Taq polymerase (Sigma Aldrich), 100 ng DNA template and nanopure water to carry a final volume of 25 lL. The thermal cycling profile was 95 °C for 3 min, 35 cycles of 95 °C for 40 s; 57 °C for 30 s and 72 °C for 1 min, and 72 °C for 3 min. The PCR products were evaluated through agarose electrophoresis and Gelstar staining, visualized under UV light and comparing the fragment sizes to the Fermentas O’gene 100 bp DNA ladder. The amplification products were purified with ExoSAP-ITÒ (USBÒ/ AffymetrixÒ) and automatically sequenced in an ABI Prism 3100 Automated Capillary DNA sequencer (Applied BiosystemsÒ). The wild type pncA gene from M. tuberculosis H37Rv (Gene Bank accession number: 888260) was used as the reference sequence. Sequence files were examined using Codon Code Aligner v.3.0.2. (Codon Code Corporation, 2006) Multiple alignments were conducted in CLUSTAL X v 2.0 (Thompson et al., 1997) as implemented in MEGA v.5 (Tamura et al., 2011).
2.2. Genetic analysis The DNA was isolated from cultured cells. Three to four bacterial colonies were suspended in 100 lL lyses solution (10 mM Tris–HCl [pH 8.3], 2 mM MgCl2, 50 mM KCl) and incubated at 95 °C for 15 min. The homogenate was centrifuged at 5000 rpm for 5 min to separate phases. The supernatant was recovered and stored at 20 °C until the PCR analysis was performed (Marcos et al., 1999). The quantity and quality of the genomic DNA was evaluated by agarose electrophoresis and Gelstar (Lonza Rockland, Inc.) stain.
2.2.4. Analysis of VNTR profiles Allele size and frequency per locus and multilocus genotypes were determined using MSTools v.3.1.1. (Minch et al., 1995). Clinical isolates with identical MIRU-VNTR-8 genotypes were defined as belonging to the same cluster. The Hunter-Gaston index (HGI) was calculated to determine the discriminatory power for individual VNTR loci (Hunter and Gaston, 1988). 3. Results 3.1. Clinical isolates and molecular identification
2.2.1. Molecular species identification A single tube multiplex-PCR (m-PCR) approach to differentiate between M. bovis and M. tuberculosis was carried out. We amplified a unique 168-bp amplicon for M. bovis and 262-bp for M. tuberculosis. Primers and PCR conditions were used as reported by Bakshi et al. (2005, 2007). Besides, samples were identified as M. bovis amplifying the region RD1 and RD8 (Kim et al., 2013). To ensure reproducibility and consistency of PCR amplifications, approximately 5% of samples were re-amplified. We used
During the study period a total of 2699 clinical samples were cultured and 600 (22%) were further processed for drug susceptibility for first line drugs, the rest corresponded to negative cultures or cultures for treatment follow-up. Sixty-four (10.7%) of the isolates tested for drug resistance were resistant to Z, and 27 of those were subsequently identified molecularly as M. bovis, which corresponded to the sequence of GenBank Accession Number: AJ003103. All 27 cases had pulmonary TB and had never been
3
R. Laniado-Laborín et al. / Infection, Genetics and Evolution 27 (2014) 1–5
treated in the past. Mean age for the group was 28.7 ± 4.7 years; 20 patients were male. All subjects lived in an urban environment and none had an occupation that would expose them to a zoonosis; none of the cases was aware of having been in contact with a known case of pulmonary TB but all reported having eaten in the past some unpasteurized milk product (most commonly fresh cheese or cream). Three of the M. bovis isolates were polyresistant (Z + H + E, Z + E and Z + R); the rest were resistant only to Z. The pncA gene sequence analysis of all BC 27 isolates showed a point mutation, that altered the primary amino acid sequence of pyrazinamidase, H57D (nucleotide 169, C ? G) which has been described early in clinical isolates recovered from diverse geographic localities (Sreevatsan et al., 1997).
Table 2 Determination of heterogeneity at each of the loci amongst the 27 clinical isolates of Mycobacterium bovis collected in Baja California.
*
Locus
Number of isolates for each allelic profile by locus 1
2
3
4
MIRU 26 QUB 11b QUB 11a ETR-B QUB 26 ETR-A MIRU 04 MIRU 31
2 2 2 6 2 2 54 54
32 4 8 48 50 52
21 44 44
4
2
Allelic diversity (h)*
0.53 0.34 0.33 0.21 0.15 0.07 0.00 0.00
Hunter and Gaston (1988).
3.2. Analysis of VNTR profiles Locus QUB3232 showed a number of problems and was thus subsequently excluded from the final selection. We detected 12 different allelic profiles (samples with different number of copies in at least one locus of the ones analyzed) using eight loci. From which 19 isolates are organized in four main allelic profiles (1–4), while the remaining eight isolates had unique allelic profiles (5–12) (Table 1). The allelic diversity (h) obtained for each one of the loci was 0.00–0.53 (Table 2). The MIRU-26 locus showed the highest discriminatory power (h = 0.0.53) and the ETR-D and ETR-E showed null discriminatory power (h = 0.00). (Table 2). 4. Discussion In this study, 4.3% (26/600) of the clinical isolates recovered were M. bovis. The global median of M. bovis infections among human TB cases in the Americas has been reported at of 0.3% (range 0–33.9%); for most countries, M. bovis accounts for a negligible percentage of the TB cases. In contrast, high proportions Table 1 Molecular characteristics of M. bovis clinical isolates from humans in Baja California, Mexico.
⁄⁄
Isolate code
MIRU type*
Country of birth
Year collected
Genotype
BC084 BC094 BC106 BC118 BC273 BC328 BC329 BC333 BC335 BC337 BC338 BC339 BC340 BC341 BC342 BC343 BC345 BC347 BC348 BC482 BC513 BC560 BC589 BC660 BC663 BC666 BC672
35374394 3 5 3 7 4 3 11 3 3 5 3 7 4 3 11 4 3 5 3 7 4 3 11 4 3 6 3 7 3 3 11 4 3 3 3 7 4 3 11 4 3 5 3 7 3 3 11 4 3 6 3 7 4 3 11 4 3 5 3 7 4 3 11 4 3 5 3 7 3 3 11 6 35374394 3 6 3 7 4 3 11 6 3 6 3 7 4 3 11 4 3 5 3 7 4 3 11 3 3 5 3 7 4 3 11 4 3 5 3 7 4 4 11 4 3 5 3 7 4 3 11 4 3 6 3 7 4 3 11 4 3 6 3 7 4 3 11 4 36364271 3 6 3 7 4 3 11 4 35374394 3 5 3 7 4 3 11 4 3 5 3 7 4 3 11 4 36374394 3 6 3 7 4 3 11 4 3 5 3 7 4 3 11 4
Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico
2011 2011 2011 2011 2011 2011 2011 2011 2012 2012 2012 2012 2012 2012 2012 2012 2012 2012 2012 2012 2012 2012 2012 2012 2012 2013 2013
G1 G2 G3 G3 G5 G6 G7 G4 G3 G8 G1 G9 G4 G2 G3 G10 G3 G4 G4 G11 G4 G1 G3 G3 G12 G4 G3
G = Genotype. * The MIRU loci are listed in the order MIRU 04, MIRU 26, MIRU 31, ETR-A, ETR-B, QUB 26, QUB11a, QUB 11b.
of cases have been reported for specific areas of Mexico and the USA. In Mexico, the average percentage of M. bovis cases is 7.6% (range 0–31.6%), while in the USA, TB caused by M. bovis is usually traced to persons in Hispanic communities, mostly with origins in Mexico; 90% of all TB cases caused by M. bovis in the USA affect Hispanic people. This association is attributed to the consumption of unpasteurized, contaminated cheese produced in Mexico (Harris et al., 2007; Müller et al., 2013). Official reports in Mexico show that almost 30% of the milk produced in the country is sold unpasteurized, included the one that issued for the production of soft cheese (Center for Disease Control and Prevention, 2005) from which M. bovis has been isolated (Harris et al., 2007). There have been reports of a number of multidrug-resistant strains of M. bovis across the world (Cordova et al., 2012; de Jong et al., 2005; Durr et al., 2010; Gutiérrez et al., 1999; Romero et al., 2006). Furthermore, Rivero et al. (2001) in Spain (Málaga) reported a nosocomial outbreak of TB-MDR caused by M. bovis in 31 patients, 30 of whom were infected with human immunodeficiency virus; all the patients died of progressive tuberculosis. All M. bovis strains had identical spoligotyping patterns and showed resistance to 12 antituberculosis drugs. In all 31 cases, the strains of M. bovis showed resistance to H, R, E, Z, S, aminosalicylic acid, clarithromycin, ethionamide, ofloxacin, capreomycin, cycloserine, and amikacin. For many years, the occurrence of human-to-human airborne transmission of this organism was a topic of debate because such transmission was difficult to prove. However, recent genetic fingerprinting techniques have provided evidence of human-tohuman M. bovis transmission (LoBue et al., 2004). Disease caused by M. bovis and M. tuberculosis cannot be distinguished clinically, radiographically, or pathologically in individual patients; the rates of cavitary pulmonary disease and AFB sputum smear-positive disease, two of the most important indicators of infectiousness in TB patients, are similar for M. bovis and M. tuberculosis (LoBue et al., 2003), therefore, the distinction between these two causative agents requires laboratory testing (Hlavsa et al., 2008). Three of our patients had a M. bovis strain resistant to other drugs (Z + H + E, Z + E and Z + R) besides Z, which is indicative of human-to-human transmission. Based on the fact that the only presentation was pulmonary and that H and R are not used in veterinary practice, our data suggests that these isolates may have been acquired from a human source (Hughes et al., 2003); occupational exposure was not a risk factor in these patients since none had a history of contact with cattle. The human disease caused by M. bovis is probably underreported as a result of diagnostic limitations. For many low-income countries, a mycobacterial culture is usually an expensive and unavailable option in comparison to the cheaper and quicker acid-fast staining (Etchechoury et al., 2010); this rapid, low-cost and relatively high specific technique allows for the detection of
4
R. Laniado-Laborín et al. / Infection, Genetics and Evolution 27 (2014) 1–5
the highly infectious pulmonary cases but does not allow species identification. In addition, in developed countries where culture is routinely used in the diagnosis of TB, many laboratories do not identify positive cultures beyond the level of the M. tuberculosis complex and in many laboratories where culture is available, only Lowenstein-Jensen solid culture medium is used. Lowenstein–Jensen medium is supplemented with glycerol, which does not promote M. bovis growth. The ideal solid media for M. bovis isolation is an egg medium supplemented with pyruvate (Stonebrink medium) (Cordova et al., 2012). The identification of M. bovis is not only an epidemiologic curiosity; since M. bovis is intrinsically resistant to Z (a critical drug of the standard 6-month, short-course regimen for M. tuberculosis due to its early sterilizing activity), treatment for M. bovis is usually recommended to extend to 9 months of isoniazid and rifampin instead of the standardized 6-month treatment regimen to reduce the risk of failure or relapse (Allix-Béguec et al., 2010; Müller et al., 2013; Rodwell et al., 2010; Stone et al., 2012). Our study has several methodological limitations: 1. In Mexico, as in most developing countries, diagnosis of tuberculosis is mainly based on microscopy results. In our region, approximately 25% of new cases are submitted to the laboratory for culture. 2. We submitted only M. tuberculosis strains that were resistant to Z for genetic analysis. False negative results for the MGIT system Z test has been reported at 5% (Hughes et al., 2003); some strains of M. bovis with this screening strategy might have not been detected. 3. Finally, another source of bias in our study is related to the type of solid culture medium utilized for human pulmonary tuberculosis samples. In the past, our laboratory used exclusively the Lowenstein–Jensen medium supplemented with glycerol, which does not promote M. bovis growth. M. bovis grows faster on egg medium supplemented with pyruvate (Stonebrink medium) (Etchechoury et al., 2010). Since 2013, when we detected the presence of M. bovis as an etiologic agent among our patients we decided to implement in our laboratory the routine of inoculating every sample in both types of solid medium. This also would yield some false negative culture results. However, is important to note that these sources of bias would actually result in an underestimation the importance of M. bovis as a human pathogen in the region. 5. Conclusions The real burden of M. bovis cases among the total of human tuberculosis cases reported can only be known from especially designed studies in which, during a specific period, all specimens submitted to tuberculosis diagnosis in one or more laboratories are cultured on the appropriate media and the isolated mycobacteria are analyzed to differentiate M. bovis from M. tuberculosis and other Mycobacterium species. Efforts to eradicate M. bovis in humans should also include the eradication of the disease in cattle, increasing dairy products pasteurization providing education about the dangers of consuming unpasteurized dairy products. Monitoring of both, human and bovine tuberculosis are essential in the control and eradication programs of tuberculosis. In addition, it is relevant to use molecular markers, as MIRU-VNTR analysis for typing human M. bovis isolates. Acknowledgements This project was sponsored by the 14th Internal Call for Support to Investigation Projects of the UABC (Project No. 4276) and by the
CONACYT Grant No. 166624 ‘‘Epidemiología molecular de Mycobacterium tuberculosis en la frontera Noroeste México-Estados Unidos’’. M. Sc. Nelva L. Victoria-Cota and M. Sc. Norma Martínez Cisneros gave technical support. References Allix, C., Walravens, K., Saegerman, C., Godfroid, J., Supply, P., Fauville-Dufaux, M., 2006. Evaluation of the epidemiological relevance of variable-number tandemrepeat genotyping of Mycobacterium bovis and comparison of the method with IS6110 restriction fragment length polymorphism analysis and spoligotyping. J. Clin. Microbiol. 44, 1951–1962. Allix-Béguec, C., Fauville-Dufaux, M., Stoffels, K., Ommeslag, D., Walravens, K., Saegerman, C., Supply, P., 2010. Importance of identifying Mycobacterium bovis as a causative agent of human tuberculosis. Eur. Res. J. 35, 692–694. Bakshi, C.S., Shah, D.H., Verma, R., Singh, R.K., Malik, M., 2005. Rapid differentiation of Mycobacterium bovis and Mycobacterium tuberculosis based on a 12.7-kb fragment by a single tube multiplex-PCR. Vet. Microbiol. 109, 211–216. Bakshi, C.S., Shah, D.H., Verma, R., Singh, R.K., Malik, M., 2007. Corrigendum to ‘‘Rapid differentiation of Mycobacterium bovis and Mycobacterium tuberculosis based on a 12.7-kb fragment by a single tube multiplex-PCR’’. Vet. Microbiol. 109 (2005), 211–216. Center for Disease Control and Prevention, 2005. Human tuberculosis caused by Mycobacterium bovis New York City, 2001–2004. MMWR Morb. Mortal. Wkly. Rep. 54, 605–608. Codon Code Corporation, 2006. Codon Code Aligner.. Consulted on September 20, 2013. Cordova, E., Gonzalo, X., Boschi, A., Lossa, M., Robles, M., Poggi, S., Ambroggi, M., 2012. Human Mycobacterium bovis infection in Buenos Aires: epidemiology, microbiology and clinical presentation. Int. J. Tuberculosis Lung. Dis. 16, 415– 417. de Jong, B.C., Onipede, A., Pym, A.S., Gagneux, S., Aga, R.S., DeRiemer, K., Small, P.M., 2005. Does resistance to pyrazinamide accurately indicate the presence of Mycobacterium bovis? J. Clin. Microbiol. 43, 3530–3532. de Kantor, I.N., LoBue, P.A., Thoen, C.O., 2010. Human tuberculosis caused by Mycobacterium bovis in the United States, Latin America and the Caribbean. Int. J. Tuberculosis Lung. Dis. 14, 1369–1373. Durr, P., Hewinson, R., Clifton-Hadley, R., 2010. Molecular epidemiology of bovine tuberculosis I. Mycobacterium bovis genotyping. Rev. Sci. Tech. Off. Int. Epizoot. 19, 675–688. Etchechoury, I., Valencia, G., Morcillo, N., Sequeira, M., Imperiale, B., López, M., Caimi, K., Zumárraga, M., Cataldi, A., Romano, M., 2010. Molecular typing of Mycobacterium bovis isolates in Argentina: first description of a person-toperson transmission case. Zoonoses Public Health 57, 375–381. Evans, J.T., Smith, E.G., Banerjee, A., Smith, R.M., Dale, J., Innes, J.A., Hunt, D., Tweddell, A., Wood, A., Anderson, C., Hewinson, R.G., Smith, N.H., Hawkey, P.M., Sonnenberg, P., 2007. Cluster of human tuberculosis caused by Mycobacterium bovis: evidence for person-to-person transmission in the UK. Lancet 369, 1270– 1276. Frothingham, R., Meeker-O’Connell, W.A., 1998. Genetic diversity in the Mycobacterium tuberculosis complex based on variable numbers of tandem DNA repeats. Microbiology 144, 1189–1196. Gibson, A.L., Hewinson, G., Goodchild, T., Watt, B., Story, A., Inwald, J., Drobniewski, F.A., 2004. Molecular epidemiology of disease due to Mycobacterium bovis in humans in the United Kingdom. J. Clin. Microbiol. 42, 431–434. Gutiérrez, M., Galán, J., Blázquez, J., Bouvet, E., Vincent, V., 1999. Molecular markers demonstrate that the first described multidrug-resistant Mycobacterium bovis outbreak was due to Mycobacterium tuberculosis. J. Clin. Microbiol. 37, 971–975. Harris, N.B., Payeur, J., Bravo, D., Osorio, R., Stuber, T., Farrell, D., Paulson, D., Treviso, S., Mikolon, A., Rodriguez-Lainz, A., Cernek-Hoskins, S., Rast, R., Ginsberg, M., Kinde, H., 2007. Recovery of Mycobacterium bovis from soft fresh cheese originating in Mexico. Appl. Environ. Microbiol. 73, 1025–1028. Hlavsa, M.C., Moonan, P.K., Cowan, L.S., Navin, T.R., Kammerer, J.S., Morlock, G.P., Crawford, J.T., LoBue, P.A., 2008. Human tuberculosis due to Mycobacterium bovis in the United States, 1995–2005. Clin. Infect. Dis. 47, 168–175. Hughes, V., Skuce, R.A., Doig, C., Stevenson, K.S.J., Watt, B., 2003. Analysis of multidrug-resistant Mycobacterium bovis from three clinical samples from Scotland. Int. J. Tuberculosis Lung Dis. 7, 1191–1198. Hunter, R., Gaston, M., 1988. Numerical index of the discriminatory ability of typing systems: an application of Simpson’s index of diversity. J. Clin. Microbiol. 26, 2465–2466. INEGI, 2013. . Consulted on October 30, 2013. Kim, Y., Choi, Y., Jeon, B.-Y., Jin, H., Cho, S.-N., Lee, H., 2013. A simple and efficient multiplex PCR assay for the identification of Mycobacterium genus and Mycobacterium tuberculosis complex to the species level. Yonsei Med. J. 54, 1220–1226. LoBue, P., Betacourt, W., Peter, C., Moser, K., 2003. Epidemiology of Mycobacterium bovis disease in San Diego Country, 1994–2000. Int. J. Tuberculosis Lung. Dis. 7, 180–185. LoBue, P., LeClair, J., Moser, K., 2004. Contact investigation for cases of pulmonary Mycobacterium bovis. Int. J. Tuberculosis Lung Dis. 8, 868–872. Mandal, S., Bradshaw, L., Anderson, L., Brown, T., Evans, J., Drobniewski, F., Smith, G., Magee, J., Barrett, A., Blatchford, O., Laurenson, I., Seagar, A., Ruddy, M., White,
R. Laniado-Laborín et al. / Infection, Genetics and Evolution 27 (2014) 1–5 P., Myers, R., Hawkey, P., Abubakar, I., 2013. Investigating transmission of tuberculosis caused by Mycobacterium tuberculosis in the United Kingdom in 2005 to 2008. J. Clin. Microbiol. 49, 1943–1950. Marcos, J.Y., Cascon-Soriano, A., Sanchez-Salazar, M., Hernanz-Moral, C., SuarezRamos, S., Smeltzer, M.S., Naharro-Carrasco, G., 1999. Rapid identification and typing of Staphylococcus aureus by PCR-restriction fragment length polymorphism analysis of the aroA gene. J. Clin. Microbiol. 37, 570–574. Matos, F., Amado, A., Botelho, A., 2010. Molecular typing of Mycobacterium bovis isolated in the first outbreak of bovine tuberculosis in the Azores Islands: a case report. Vet. Med. (PRAHA) 55, 133–136. Michel, A.L., Müller, B., van Helden, P.D., 2010. Mycobacterium bovis at the animal– human interface: a problem, or not? Vet. Microbiol. 140, 371–381. Minch, E., Ruiz-Linares, A., Goldstein, D., Feldman, M., Cavalli-Sforza, L., 1995. MICROSAT, The microsatellite distance program.
5
Skuce, R.A., McCorry, T.P., McCarroll, J.F., Roring, S.M.M., Scott, A.N., Brittain, D., Hughes, S.L., Hewinson, R.G., Neill, S.D., 2002. Discrimination of Mycobacterium tuberculosis complex bacteria using novel VNTR-PCR targets. Microbiology 148, 519–528. Sreevatsan, S., Pan, X., Zhang, Y., Kreiswirth, B.N., Musser, J.M., 1997. Mutations associated with pyrazinamide resistance in pncA of Mycobacterium tuberculosis complex organisms. Antimicrob. Agents Chemother. 41, 636–640. Stone, M.J., Brown, T.J., Drobniewski, F.A., 2012. Human Mycobacterium bovis infections in London Southeast England. J. Clin. Microbiol. 50, 164–165. Sunder, S., Lanotte, P., Godreuil, S., Martin, C., Boschiroli, M.L., Besnier, J.M., 2009. Human-to-Human transmission of tuberculosis caused by Mycobacterium bovis in immunocompetent patients. J. Clin. Microbiol. 47, 1249–1251. Supply, P., Allix, C., Lesjean, S., Cardoso-Oelemann, M., Rusch-Gerdes, S., Willery, E., Savine, E., de Haas, P., van Deutekom, H., Roring, S., Bifani, P., Kurepina, N., Kreiswirth, B., Sola, C., Rastogi, N., Vatin, V., Gutierrez, M.C., Fauville, M., Niemann, S., Skuce, R., Kremer, K., Locht, C., van Soolingen, D., 2006. Proposal for standardization of optimized mycobacterial interspersed repetitive unitvariable-number tandem repeat typing of Mycobacterium tuberculosis. J. Clin. Microbiol. 44, 4498–4510. Supply, P., Lesjean, S., Savine, E., Kremer, K., Van Soolingen, D., Locht, C., 2001. Automated high-throughput genotyping for study of global epidemiology of Mycobacterium tuberculosis based on mycobacterial interspersed repetitive units. J. Clin. Microbiol. 39, 3563–3571. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Thompson, J., Gibson, T., Plewnial, F., Jeanmougin, F., Higgins, D., 1997. The CLUSTAL-Windows interface: flexible strategies for multiple alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882. Zumárraga, M.J., Arriaga, C., Barandiaran, S., Cobos Marín, L., de Waard, J., Garcia, I.E., Figueiredo, T., Figueroa, A., Giménez, F., Gomes, H.M., Gonzalez-y-Merchand, J.A., Macías, A., Milián Suazo, F., Rodríguez, C.A.R., Santillán, M.A., Suffys, P.N., Trangoni, M.D., Zárraga, A.M., Cataldi, A., 2013. Understanding the relationship between Mycobacterium bovis spoligotypes from cattle in Latin American Countries. Res. Vet. Sci. 94, 9–21.
Contents lists available at ScienceDirect
Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid
Molecular characterization of Mycobacterium bovis isolates from patients with tuberculosis in Baja California, Mexico Rafael Laniado-Laborín a,b,⇑, Raquel Muñiz-Salazar c,3, Rosa Alejandra García-Ortiz c,3, Adriana Carolina Vargas-Ojeda b,2, Cecilia Villa-Rosas a,1, Lorena Oceguera-Palao a,1 a b c
Facultad de Medicina y Psicología, Universidad Autónoma de Baja California, Calzada Tecnológico 14418, Mesa de Otay, 22390 Tijuana, Baja California, Mexico Clínica de Tuberculosis, Hospital General Tijuana, ISESALUD, Avenida Centenario 10851, Zona Rio, 22320 Tijuana, Baja California, Mexico Escuela de Ciencias de la Salud, Universidad Autónoma de Baja California, Blvd. Zertuche y Blvd. de los Lagos s/n, Fracc. Valle Dorado, 22890 Ensenada, Baja California, Mexico
a r t i c l e
i n f o
Article history: Received 7 January 2014 Received in revised form 23 June 2014 Accepted 25 June 2014 Available online 2 July 2014 Keywords: MIRU-VNTR Pyrazinamide Human–human transmission Bovis
a b s t r a c t The incidence of tuberculosis (TB) from Mycobacterium bovis in humans is likely to be underestimated and in some cases even ignored in most developing countries. This may be due to the difficulty of differentiating TB caused by either Mycobacterium tuberculosis or M. bovis. Our objectives were to determine the prevalence of M. bovis human disease among the patients referred for study to the Tuberculosis Laboratory of the Tijuana General Hospital in Baja California, Mexico and to characterize molecularly the clinical isolates using 8 loci of MIRU-VNTR. A cross-sectional analysis of all culture-proven cases of tuberculosis was conducted during the period from January 1, 2011 through June 30, 2013. Clinical isolates that exhibited resistance to pyrazinamide (Z) were submitted for molecular analysis. A total of 2699 clinical samples were cultured during the study period and 600 (22%) that tested positive were processed for drug susceptibility for first line drugs. Sixty-four (10.7%) of the tested isolates tested were resistant to Z, and 27 (4.5%) of those were subsequently identified molecularly as M. bovis. Three of the M. bovis isolates were polyresistant to Z, isoniazid (H), ethambutol (E) and rifampicin (R) (Z + H + E, Z + E and Z + R); the rest were only resistant only to Z. VNTR typing, based on the 8 VNTR loci commonly tested for M. bovis, detected 12 allelic profiles (genotypes). The real burden of M. bovis cases among the total reported human tuberculosis cases can only be known from especially designed studies in which, during a specific period, all specimens submitted to tuberculosis diagnosis in one or more laboratories are cultured on the appropriate media and the isolated mycobacteria are analyzed to differentiate M. bovis from M. tuberculosis and other Mycobacterium species. Ó 2014 Elsevier B.V. All rights reserved.
1. Introduction In most industrialized countries, Mycobacterium bovis plays a minor role in human disease due to the success of control measures such as milk pasteurization, meat inspection and the ⇑ Corresponding author. Address: Facultad de Medicina y Psicología, Universidad Autónoma de Baja California, Calzada Tecnológico 14418, Mesa de Otay, 22390 Tijuana, Baja California, Mexico. Tel.: +52 1 664 3687041, +52 664 9797500, +52 664 6343792. E-mail addresses: [email protected] (R. Laniado-Laborín), ramusal@uabc. edu.mx (R. Muñiz-Salazar), [email protected] (R.A. García-Ortiz), [email protected] (A.C. Vargas-Ojeda), [email protected] (C. Villa-Rosas), [email protected] (L. Oceguera-Palao). 1 Tel.: +52 664 9797500. 2 Tel.: +52 664 6343792. 3 Tel.: +52 646 1750707. http://dx.doi.org/10.1016/j.meegid.2014.06.020 1567-1348/Ó 2014 Elsevier B.V. All rights reserved.
compulsory herd testing (Hughes et al., 2003). Currently, human disease caused by M. bovis in developed countries is estimated to be around 1% of all tuberculosis (TB) cases, and sporadic cases occur either in elderly people by reactivation of ancient infections or in immigrants from countries where bovine TB has not been eradicated (Center for Disease Control and Prevention, 2005; Gibson et al., 2004; Hughes et al., 2003; Matos et al., 2010; Michel et al., 2010; Müller et al., 2013; Roring et al., 2004; Stone et al., 2012). The real incidence of TB from M. bovis in humans is likely to be underestimated and in some cases even ignored for most of the countries in the Latin America and the Caribbean Region (de Kantor et al., 2010) and its incidence is thought to account for up to 10% of cases of human TB (Etchechoury et al., 2010; Zumárraga et al., 2013) and no assessment of the global consequences of zoonotic TB has already been done. This may have
2
R. Laniado-Laborín et al. / Infection, Genetics and Evolution 27 (2014) 1–5
been partially caused by the difficulty of distinguishing TB caused by M. tuberculosis or M. bovis, which requires mycobacterial culture and the subsequent use of biochemical or molecular (e.g., genotyping) diagnostic methods. Furthermore, in low-income countries, facilities to identify the causative agent of TB are largely absent (Müller et al., 2013). The main mode of transmission of M. bovis to humans is believed to be from cattle via consumption of unpasteurized dairy products. Less frequently, aerosol inhalation following close contact with infectious cattle, e.g., on farms, abattoirs, or from other animals, includes household pets (Mandal et al., 2011). In fact, inter-human transmission of M. bovis, thought to be infrequent, has been reported world-wide (Evans et al., 2007; Sunder et al., 2009). Our objectives were to determine the prevalence of M. bovis human disease among the patients referred for study to the Tuberculosis Laboratory of the Tijuana General Hospital in Baja California, Mexico and to characterize molecularly the clinical isolates using 8 loci of MIRU-VNTR. 2. Materials and methods
M. tuberculosis H37Rv and M. bovis AN5 as controls. In addition, a negative control (nanopure water) was run for each set of PCR reactions and genotyped to check for contamination. 2.2.2. MIRU-VNTR genotyping All clinical isolates were genotyped using 9 loci of MIRUs-VNTR (ETR-A, ETR-B, ETR-D, ETR-E, QUB11a, QUB11b, QUB3232, QUB26, MIRU26), which were amplified using the recommended PCR conditions (Allix et al., 2006; Frothingham and Meeker-O’Connell, 1998; Roring et al., 2004; Skuce et al., 2002; Supply et al., 2001, 2006). We used M. tuberculosis H37Rv and M. bovis AN5 as controls. The forward primers were fluorescent-labeled with FAM, VIC, PET and NED (Applied Biosystems Inc.). All amplifications were performed on a Mycycler BIORAD thermal cycler. To ensure reproducibility and consistency in PCR amplification, approximately 5% of samples were re-amplified. In addition, a negative control (nanopure water) was run for each set of PCR reactions and genotyped to check for contamination. Amplified products were run on an ABI 310 automated DNA sequencer, and microsatellite alleles were visualized and scored in the program GeneMarker 1.97 (Softgenetics).
2.1. Patients and clinical isolates The study consisted of a cross-sectional analysis of all the culture-proven cases of tuberculosis reported by the Tuberculosis Laboratory of the Tijuana General Hospital, Mexico during the period January 1st 2011 to June 30th 2013. The TB laboratory serves as a reference laboratory for the northwest region of the state of Baja California (population in the region >2.2 million) (INEGI, 2013). All the clinical samples (sputum) were routinely cultured in liquid media BBL Mycobacteria Growth Indicator Tube (BBL™, MGIT™, Beckton Dickinson) and solid media (Löwenstein-Jensen and Stonebrinck medium, Beckton Dickenson). Drug susceptibility for first line antituberculosis drugs (isoniazid [H], rifampin [R], ethambutol [E], pyrazinamide [Z] and streptomycin [S]) was tested with the MGIT system (BACTEC™ MGIT™ 960 Mycobacterial Detection System). Identification is done only to determine whether or not the mycobacteria belongs to the M. tuberculosis complex, and additional tests to identify M. bovis are not routinely done for clinical purposes. Strains that tested resistant to Z were sent to the Molecular Epidemiology and Ecology Laboratory at the Health Sciences School, Universidad Autónoma de Baja California for molecular analysis.
2.2.3. pncA gene sequencing The complete gene pncA and the promoter (nucleotides 80 to 590) were amplified using primers: PR9-F 50 GGCGTCATGGACCCTATATC30 and PR10-R 30 CAACAGTTCATCCCGGTTC50 (Sekiguchi et al., 2007). PCR reactions were performed from 10 mM Tris pH 8, 1.5 mM MgCl2, 0.2 mM of each dNTPs, 10 lM of each primer, 1.25 U Taq polymerase (Sigma Aldrich), 100 ng DNA template and nanopure water to carry a final volume of 25 lL. The thermal cycling profile was 95 °C for 3 min, 35 cycles of 95 °C for 40 s; 57 °C for 30 s and 72 °C for 1 min, and 72 °C for 3 min. The PCR products were evaluated through agarose electrophoresis and Gelstar staining, visualized under UV light and comparing the fragment sizes to the Fermentas O’gene 100 bp DNA ladder. The amplification products were purified with ExoSAP-ITÒ (USBÒ/ AffymetrixÒ) and automatically sequenced in an ABI Prism 3100 Automated Capillary DNA sequencer (Applied BiosystemsÒ). The wild type pncA gene from M. tuberculosis H37Rv (Gene Bank accession number: 888260) was used as the reference sequence. Sequence files were examined using Codon Code Aligner v.3.0.2. (Codon Code Corporation, 2006) Multiple alignments were conducted in CLUSTAL X v 2.0 (Thompson et al., 1997) as implemented in MEGA v.5 (Tamura et al., 2011).
2.2. Genetic analysis The DNA was isolated from cultured cells. Three to four bacterial colonies were suspended in 100 lL lyses solution (10 mM Tris–HCl [pH 8.3], 2 mM MgCl2, 50 mM KCl) and incubated at 95 °C for 15 min. The homogenate was centrifuged at 5000 rpm for 5 min to separate phases. The supernatant was recovered and stored at 20 °C until the PCR analysis was performed (Marcos et al., 1999). The quantity and quality of the genomic DNA was evaluated by agarose electrophoresis and Gelstar (Lonza Rockland, Inc.) stain.
2.2.4. Analysis of VNTR profiles Allele size and frequency per locus and multilocus genotypes were determined using MSTools v.3.1.1. (Minch et al., 1995). Clinical isolates with identical MIRU-VNTR-8 genotypes were defined as belonging to the same cluster. The Hunter-Gaston index (HGI) was calculated to determine the discriminatory power for individual VNTR loci (Hunter and Gaston, 1988). 3. Results 3.1. Clinical isolates and molecular identification
2.2.1. Molecular species identification A single tube multiplex-PCR (m-PCR) approach to differentiate between M. bovis and M. tuberculosis was carried out. We amplified a unique 168-bp amplicon for M. bovis and 262-bp for M. tuberculosis. Primers and PCR conditions were used as reported by Bakshi et al. (2005, 2007). Besides, samples were identified as M. bovis amplifying the region RD1 and RD8 (Kim et al., 2013). To ensure reproducibility and consistency of PCR amplifications, approximately 5% of samples were re-amplified. We used
During the study period a total of 2699 clinical samples were cultured and 600 (22%) were further processed for drug susceptibility for first line drugs, the rest corresponded to negative cultures or cultures for treatment follow-up. Sixty-four (10.7%) of the isolates tested for drug resistance were resistant to Z, and 27 of those were subsequently identified molecularly as M. bovis, which corresponded to the sequence of GenBank Accession Number: AJ003103. All 27 cases had pulmonary TB and had never been
3
R. Laniado-Laborín et al. / Infection, Genetics and Evolution 27 (2014) 1–5
treated in the past. Mean age for the group was 28.7 ± 4.7 years; 20 patients were male. All subjects lived in an urban environment and none had an occupation that would expose them to a zoonosis; none of the cases was aware of having been in contact with a known case of pulmonary TB but all reported having eaten in the past some unpasteurized milk product (most commonly fresh cheese or cream). Three of the M. bovis isolates were polyresistant (Z + H + E, Z + E and Z + R); the rest were resistant only to Z. The pncA gene sequence analysis of all BC 27 isolates showed a point mutation, that altered the primary amino acid sequence of pyrazinamidase, H57D (nucleotide 169, C ? G) which has been described early in clinical isolates recovered from diverse geographic localities (Sreevatsan et al., 1997).
Table 2 Determination of heterogeneity at each of the loci amongst the 27 clinical isolates of Mycobacterium bovis collected in Baja California.
*
Locus
Number of isolates for each allelic profile by locus 1
2
3
4
MIRU 26 QUB 11b QUB 11a ETR-B QUB 26 ETR-A MIRU 04 MIRU 31
2 2 2 6 2 2 54 54
32 4 8 48 50 52
21 44 44
4
2
Allelic diversity (h)*
0.53 0.34 0.33 0.21 0.15 0.07 0.00 0.00
Hunter and Gaston (1988).
3.2. Analysis of VNTR profiles Locus QUB3232 showed a number of problems and was thus subsequently excluded from the final selection. We detected 12 different allelic profiles (samples with different number of copies in at least one locus of the ones analyzed) using eight loci. From which 19 isolates are organized in four main allelic profiles (1–4), while the remaining eight isolates had unique allelic profiles (5–12) (Table 1). The allelic diversity (h) obtained for each one of the loci was 0.00–0.53 (Table 2). The MIRU-26 locus showed the highest discriminatory power (h = 0.0.53) and the ETR-D and ETR-E showed null discriminatory power (h = 0.00). (Table 2). 4. Discussion In this study, 4.3% (26/600) of the clinical isolates recovered were M. bovis. The global median of M. bovis infections among human TB cases in the Americas has been reported at of 0.3% (range 0–33.9%); for most countries, M. bovis accounts for a negligible percentage of the TB cases. In contrast, high proportions Table 1 Molecular characteristics of M. bovis clinical isolates from humans in Baja California, Mexico.
⁄⁄
Isolate code
MIRU type*
Country of birth
Year collected
Genotype
BC084 BC094 BC106 BC118 BC273 BC328 BC329 BC333 BC335 BC337 BC338 BC339 BC340 BC341 BC342 BC343 BC345 BC347 BC348 BC482 BC513 BC560 BC589 BC660 BC663 BC666 BC672
35374394 3 5 3 7 4 3 11 3 3 5 3 7 4 3 11 4 3 5 3 7 4 3 11 4 3 6 3 7 3 3 11 4 3 3 3 7 4 3 11 4 3 5 3 7 3 3 11 4 3 6 3 7 4 3 11 4 3 5 3 7 4 3 11 4 3 5 3 7 3 3 11 6 35374394 3 6 3 7 4 3 11 6 3 6 3 7 4 3 11 4 3 5 3 7 4 3 11 3 3 5 3 7 4 3 11 4 3 5 3 7 4 4 11 4 3 5 3 7 4 3 11 4 3 6 3 7 4 3 11 4 3 6 3 7 4 3 11 4 36364271 3 6 3 7 4 3 11 4 35374394 3 5 3 7 4 3 11 4 3 5 3 7 4 3 11 4 36374394 3 6 3 7 4 3 11 4 3 5 3 7 4 3 11 4
Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico Mexico
2011 2011 2011 2011 2011 2011 2011 2011 2012 2012 2012 2012 2012 2012 2012 2012 2012 2012 2012 2012 2012 2012 2012 2012 2012 2013 2013
G1 G2 G3 G3 G5 G6 G7 G4 G3 G8 G1 G9 G4 G2 G3 G10 G3 G4 G4 G11 G4 G1 G3 G3 G12 G4 G3
G = Genotype. * The MIRU loci are listed in the order MIRU 04, MIRU 26, MIRU 31, ETR-A, ETR-B, QUB 26, QUB11a, QUB 11b.
of cases have been reported for specific areas of Mexico and the USA. In Mexico, the average percentage of M. bovis cases is 7.6% (range 0–31.6%), while in the USA, TB caused by M. bovis is usually traced to persons in Hispanic communities, mostly with origins in Mexico; 90% of all TB cases caused by M. bovis in the USA affect Hispanic people. This association is attributed to the consumption of unpasteurized, contaminated cheese produced in Mexico (Harris et al., 2007; Müller et al., 2013). Official reports in Mexico show that almost 30% of the milk produced in the country is sold unpasteurized, included the one that issued for the production of soft cheese (Center for Disease Control and Prevention, 2005) from which M. bovis has been isolated (Harris et al., 2007). There have been reports of a number of multidrug-resistant strains of M. bovis across the world (Cordova et al., 2012; de Jong et al., 2005; Durr et al., 2010; Gutiérrez et al., 1999; Romero et al., 2006). Furthermore, Rivero et al. (2001) in Spain (Málaga) reported a nosocomial outbreak of TB-MDR caused by M. bovis in 31 patients, 30 of whom were infected with human immunodeficiency virus; all the patients died of progressive tuberculosis. All M. bovis strains had identical spoligotyping patterns and showed resistance to 12 antituberculosis drugs. In all 31 cases, the strains of M. bovis showed resistance to H, R, E, Z, S, aminosalicylic acid, clarithromycin, ethionamide, ofloxacin, capreomycin, cycloserine, and amikacin. For many years, the occurrence of human-to-human airborne transmission of this organism was a topic of debate because such transmission was difficult to prove. However, recent genetic fingerprinting techniques have provided evidence of human-tohuman M. bovis transmission (LoBue et al., 2004). Disease caused by M. bovis and M. tuberculosis cannot be distinguished clinically, radiographically, or pathologically in individual patients; the rates of cavitary pulmonary disease and AFB sputum smear-positive disease, two of the most important indicators of infectiousness in TB patients, are similar for M. bovis and M. tuberculosis (LoBue et al., 2003), therefore, the distinction between these two causative agents requires laboratory testing (Hlavsa et al., 2008). Three of our patients had a M. bovis strain resistant to other drugs (Z + H + E, Z + E and Z + R) besides Z, which is indicative of human-to-human transmission. Based on the fact that the only presentation was pulmonary and that H and R are not used in veterinary practice, our data suggests that these isolates may have been acquired from a human source (Hughes et al., 2003); occupational exposure was not a risk factor in these patients since none had a history of contact with cattle. The human disease caused by M. bovis is probably underreported as a result of diagnostic limitations. For many low-income countries, a mycobacterial culture is usually an expensive and unavailable option in comparison to the cheaper and quicker acid-fast staining (Etchechoury et al., 2010); this rapid, low-cost and relatively high specific technique allows for the detection of
4
R. Laniado-Laborín et al. / Infection, Genetics and Evolution 27 (2014) 1–5
the highly infectious pulmonary cases but does not allow species identification. In addition, in developed countries where culture is routinely used in the diagnosis of TB, many laboratories do not identify positive cultures beyond the level of the M. tuberculosis complex and in many laboratories where culture is available, only Lowenstein-Jensen solid culture medium is used. Lowenstein–Jensen medium is supplemented with glycerol, which does not promote M. bovis growth. The ideal solid media for M. bovis isolation is an egg medium supplemented with pyruvate (Stonebrink medium) (Cordova et al., 2012). The identification of M. bovis is not only an epidemiologic curiosity; since M. bovis is intrinsically resistant to Z (a critical drug of the standard 6-month, short-course regimen for M. tuberculosis due to its early sterilizing activity), treatment for M. bovis is usually recommended to extend to 9 months of isoniazid and rifampin instead of the standardized 6-month treatment regimen to reduce the risk of failure or relapse (Allix-Béguec et al., 2010; Müller et al., 2013; Rodwell et al., 2010; Stone et al., 2012). Our study has several methodological limitations: 1. In Mexico, as in most developing countries, diagnosis of tuberculosis is mainly based on microscopy results. In our region, approximately 25% of new cases are submitted to the laboratory for culture. 2. We submitted only M. tuberculosis strains that were resistant to Z for genetic analysis. False negative results for the MGIT system Z test has been reported at 5% (Hughes et al., 2003); some strains of M. bovis with this screening strategy might have not been detected. 3. Finally, another source of bias in our study is related to the type of solid culture medium utilized for human pulmonary tuberculosis samples. In the past, our laboratory used exclusively the Lowenstein–Jensen medium supplemented with glycerol, which does not promote M. bovis growth. M. bovis grows faster on egg medium supplemented with pyruvate (Stonebrink medium) (Etchechoury et al., 2010). Since 2013, when we detected the presence of M. bovis as an etiologic agent among our patients we decided to implement in our laboratory the routine of inoculating every sample in both types of solid medium. This also would yield some false negative culture results. However, is important to note that these sources of bias would actually result in an underestimation the importance of M. bovis as a human pathogen in the region. 5. Conclusions The real burden of M. bovis cases among the total of human tuberculosis cases reported can only be known from especially designed studies in which, during a specific period, all specimens submitted to tuberculosis diagnosis in one or more laboratories are cultured on the appropriate media and the isolated mycobacteria are analyzed to differentiate M. bovis from M. tuberculosis and other Mycobacterium species. Efforts to eradicate M. bovis in humans should also include the eradication of the disease in cattle, increasing dairy products pasteurization providing education about the dangers of consuming unpasteurized dairy products. Monitoring of both, human and bovine tuberculosis are essential in the control and eradication programs of tuberculosis. In addition, it is relevant to use molecular markers, as MIRU-VNTR analysis for typing human M. bovis isolates. Acknowledgements This project was sponsored by the 14th Internal Call for Support to Investigation Projects of the UABC (Project No. 4276) and by the
CONACYT Grant No. 166624 ‘‘Epidemiología molecular de Mycobacterium tuberculosis en la frontera Noroeste México-Estados Unidos’’. M. Sc. Nelva L. Victoria-Cota and M. Sc. Norma Martínez Cisneros gave technical support. References Allix, C., Walravens, K., Saegerman, C., Godfroid, J., Supply, P., Fauville-Dufaux, M., 2006. Evaluation of the epidemiological relevance of variable-number tandemrepeat genotyping of Mycobacterium bovis and comparison of the method with IS6110 restriction fragment length polymorphism analysis and spoligotyping. J. Clin. Microbiol. 44, 1951–1962. Allix-Béguec, C., Fauville-Dufaux, M., Stoffels, K., Ommeslag, D., Walravens, K., Saegerman, C., Supply, P., 2010. Importance of identifying Mycobacterium bovis as a causative agent of human tuberculosis. Eur. Res. J. 35, 692–694. Bakshi, C.S., Shah, D.H., Verma, R., Singh, R.K., Malik, M., 2005. Rapid differentiation of Mycobacterium bovis and Mycobacterium tuberculosis based on a 12.7-kb fragment by a single tube multiplex-PCR. Vet. Microbiol. 109, 211–216. Bakshi, C.S., Shah, D.H., Verma, R., Singh, R.K., Malik, M., 2007. Corrigendum to ‘‘Rapid differentiation of Mycobacterium bovis and Mycobacterium tuberculosis based on a 12.7-kb fragment by a single tube multiplex-PCR’’. Vet. Microbiol. 109 (2005), 211–216. Center for Disease Control and Prevention, 2005. Human tuberculosis caused by Mycobacterium bovis New York City, 2001–2004. MMWR Morb. Mortal. Wkly. Rep. 54, 605–608. Codon Code Corporation, 2006. Codon Code Aligner.
R. Laniado-Laborín et al. / Infection, Genetics and Evolution 27 (2014) 1–5 P., Myers, R., Hawkey, P., Abubakar, I., 2013. Investigating transmission of tuberculosis caused by Mycobacterium tuberculosis in the United Kingdom in 2005 to 2008. J. Clin. Microbiol. 49, 1943–1950. Marcos, J.Y., Cascon-Soriano, A., Sanchez-Salazar, M., Hernanz-Moral, C., SuarezRamos, S., Smeltzer, M.S., Naharro-Carrasco, G., 1999. Rapid identification and typing of Staphylococcus aureus by PCR-restriction fragment length polymorphism analysis of the aroA gene. J. Clin. Microbiol. 37, 570–574. Matos, F., Amado, A., Botelho, A., 2010. Molecular typing of Mycobacterium bovis isolated in the first outbreak of bovine tuberculosis in the Azores Islands: a case report. Vet. Med. (PRAHA) 55, 133–136. Michel, A.L., Müller, B., van Helden, P.D., 2010. Mycobacterium bovis at the animal– human interface: a problem, or not? Vet. Microbiol. 140, 371–381. Minch, E., Ruiz-Linares, A., Goldstein, D., Feldman, M., Cavalli-Sforza, L., 1995. MICROSAT, The microsatellite distance program.
5
Skuce, R.A., McCorry, T.P., McCarroll, J.F., Roring, S.M.M., Scott, A.N., Brittain, D., Hughes, S.L., Hewinson, R.G., Neill, S.D., 2002. Discrimination of Mycobacterium tuberculosis complex bacteria using novel VNTR-PCR targets. Microbiology 148, 519–528. Sreevatsan, S., Pan, X., Zhang, Y., Kreiswirth, B.N., Musser, J.M., 1997. Mutations associated with pyrazinamide resistance in pncA of Mycobacterium tuberculosis complex organisms. Antimicrob. Agents Chemother. 41, 636–640. Stone, M.J., Brown, T.J., Drobniewski, F.A., 2012. Human Mycobacterium bovis infections in London Southeast England. J. Clin. Microbiol. 50, 164–165. Sunder, S., Lanotte, P., Godreuil, S., Martin, C., Boschiroli, M.L., Besnier, J.M., 2009. Human-to-Human transmission of tuberculosis caused by Mycobacterium bovis in immunocompetent patients. J. Clin. Microbiol. 47, 1249–1251. Supply, P., Allix, C., Lesjean, S., Cardoso-Oelemann, M., Rusch-Gerdes, S., Willery, E., Savine, E., de Haas, P., van Deutekom, H., Roring, S., Bifani, P., Kurepina, N., Kreiswirth, B., Sola, C., Rastogi, N., Vatin, V., Gutierrez, M.C., Fauville, M., Niemann, S., Skuce, R., Kremer, K., Locht, C., van Soolingen, D., 2006. Proposal for standardization of optimized mycobacterial interspersed repetitive unitvariable-number tandem repeat typing of Mycobacterium tuberculosis. J. Clin. Microbiol. 44, 4498–4510. Supply, P., Lesjean, S., Savine, E., Kremer, K., Van Soolingen, D., Locht, C., 2001. Automated high-throughput genotyping for study of global epidemiology of Mycobacterium tuberculosis based on mycobacterial interspersed repetitive units. J. Clin. Microbiol. 39, 3563–3571. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Thompson, J., Gibson, T., Plewnial, F., Jeanmougin, F., Higgins, D., 1997. The CLUSTAL-Windows interface: flexible strategies for multiple alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882. Zumárraga, M.J., Arriaga, C., Barandiaran, S., Cobos Marín, L., de Waard, J., Garcia, I.E., Figueiredo, T., Figueroa, A., Giménez, F., Gomes, H.M., Gonzalez-y-Merchand, J.A., Macías, A., Milián Suazo, F., Rodríguez, C.A.R., Santillán, M.A., Suffys, P.N., Trangoni, M.D., Zárraga, A.M., Cataldi, A., 2013. Understanding the relationship between Mycobacterium bovis spoligotypes from cattle in Latin American Countries. Res. Vet. Sci. 94, 9–21.