Molecular characterization of p38 MAPK and tissue-specific expression under cadmium stress in red swamp crayfish (Procambarus clarkii)

Journal Pre-proof Molecular characterization of p38 MAPK and tissue-specific expression under cadmium stress in red swamp crayfish (Procambarus clarkii)

Yahui Shui, Junpu Xie, Yong Zhou, Jinping Li, Jinhua Gan PII:

S0048-9697(20)30835-4

DOI:

https://doi.org/10.1016/j.scitotenv.2020.137325

Reference:

STOTEN 137325

To appear in:

Science of the Total Environment

Received date:

15 October 2019

Revised date:

13 February 2020

Accepted date:

13 February 2020

Please cite this article as: Y. Shui, J. Xie, Y. Zhou, et al., Molecular characterization of p38 MAPK and tissue-specific expression under cadmium stress in red swamp crayfish (Procambarus clarkii), Science of the Total Environment (2018), https://doi.org/10.1016/ j.scitotenv.2020.137325

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2018 Published by Elsevier.

Journal Pre-proof

Molecular characterization of p38 MAPK and tissue-specific expression under cadmium stress in red swamp crayfish (Procambarus clarkii) Yahui Shui a, b, Junpu Xie a, b, Yong Zhou a, Jinping Li b,* * , Jinhua Gan a, *

a

Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Wuhan, Hubei 430223, China School of Environmental Engineering, Wuhan Textile University, Wuhan, Hubei 430073, PR China

of

b

ro

Corresponding anthor.

-p

E-mail address: [email protected] (Jinhua Gan). Tel: +86 10 81780165; [email protected] (Jinping

re

Li).

lP

Abstract: Keeping harmful pollutants out of some crucial tissues as much as possible is a key trait for the organism to survive in adverse conditions, such as in heavy-metal contaminated aquatic

na

environments. In the current study, it was hypothesized that the p38 Mitogen-activated Protein

Jo ur

Kinase (MAPK) controls the distribution of cadmium (Cd) in red swamp crayfish (Procambarus clarkii) by regulating the accumulation of Cd in different tissues under Cd-stressed conditions. To test this hypothesis, this study analyzed the p38 MAPK gene and compared the differential expression levels in the heart, antennal gland, gill, hepatopancreas, and muscles. Differences in expression levels of p38 MAPK gene between different tissues were conducted under controlled Cd exposure. This study found that the expression of p38 MAPK is tissue-specific in all tested samples under non-stressed condition. Under Cd-stressed condition and with the prolongation of Cd exposure time, the content of Cd in all examined tissues of P. clarkii has substantially increased compared to the control, although the Cd contents in the heart, antennal gland, and muscle remained relatively lower than those observed in the hepatopancreas. Consequently, the levels of p38 MAPK in the heart, antennal gland, and muscle were higher than the level in the hepatopancreas. These results indicate 1

Journal Pre-proof that p38 MAPK regulates the distribution and accumulation of Cd in different tissues of P. clarkii under Cd-stressed condition. Furthermore, the results suggested that the higher expression of p38 MAPK played a crucial role in keeping Cd out of the tissues in the Cd-rich aquatic environment to maintain the normal physiological function of the red swamp crayfish, a process necessary for survival and growth.

of

Keywords: aquatic animals; p38 expression; cDNA sequence; Cd stress; tissues accumulation

ro

1. Introduction

-p

Cadmium (Cd) contamination is now a widespread problem that raises environmental, food safety, and public health concerns for its high bioavailability in many areas of the world. Most

re

aquatic animals in contaminated environments are not able to survive after Cd exposure due to its

lP

pathology-inducing effect. For example, Cd toxicity can injure multiple tissues including the liver,

na

kidney, and lung. The degree of organ damage is related to the route, dose, and duration of exposure (Nair et al., 2013). However, a restricted number of aquatic animal species can survive and reproduce

Jo ur

on the Cd-rich aquatic environment suffering from minor toxicity. The red swamp crayfish (Procambarus clarkii) is a widely cultured aquatic animal in China, with a production of 1,129,700 tons in 2018 (Xu and Lv, 2018). Because of its distinct benthic lifestyle and good tolerance to heavy metal pollution, it is often used as an indicator of the bioavailability of heavy metals when monitoring aquatic environments (Alcorlo et al., 2006). The heavy metal contents of P. clarkii vary from 623 to 155,763 times higher than that in the surrounding aquatic environment (Bellante et al., 2015). Hence, this species provides an elegant aquatic animal model for studying processes involved in the tolerance to toxic concentrations of heavy metals in aquatic animals inhabiting a heavy metal-rich aquatic environment. 2

Journal Pre-proof

Mitogen-activated protein kinases (MAPKs) are a family of protein-serine/threonine kinases that are highly conserved in protein structures from unicellular eukaryotic organisms to multicellular organisms. These kinases, including ERKs, JNKs, and p38s, are regulated by a phosphorelay cascade, with a prototype of three protein kinases that sequentially phosphorylate one another (Huang et al., 2010). Among them, p38 can be irritated by various extracellular stimulation, including UV

of

irradiation, inflammatory cytokines, pathogen infections, and environmental stress (Regan et al., 2009; Cuadrado and Nebreda, 2010; Cai et al., 2011; Huang et al., 2011; He et al., 2013; Zhu et al.,

ro

2014). Previous studies have revealed that MAPK cascade is one of the important mechanisms

-p

involved during Cd toxicity and has been verified in many cell lines (Ding and Templeton, 2000;

re

Nakagawa et al., 2007). A study on zebrafish embryos showed that the toxic effect of Cd is mainly

lP

regulated by the p38 MAPK signaling pathway and that the expression of p38 increased at 0-96 h

na

under Cd treatment at the concentration of 12 mg·L-1 (Yin et al., 2017). In whiteleg shrimp (Litopenaeus vannamei), the expression of p38 was slightly increased at 6 h but then decreased to

2015).

Jo ur

pre-exposure levels at 12 h under Cd treatment at the concentration of 8.50 µmol·L-1 (Peng et al.,

The p38 expression was observed in all the tested tissues of Chinese white shrimp (Fenneropenaeus chinensis) including the intestine, gill, stomach, heart, hepatopancreas, muscles and hemocytes, with the highest expression in muscles (Yao et al., 2016). In red swamp crayfish (Procambarus clarkii), hepatopancreas is one of the main target tissues for the accumulation of heavy metals (Goretti et al., 2016; Gedik et al., 2017). Among the accumulating heavy metals in the hepatopancreas, Cd has the highest enrichment coefficient of 237,500 in comparison with mercury, arsenic, lead, copper, and zinc (Svobodová et al., 2017). In an aquatic environment, crayfish absorbs 3

Journal Pre-proof

Cd into the body through the gills and the absorbed Cd migrates to different tissues through a series of migration and transformation pathways, accumulating finally in the reservoir tissues. These studies suggested that the tissue-specific accumulation of Cd in P. clarkii may be the result of p38 MAPK gene regulation in the tissue – a crucial process in avoiding Cd toxicity. In the current study, it was hypothesized that the p38 MAPK controls the distribution of Cd in

of

different reservoir tissues of P. clarkii and that it further regulates the accumulation of Cd under the Cd-stressed environment. To test the hypothesis, this study isolated the p38 MAPK gene from P.

ro

clarkii and analyzed for differences in expression levels in the heart, antennal gland, gill,

re

between tissues under controlled Cd exposure.

na

lP

2.Materials and methods

2.1 Experimental animals

-p

hepatopancreas, and muscles. Finally, this study compared the expression levels of p38 MAPK gene

Jo ur

The stock of red swamp crayfish (Procambarus clarkii) was purchased from a commercial farm in Lixian (Hunan, China) and kept in tanks with aerated water for 2 weeks to acclimatize to the laboratory condition. The red swamp crayfish (weight, 35±5 g) was used to clone the p38 MAPK sequence and study its expression after Cd stress. Based on the aquaculture conditions provided elsewhere (Yao et al., 2016; Zhang et al., 2018), crayfish was tested under the following conditions: water temperature, 22-25 ºC; pH, 7.2-7.6; Dissolved Oxygen (DO), 5.0-6.0 mg·L-1; photoperiod, 12:12 h (light: dark); and fed with freshwater crayfish feedstuff by the Cd scavenging technology (Cd≤0.1 µg/kg) (Haid, China).

2.2 Molecular cloning of p38 MAPK

4

Journal Pre-proof The total RNA was extracted from the P. clarkii tissues using a Trizol reagent (Invitrogen, USA) following the manufacturer’s instructions. The integrity and concentration of the RNA were assessed by gel electrophoresis and ND1000spectrophotometer (NanoDrop Technologies, USA), respectively. Afterward, cDNA synthesis was performed in a 25 ml reaction volume by the PrimeScriptTM1st strand cDNA Synthesis Kit (Takara, Japan) according to the manufacturer’s instructions, i.e., using the SMARTer® RACE 5'/3'Kit to synthesis 5'-RACE cDNA and 3'-RACE cDNA. To identify the conserved regions and design the degenerate primers F1 and R1, the p38 MAPK

of

gene in Fenneropenaeus chinensis (Genbank ID: KF991368), Marsupenaeus Japonicus (GenbankID:

ro

BAK78916.1) and Scylla paramamosain (Genbank ID: AHH29322) in the NCBI was searched and

-p

analyzed through Megalin. Then the primers F2 and R2 were designed to ensure the accuracy of the

re

sequence with the following reaction procedure: (a) pre-denaturation at 94 ºC for 5 min; (b) 35 cycles of 94 ºC for 30 s, 55 ºC for 30 s, 72 ºC for 1.5 min; (c) and 10 min extension at 72 ºC. The

lP

purified PCR products were sequenced directly. Primers for the RACE designed according to the

na

partial fragment of p38 MAPK are listed in Table 1. The products were purified and inserted into pMD19-T (Takara, Japan) before sequencing and the full-length cDNA sequence of P. clarkii p38

Jo ur

（Pc-p38）MAPK was acquired by overlapping the two fragments.

2.3. Sequence and bioinformatic analysis

The open reading frame (ORF) of p38 MAPK was deduced using the Edit-Seq in the DNAstar. The similarity of p38 MAPK with other species was analyzed using the NCBI BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The protein physicochemical properties analysis of p38 MAPK was executed with the ExPASy (https://web.expasy.org/protparam/) and the signal peptide was predicted by SignalP-5.0 program (http://www.cbs.dtu.dk/services/SignalP/). The NCBI Conserved Domains Search (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) was used to predict the conservative domain of amino acid sequences. Multiple sequence alignment and 5

Journal Pre-proof homology analyses were generated using ClustalX 1.83 and DNAMAN 8. A Neighbor-Joining (NJ) phylogenic tree was structured by MEGA X based on the result of multiple sequence alignment and homology analysis. Bootstrap values were decided based on 1000 replications.

2.4. Tissue distribution analysis of p38 MAPK

To study the p38 MAPK distribution of crayfish tissues in natural conditions, five different

of

tissues including heart, antennal gland, gill, hepatopancreas, and muscle were collected separately from red swamp crayfish, with six crayfish randomly selected by tissue to eliminate individual

ro

differences (Yao et al., 2016; Zhang et al., 2018). RNA was extracted and cDNA was synthesized

-p

separately from these tissues. Pc-p38 F/R and β-actin F/R were designed to amplify the Pc-p38 and

re

β-actin fragments. Here, the β-actin was used as the reference gene. Quantitative real-time PCR

lP

(qPCR) was performed in a volume of 20 μL containing 10 μL TB Green Premix Ex Taq II (Takara, Japan), 0.8 μL each primer, 2 μL cDNA, and 6.4 μL double-distilled H2O. The program of qPCR was

na

as follows: 40 cycles at 95 ºC for 10 s, 60 ºC for 30 s and 72 ºC for 30 s. The formula 2-∆∆CT was

Jo ur

utilized to calculate the expression levels of p38 MAPK in different tissues.

2.5. Expression profiles of Pc-p38 MAPK under Cd exposure Two different Cd conditions – untreated control (normal freshwater as control) and 0.1 mg·L -1 Cd were set up in line with the previous study (Kefaloyianni et al., 2005). Tissues including heart, antennal gland, gill, hepatopancreas, and muscle were extracted from P. clarkii on 0, 1, 3, 5, 7, 10, 13, 19, 26, 30, 45, 60 days after Cd exposure. For each sample, three P. clarkii were randomly selected to eliminate potential bias attributed to individual differences (He et al., 2013; Yu et al., 2017). Using the methods described previously to extract total RNA and synthesize the cDNA, the expression levels of different samples were detected by qPCR with the same method, program, and primers (Table 1). The p38 MAPK expression of samples was calculated as described earlier. 6

Journal Pre-proof 2.6 Cd measurement The Cd environmental concentration was set at 0.1 mg·L-1 and at the end of 0, 1, 3, 5, 7, 10, 13, 19, 26, 30, 45, 60 days of Cd exposure crayfish were dissected to obtain the heart, antennal gland, gills, hepatopancreas, and muscle. The concentrations of Cd in the crayfish tissues were measured according to the Chinese national standard for the determination of Cd in food (GB 5009.15-2014). The samples were weighed and acidified with 7.5 mL HNO3 (analytical grade, Sinopharm Chemical

of

Reagent Co., Shanghai, China). 2.5 mL H2O2 (analytical grade, Sinopharm Chemical Reagent Co.,

ro

Shanghai, China) was added to the digestion tanks and then digested by a microwave digestion

-p

instrument (Milestone ETHOS UP, Italy). The resulting digests were analyzed for Cd concentration

re

by graphite furnace atomic absorption spectrometer (Analytik Jena AG, ZEE nit 650p, Germany).

lP

2.7 Statistical analysis

na

To obtain the p38 MAPK expression level and Cd content of the crayfish tissues in natural conditions, six crayfish were taken for repeated detection and analysis to eliminate individual

Jo ur

differences. The relationship between the Cd content and the expression level of p38 MAPK in tissues was investigated by a regression analysis. To examine differences in p38 MAPK expression among Cd treatments, two-way analysis of variance (ANOVA) was used to perform a holistic comparison, when two-way ANOVA identified two factors had interaction, simple effect test was used to examine differences in p38 expression among treatments. All statistical tests were conducted in the SPSS package version 24.0 considering a significant level of 0.05.

3. Results

3.1 Cloning and sequence analysis of p38 MAPK

The 831 bp fragment of Pc-p38 MAPK was initially obtained and based on this partial sequence 7

Journal Pre-proof the complete sequence was acquired through the RACE technology. The full-length cDNA of Pc-p38 MAPK is 1581 bp containing an open reading frame (ORF) of 1098 bp, 5′untranslated region (UTR) of 147 bp, and 3′UTR of 483 bp. Amino acid sequence analysis showed that the ORF of Pc-p38 MAPK encoded a predicted protein of 365 amino acids with no signal peptide. The molecular weight was 41.83 kDa and the theoretical pI was 5.69. The aliphatic index of Pc-p38 MAPK was 84.44, indicating that it’s a liposoluble protein. The grand average of hydrophobicity was -0.424, suggesting that it’s a hydrophilic protein. Conserved domain analysis showed that the Pc-p38 protein contains a

of

functional domain (STKc) and it belongs to protein kinase c (PKc) superfamily. It has glycine-rich

ro

(GxGxxG) ATP binding loop, ED site (Glu and Asp), the putative dual phosphorylation motif

-p

Thr-Gly-Tyr (TGY), and the substrate-binding site Ala-Thr-Arg-Trp (ATRW) (Fig.1). The TGY motif

re

was required for all p38 MAPK activation, the ATRW domain was the kinase interaction motif (KIM) docking site that binds to the linear KIM sequences and MAPK phosphatases (Akella et al., 2008).

lP

Likewise, the ED (ERK docking) site is essential for the interaction of p38 MAPK with the substrate,

na

activators, and regulators (Akella et al., 2008; Roskoski, 2012). These functional sites exist in all p38

Jo ur

MAPK amino acid sequences as representative marks of p38 MAPK.

3.2. Homology and phylogenetic analysis

The NCBI BLASTP analysis revealed that the amino acid sequence of Pc-p38 MAPK showed the highest level of identity to Macrobrachium nipponense (ASM46958.1) and Palaemon carinicauda (ASU54245.1), with similarity level at 95%. It belonged to the p38 MAPK family having high similarity with other invertebrates and vertebrates. Multiple-sequence alignment of P. clarkii p38 MAPK amino acid sequence with other species demonstrated a high similarity in the sequence (Fig. 2) and the identity was 79.81%. Functional sites existed in all p38 MAPK amino acid sequences containing the TGY motif, ATRW site, and ED motif. Consistent with other known p38 MAPK amino acid sequences, the dual phosphorylation site of the TGY motif, substrate-binding site 8

Journal Pre-proof of ATRW, and functional site ED are reported to be highly conserved (Hanks and Hunter, 1995; Ressurreição et al., 2011). The phylogenetic tree was further constructed by MEGA X with the neighbor-joining method to analyze the evolutionary relationship among different species (Fig.3). The tree was divided into two big branches, namely invertebrates and vertebrates. P. clarkii p38 MAPK became a branch with Macrobrachium nipponense and Palaemon carinicauda and a class under invertebrates. Also, phylogenetic analysis indicated that p38 MAPK of P. clarkii has the

of

closest relationship to shrimp, then with crab, and lastly with other invertebrates.

ro

3.3. Tissue distribution of p38 MAPK

-p

qPCR was used to investigate the expression levels of p38 MAPK in different tissues of P.

re

clarkii, including the heart, antennal gland, gill, hepatopancreas, and muscle. As shown in Fig.4 (A),

lP

p38 MAPK was expressed in all analyzed tissues with the highest expression observed in the antennal gland followed by muscle and heart. The lowest expression level was observed in the

na

hepatopancreas.

Jo ur

3.4. Expression of p38 MAPK under Cd stress

The relative expression levels of Pc-p38 MAPK in the heart, antennal gland, gill, hepatopancreas, and muscle under Cd-stressed condition were displayed in Fig.5. The two-way ANOVA identified two factors had interaction in all the tested tissues (P<0.01), so the simple effect test was used to examine differences in p38 expression among treatments. The expression of Pc-p38 MAPK in the antennal gland showed a significant increase after Cd exposure, especially from the 7th to the 26th day, which was 3- to 4-times higher than that in the control. The expression of Pc-p38 MAPK in gill was enhanced after 1 day of Cd exposure but showed a decreasing trend comparable to the control group. The lowest relative expression level of Pc-p38 MAPK in the heart was on the 7th day while the lowest level in muscle was at the 10th day. The differences were not obvious on the 7th 9

Journal Pre-proof day and the 10th day for the muscle and the highest levels in both heart and muscle were on the 19th day. The expression of Pc-p38 MAPK in the hepatopancreas appeared to decline after Cd exposure and fluctuated in a time-dependent manner. Overall, the expression levels were lower than those in the control group.

3.5 Cd concentration in P. clarkii

of

Fig.4 (B) shows that the results of Cd measurement in different tissues of original crayfish. The highest Cd concentration was observed in the hepatopancreas followed by gill. The Cd concentration

ro

in muscle, heart, and antennal gland were low with numerical values closed to zero. As shown in

-p

Fig.4 (C), there was a significant negative relation between the Cd content and the expression level

re

of p38 MAPK in tissues (the model built by regression analysis was validated by ANOVA, P<0.01,

lP

and the determination coefficients (R2) was 0.443).

As shown in Fig. 6, the Cd accumulation in the tissues of P. clarkii under Cd exposure showed a

na

significant increase compared to the original crayfish. The amounts of Cd enrichment in hepatopancreas and gill increased with enrichment time and the level of accumulation was larger at

Jo ur

the beginning of enrichment, suggesting that the enrichment rates were higher during this period. Cd accumulation increased slowly after the 13th day and reached a balanced level gradually. The extent of increase in Cd accumulation in muscle, heart, and antennal gland were lower than the hepatopancreas and gill. Here, Cd accumulation reached a balanced level after the 26th day where the amount of Cd in muscle, heart, and antennal gland appeared similar and far below the amount accumulated in hepatopancreas and gill.

4. Discussion

4.1 The specific-tissue expression of p38 MAPK under no Cd stress

10

Journal Pre-proof In the present study, p38 MAPK was found in all the examined tissues of P. clarkii, with the highest expression in the antennal gland followed by the muscle and heart. The lowest expression was observed in hepatopancreas under no Cd stress. Hence, p38 MAPK has different tissue expressions or specific for tissues under no stress condition – a similar phenomenon found in previous literature (Peng et al., 2015; Yao et al., 2016). In the past, there were few studies on the tissue-specific distribution of the p38 MAPK gene under no-stress conditions and little is known about the reason why the expression of this gene in various tissues differed under normal conditions.

of

In this study, the results show minimal levels of Cd in the heart, antennal gland, and muscle but

ro

reveal highest Cd concentration in hepatopancreas under no Cd stress. As a result, there is a

-p

significant negative relation between the Cd content and the expression level of p38 MAPK in

re

tissues Fig.4 (C), implying that the high expression of the p38 MAPK gene potentially reduces the absorption of Cd in different P. clarkii tissues. Hence, the p38 MAPK might play a crucial role in the

lP

process of maintaining normal physiological functions of crayfish under Cd pollution.

na

In an aquatic environment, crayfish absorbs Cd into the body through the gills and the absorbed Cd migrates to different tissues of P. clarkii through a series of migration and transformation

Jo ur

pathways that result in the accumulation of Cd in the reservoir tissues. Cd is among the non-essential elements for the growth of an organisms and harmful to the aquatic organisms even at lower concentrations due to its potential carcinogenic nature and difficult degradation (Sreenivasula Reddy et al., 2011). Cd is easily transferred from low to high level organisms in the aquatic food web because of its high bioavailability (Ruangsomboon et al., 2006; Kang et al., 2017). For instance, the dietary Cd can be absorbed by fish via gastrointestinal tract leading to Cd accumulation and toxic effects such as physiological, biochemical, and behavioral dysfunctions in fish (Kim et al., 2011). Finally, Cd can enter into human bodies through food chains and may lead to various diseases, including injury of the lungs and dysfunction of the kidneys resulting to death. In addition, Cd has been classified as a probable human carcinogen by U.S. Environmental Protection Agency (Fu and 11

Journal Pre-proof Wang, 2011). Considering the human health and normal life activities of aquatic animals, keeping these harmful pollutants out from crucial tissues is a key rule for an organism to survive in adverse environments. As the source of heavy metals in crayfish, the gill structure plays a very important role in the physiological process of resistance to heavy metals. In the study, perhaps to absorb more co-absorbable substances in the water environment, such as oxygen, p38 MAPK expression in the gills is low and only relatively higher in the hepatopancreas. Therefore, much Cd is absorbed into the gills of P. clarkii under no Cd stress.

of

As mentioned above, the absorbed Cd in the gill must be migrated and transferred into other

ro

tissue and finally accumulate in the reservoir tissues. In the present study, hepatopancreas was the

-p

target tissue for Cd accumulation in P. clarkii, with the highest content of 538.16 µg·kg-1, which was

re

0.84, 146.8, 163.1 and 244.7 times higher than those in the gill, muscle, antennal gland, and heart respectively. Correspondingly, the p38 MAPK gene had the minimal expression in the

lP

hepatopancreas, with the lowest expression of 0.127, which was 0.078, 0.004, 0.010 and 0.011 times

na

of that in the gill, antennal gland, muscle, and heart. Therefore, it can be inferred that the p38 MAPK gene must play a decisive role in regulating the distribution of Cd in different reservoir tissues of P.

Jo ur

clarkii. As the target tissue for Cd accumulation, the hepatopancreas must store as much Cd as possible to reduce the migration and transformation of Cd into other tissues.

4.2 The low expression of p38 MAPK is responsible for high accumulation of Cd in gill and hepatopancreas under Cd stress

The gill is the tissue where gas exchange and excretion take place, as well as where aquatic animals directly contact with the external environment (Ponzoni, 2017). Also, filtration and osmotic effect of the crustacean gills are the main way for heavy metal absorption in the body (Martín-Díaz et al., 2005). Previous studies showed the high expression of p38 MAPK in gills of teleost fish and crustaceans. This gene appeared to be not only associated with immune function but also involved in 12

Journal Pre-proof osmotic and ion regulation (Marshall et al., 2017; Yu et al., 2017). In this study, the results show a stress response in gill during the early stage of Cd stress so that the expression level of p38 MAPK significantly rises on the first day but fluctuates during the late stage of Cd stress. The significant rise of p38 MAPK on the first day is mainly due to oxidative stress induced by Cd. At the same time, as the earliest cadmium-contaminated tissue, gill also accumulates a part of Cd to ensure the normal physiological functions of other tissues. The results also imply that the rate of Cd accumulation in gill is faster than the other tissues in the first week. The gill seems to be a temporary target organ of

of

Cd accumulation when exposed to low Cd concentrations, after which the Cd is transferred into

ro

hepatopancreas (Al Kaddissi et al., 2014).

-p

The Cd accumulation in hepatopancreas shows an obvious increase after the Cd exposure,

re

especially during the 5th to 13th days. Based on that and the trend of Cd accumulation in gills, it could infer that Cd is transferred from gills to hepatopancreas. The p38 MAPK of P. clarkii is weakly

lP

expressed in the hepatopancreas. Its expression level is below the control group after Cd stress,

na

which is similar to the p38 MAPK in Fenneropenaeus chinensis (Yao et al., 2016). The hepatopancreas of crustaceans is responsible for immunity and metabolism (Rőszer, 2014; Sun et al.,

Jo ur

2015). The expression of p38 MAPK in hepatopancreas of P. clarkii indicates that it could be involved in immunity and metabolism. In fact, hepatopancreas play an essential role in storage, detoxification, and metabolism of metals (Kouba et al., 2010). Both high Cd concentration and low expression of p38 MAPK in hepatopancreas indicate a strategy for P. clarkii to survive and even reproduce on a cadmium-rich aquatic environment with minor damage from Cd. Because hepatopancreas is the main target tissue for Cd accumulation in crayfish, the effect is the reduction of transport and enrichment of Cd in other tissues.

4.3 The high expression of p38 MAPK keeps Cd out of antennal gland and heart as much as possible under Cd stress

13

Journal Pre-proof The antennal gland is the excretory organ of the arthropod crustacean, which evolved from the kidney. The antennal gland is a tissue that connects to the crayfish's eyes and tentacles directly. It is one of the most sensitive tissues of crayfish. Besides, it has another function that is to recover useful ions from the blood and regulate the blood’s ion balance (Kormanik and Harris, 1981). Some researches showed that p38 MAPK gene took part in the activation of nonselective cation (NSC) channels on osmotic shrinkage, which played a significant role in the regulation of volume (Shen et al., 2002) and commonly thought that p38 genes could be involved in restoring cell volume through

of

regulatory volume increase and osmolyte transport (Nielsen et al., 2008; Hdud et al., 2014).

ro

Moreover, there are some researches showing that kidney has abundant lymphoid cells and assumes

-p

immune function (Zapata et al., 2006; Zwollo et al., 2008). According to the antennal gland evolved

re

from the kidney, antennal gland may have immune function similar to the kidney. The high expression of p38 MAPK in the antennal gland of crayfish indicates that it could be involved in ion

lP

balance and immunity. The expression of p38 MAPK in the antennal gland is higher after Cd stress,

na

and Cd concentration of the antennal gland maintains at a low level, suggesting that the antennal gland could resist Cd stress. Indeed, it is essential for the cells in the antennae gland to exert their

Jo ur

normal physiological functions.

The expression of p38 MAPK in the heart indicates that it probably had the parallel function to response to stress stimulation (He et al., 2013). For instance, MAPK pathways in the heart of zebrafish participate in the mechanism of increasing tolerance to hypoxia (Marques et al., 2008). In Drosophila, the p38 pathway protects Drosophila from septic injury-induced death caused by Pseudomonas aeruginosa and Aspergillus fumigatus (Chen et al., 2010; He et al., 2013). The heart is the key tissue of creatures, which is related to the life and death of creatures, so the body has a series of mechanisms to protect the heart from contaminants. In crayfish, the expression of p38 MAPK in the heart is at moderate level, which increases after Cd stress. The moderate expression of p38 MAPK also corresponds to the slight accumulation of Cd in the heart. 14

Journal Pre-proof 4.4 The moderate expression of p38 MAPK resulting in moderate accumulation of Cd in muscle under Cd stress

Muscle is an important tissue for the growth of crustaceans (de Oliveira Cesar et al., 2006). Previous studies have shown that p38 MAPK had prominent role in muscle differentiation and development (Keren et al., 2006). The results indicate that, under Cd stress, p38 MAPK expression in muscle slightly declines at first then increases and reaches the peak, after that, the expression

of

declines again. With the prolongation of Cd exposure time, the content of Cd in muscle of P. clarkii

ro

increases but the content remains at a lower level than that in hepatopancreas. The level of p38

-p

MAPK in muscle is always higher than that in hepatopancreas. Therefore, these observations in the studies seem to suggest that it may be a strategy for P. clarkii to grow on cadmium-rich aquatic

re

environment with minor suffering from toxicity through the regulation of p38 to keep Cd out of

lP

muscle. Organisms can minimize the harmful effect of excessive heavy metal by summation of the separate regulation of metal levels in different tissues (Zhao et al., 2019) and to maintain normal life

na

activities, like growing in heavy metal contaminated environments.

Jo ur

4.5 The p38 MAPK plays an important role in the physiological activities of crayfish

The p38 MAPK plays an important role in the biological physiology and pathology. It is involved in the development and differentiation of innate immunity (He et al., 2013). Some studies showed that lipopolysaccharide (LPS) induces a dysregulated inflammatory response depending on the p38 MAPK pathway (Neuder et al., 2009). Ropivacaine-inducing neurotoxicity also thought to activate p38 signal to up-regulate Fas expression in neurogliocyte (Wang et al., 2019). In Megalobrama amblycephala, p38 expression was up-regulated by ammonia and Aeromonas hydrophila challenge, respectively (Zhang et al., 2018). In the current study, the expression levels of the p38 MAPK gene in the heart, antennal gland, gill, hepatopancreas, and muscle of crayfish are different across time. The overall presentations of 15

Journal Pre-proof p38 MAPK in the heart, antennal gland, and muscle show an increasing expression pattern at first and decreasing after. The overall trends also appear fluctuating and volatile. Compared with the control groups, up-regulation and down-regulation of p38 MAPK expression exist in tissues except in hepatopancreas. Consistent with our observations, Yao et al. reported that under Cd exposure, the p38 expression in hepatopancreas had fluctuations as time went on, but the expression level was lower than the control (Yao et al., 2016). Crayfish absorbs Cd into the body through the gills, and then the absorbed Cd is migrated and transferred to different tissues, such as hepatopancreas, heart,

-p

ro

reservoir in P. clarkii by regulation of p38 MAPK pathway.

of

antennal gland and muscle but the accumulation occurs in hepatopancreas – the target tissue of Cd

re

5. Conclusion

lP

In conclusion, the p38 MAPK sequence was cloned and characterized in P. clarkii, which is

na

consistent with p38 MAPK of other species. Pc-p38 MAPK is widely presented in the heart, antennal gland, gill, hepatopancreas, and muscle, and specifically expressed in different tissues under no

Jo ur

stress. In addition, under Cd-stressed condition and with the prolongation of Cd exposure time, the content of Cd in all examined tissues of P. clarkii has substantially increased compared to the control, although the Cd contents in the heart, antennal gland, and muscle remained relatively lower than those observed in the hepatopancreas.. The results indicate an important role of p38 MAPK in regulating the distribution or the accumulation of Cd in different tissues of P. clarkii under Cd stress. The results also suggest that the higher expression of p38 MAPK played an role in keeping Cd out of heart, antennal gland, and muscle as much as possible in cadmium-rich aquatic environment in order to maintain the normal physiological function for survival and growth – a strategy for P. clarkii to survive, grow, and even to reproduce by keeping Cd in hepatopancreas through the lowest expression 16

Journal Pre-proof

of p38 MAPK in heavy metal contaminated aquatic environments. Acknowledgments

The research was supported by Central Public-interest Scientific Institution Basal Research Fund,

CAFS

(2018HY-ZD0603

and

2019ZD0803)

and

The

National

Key

Research

of

and Development Program of China (2017YFC1600704).

ro

References

-p

Alcorlo, P., Otero, M., Crehuet, M., Baltanás, A., Montes, C., 2006. The use of the red swamp

re

crayfish (Procambarus clarkii, Girard) as indicator of the bioavailability of heavy metals in

lP

environmental monitoring in the River Guadiamar (SW, Spain). Sci. Total Environ. 366, 380-390. doi: 10.1016/j.scitotenv.2006.02.023

na

Akella, R., Moon, T.M., Goldsmith, E.J., 2008. Unique MAP Kinase binding sites. Biochim. Biophys.

Jo ur

Acta. 1784, 48-55. doi: 10.1016/j.bbapap.2007.09.016 Al Kaddissi, S., Legeay, A., Elia, A.C., Gonzalez, P., Floriani, M., Cavalie, I., Massabuau, J.C., Gilbin, R., Simon, O., 2014. Mitochondrial gene expression, antioxidant responses, and histopathology after cadmium exposure. Environ. Toxicol. 29, 893-907. doi: 10.1002/tox.21817 Bellante, A., Maccarone, V., Buscaino, G., Buffa, G., Filiciotto, F., Traina, A., Del Core, M., Mazzola, S., Sprovieri, M., 2015. Trace element concentrations in red swamp crayfish (Procambarus clarkii) and surface sediments in Lake Preola and Gorghi Tondi natural reserve, SW Sicily. Environ. Monit. Assess. 187, 404. doi: 10.1007/s10661-015-4613-4 Cuadrado, A., Nebreda, A.R., 2010. Mechanisms and functions of p38 MAPK signalling. Biochem. J. 429, 403-417. doi: 10.1042/bj20100323 17

Journal Pre-proof

Cai, J., Huang, Y.H., Wei, S.N., Huang, X.H., Ye, F.Z., Fu, J., Qin, Q.W., 2011. Characterization of p38 MAPKs from orange-spotted grouper, Epinephelus coioides involved in SGIV infection. Fish Shellfish Immunol. 31, 1129-1136. doi: 10.1016/j.fsi.2011.10.004 Chen, J.M., Xie, C.C., Tian, L.L., Hong, L.X., Wu, X.R., Han, J.H., 2010. Participation of the p38 pathway in Drosophila host defense against pathogenic bacteria and fungi. Proc. Natl. Acad. Sci.

of

U. S. A. 107, 20774-20779. doi: 10.1073/pnas.1009223107 Ding, W., Templeton, D.M., 2000. Activation of Parallel Mitogen-Activated Protein Kinase Cascades

ro

and Induction of c- fos by Cadmium. Toxicol. Appl. Pharmacol. 162, 93-99.

-p

doi: 10.1006/taap.1999.8829

re

de Oliveira Cesar, J.R., Zhao, B.P., Malecha, S., Ako, H., Yang, J.Z., 2006. Morphological and

lP

biochemical changes in the muscle of the marine shrimp Litopenaeus vannamei during the molt

na

cycle. Aquaculture 261, 688-694. doi: 10.1016/j.aquaculture.2006.08.003 Fu, F., Wang, Q., 2011. Removal of heavy metal ions from wastewaters: A review. J. Environ.

Jo ur

Manage. 92, 407–418. doi: 10.1016/j.jenvman.2010.11.011 Goretti, E., Pallottini, M., Ricciarini, M.I., Selvaggi, R., Cappelletti, D., 2016. Heavy metals bioaccumulation in selected tissues of red swamp crayfish, An easy tool for monitoring environmental contamination levels. Sci. Total Environ. 559, 339-346. doi: 10.1016/j.scitotenv.2016.03.169 Gedik, K., Kongchum, M., Delaune, R.D., Sonnier, J.J., 2017. Distribution of arsenic and other metals in crayfish tissues (Procambarus clarkii) under different production practices. Sci. Total Environ. 574, 322-331. doi: 10.1016/j.scitotenv.2016.09.060 Huang, P.Y., Han, J.H., Hui, L.J., 2010. MAPK signaling in inflammation-associated cancer 18

Journal Pre-proof

development. Protein Cell 1, 218-226. doi: 10.1007/s13238-010-0019-9 Huang, X.H., Huang, Y.H., OuYang, Z.L., Cai, J., Yan, Y., Qin, Q.W., 2011. Roles of stress-activated protein kinases in the replication of Singapore grouper iridovirus and regulation of the inflammatory responses in grouper cells. J. Gen. Virol. 92, 1292-1301. doi: 10.1099/vir.0.029173-0

of

He, S.L., Qian, Z.Y., Yang, J., Wang, X.Z., Mi, X., Liu, Y.J., Hou, F.J., Liu, Q., Liu, X.L., 2013. Molecular characterization of a p38 MAPK from Litopenaeus vannamei and its expression during

ro

the molt cycle and following pathogen infection. Dev. Comp. Immunol. 41, 217-221.

-p

doi: 10.1016/j.dci.2013.05.010

re

Hanks, S.K., Hunter, T., 1995. Protein kinases 6. The eukaryotic protein kinase superfamily, kinase

na

doi: 10.1096/fasebj.9.8.7768349

lP

(catalytic) domain structure and classification. FASEB J. 9, 576-596.

Hdud, I.M., Mobasheri, A., Loughna, P.T., 2014. Effect of osmotic stress on the expression of

Jo ur

TRPV4 and BKCa channels and possible interaction with ERK1/2 and p38 in cultured equine chondrocytes. Am. J. Physiol. Cell Physiol. 306, 1050-1057. doi: 10.1152/ajpcell.00287.2013 Kefaloyianni, E., Gourgou, E., Ferle, V., Kotsakis, E., Gaitanaki, C., Beis, I., 2005. Acute thermal stress and various heavy metals induce tissue-specific pro- or anti-apoptotic events via the p38-MAPK signal transduction pathway in Mytilus galloprovincialis (Lam.). J. Exp. Biol. 208, 4427-4436. doi: 10.1242/jeb.01924 Kang, H.M., Jeong, C.B., Kim, M.S., Lee, J.S., Zhou, J.Y., Lee, Y.H., Kim, D.H., Moon, E.Y, Kweon, H.S., Lee, S. J., Lee J.S., 2017. The role of the p38-activated protein kinase signaling pathway-mediated autophagy in cadmium-exposed monogonont rotifer Brachious koreanus. 19

Journal Pre-proof

Aquat. Toxico. 194, 46-56. doi: 10.1016/j.aquatox.2017.11.002 Kim, S.G., Dai, W., Xu, Z.R., Li, G.H., 2011. Effects of Montmorillonite on Alleviating Dietary Cd-Induced Oxidative Damage in Carp (Carassius auratus). Biol. Trace Elem. Res. 141, 200–206. doi: 10.1007/s12011-010-8735-9 Kouba, A., Buřič, M., Kozák, P., 2010. Bioaccumulation and Effects of Heavy Metals in Crayfish, A Review. Water Air Soil Pollut. 211, 5-16. doi: 10.1007/s11270-009-0273-8

of

Kormanik, G. A., Harris, R. R., 1981. Salt and water balance and antennal gland function in three

ro

Pacific species of terrestrial crab (Gecarcoidea lalandii, Cardisoma carnifex, Birgus latro). I.

-p

Urine production and salt exchanges in hydrated crabs. J. Exp. Zool. Part A 218, 97-106.

re

doi: 10.1002/jez.1402180112

lP

Keren, A.,Tamir, Y., Bengal, E., 2006. The p38 MAPK signaling pathway, A major regulator of

na

skeletal muscle development. Mol. Cell. Endocrinol. 252, 224-230. doi: 10.1016/j.mce.2006.03.017

Jo ur

Martín-Díaz, M.L., Villena-Lincoln, A., Bamber, S., Blasco, J., DelValls, T.Á., 2005. An integrated approach using bioaccumulation and biomarker measurements in female shore crab, Carcinus maenas. Chemosphere 58, 615–626. doi: 10.1016/j.chemosphere.2004.08.072 Marshall, W.S., Cozzi, R.R.F., Spieker, M., 2017. WNK1 and p38-MAPK distribution in ionocytes and accessory cells of euryhaline teleost fish implies ionoregulatory function. Biol. Open 6, 956-966. doi: 10.1242/bio.024232 Marques, I.J., Leito, J.T.D., Spaink, H.P., Testerink, J., Jaspers, R.T., Witte, F., van den Berg, S., Bagowski, C.P., 2008. Transcriptome analysis of the response to chronic constant hypoxia in zebrafish hearts. J. Comp. Physiology B. 178, 77-92. doi: 10.1007/s00360-007-0201-4 20

Journal Pre-proof

Nair, A.R., Degheselle, O., Smeets, K., Van Kerkhove, E., Cuypers, A., 2013. Cadmium-Induced Pathologies: Where Is the Oxidative Balance Lost (or Not)?. Int. J. Mol. Sci. 14, 6116-6143. doi: 10.3390/ijms14036116 Nakagawa, J., Nishitai, G., Inageda, K., Matsuoka, M., 2007. Phosphorylation of Stats at Ser727 in renal proximal tubular epithelial cells exposed to cadmium. Environ. Toxicol. Pharmacol. 24,

of

252-259. doi: 10.1016/j.etap.2007.06.002 Nielsen, M.B., Christensen, S.T., Hoffmann, E.K., 2008. Effects of osmotic stress on the activity of

ro

MAPKs and PDGFR-beta-mediated signal transduction in NIH-3T3 fibroblasts. Am. J. Physiol.

-p

Cell Physiol. 294, 1046-1055. doi: 10.1152/ajpcell.00134.2007

re

Neuder, L.E., Keener, J.M., Eckert, R.E.,Trujillo, J.C., Jones, S.L., 2009. Role of p38 MAPK in LPS

lP

induced pro-inflammatory cytokine and chemokine gene expression in equine leukocytes. Vet.

na

Immunol. Immunopathol. 129, 192-299. doi: 10.1016/j.vetimm.2008.11.006 Peng, T., Wang, W.N., Gu, M.M., Xie, C.Y., Xiao, Y.C., Liu, Y., Wang, L., 2015. Essential roles of

Jo ur

Cdc42 and MAPK in cadmium-induced apoptosis in Litopenaeus vannamei. Aquat. Toxicol. 163, 89-96. doi: 10.1016/j.aquatox.2015.03.023 Ponzoni, S., 2017. Manganese tissue accumulation and tyrosine hydroxylase immunostaining response in the Neotropical freshwater crab, Dilocarcinus pagei , exposed to manganese. Invertebr. Neurosci. 17, 5. doi: 10.1007/s10158-017-0198-7 Regan, A.D., Cohen, R.D.,Whittaker, G.R., 2009. Activation of p38 MAPK by feline infectious peritonitis virus regulates pro-inflammatory cytokine production in primary blood-derived feline mononuclear cells. Virology 384, 135-143. doi: 10.1016/j.virol.2008.11.006 Roskoski, R., 2012. MEK1/2 dual-specificity protein kinases, structure and regulation. Biochem. 21

Journal Pre-proof

Biophys. Res. Commun. 417, 5-10. doi: 10.1016/j.bbrc.2011.11.145 Ressurreição, M., Rollinson, D., Emery, A.M., Walker, A.J., 2011. A role for p38 MAPK in the regulation of ciliary motion in a eukaryote. Bmc. Cell Biol. 12, 6. doi: 10.1186/1471-2121-12-6 Ruangsomboon, S., Wongrat, L., 2006. Bioaccumulation of cadmium in an experimental aquatic food chain involving phytoplankton (Chlorella vulgaris), zooplankton (Moina macrocopa), and

of

the predatory catfish Clarias macrocephalus×C. gariepinus. Aquat. Toxicol. 78, 15-20. doi: 10.1016/j.aquatox.2006.01.015

ro

Rőszer, T., 2014. The invertebrate midintestinal gland ("hepatopancreas") is an evolutionary

-p

forerunner in the integration of immunity and metabolism. Cell Tissue Res. 358, 685-695.

re

doi: 10.1007/s00441-014-1985-7

lP

Svobodová, J., Douda K., Fischer, D., Lapšanská, N., Vlach P., 2017. Toxic and heavy metals as a

na

cause of crayfish mass mortality from acidified headwater streams. Ecotoxicology 26, 261-270. doi: 10.1007/s10646-017-1760-0

Jo ur

Sreenivasula Reddy, P., Ramachandra Reddy, P., Sainath, S.B., 2011. Cadmium and mercury-induced hyperglycemia in the fresh water crab, Oziotelphusa senex senex, involvement of neuroendocrine system. Ecotox. Environ. Safe. 74, 279-283. doi: 10.1016/j.ecoenv.2010.10.031 Sun, S.M., Xuan, F.J., Fu, H.T., Zhu, J., Ge, X.P., Gu, Z.M., 2015. Transciptomic and histological analysis of hepatopancreas, muscle and gill tissues of oriental river prawn (Macrobrachium nipponense) in response to chronic hypoxia. Bmc Genet. 16, 491. doi: 10.1186/s12864-015-1701-3 Shen, M.R, Chou, C.Y., Hsu, K.F., Ellory, J.C., 2002. Osmotic shrinkage of human cervical cancer cells induces an extracellular Cl- -dependent nonselective cation channel, which requires p38 22

Journal Pre-proof

MAPK. J. Biol. Chem. 277, 45776-45784. doi: 10.1074/jbc.M207993200 Wang, S., Lin, Q., Wang, Z.J., Pan, X.L., 2019. Ropivacaine induces neurotoxicity by activating MAPK/p38 signal to upregulate Fas expression in neurogliocyte. Neurosci. Lett. 706, 7-11. doi: 10.1016/j.neulet.2019.04.048 Xu, L.J., Lv, Y.H., 2018. China fishery statistical yearbook. China Agriculture Press, Beijing. (In

of

Chinese) Yin, J., Wang, A.P., Li, W.F., Shi, R., Jin, H.T., Wei, J.F., 2017. Sensitive biomarkers identification

-p

56, 340. doi: 10.1016/j.etap.2017.10.010

ro

for differentiating Cd and Pb induced toxicity on zebrafish embryos. Environ. Toxicol. Pharmacol.

re

Yao, W.L., He, Y.Y., Liu, P., Li, J., Wang, Q.Y., 2016. Cloning and expression analysis of p38 MAPK

lP

gene from Chinese shrimp (Fenneropenaeus chinensis). Progress in Fishery Sciences 37, 91-98.

na

(In Chinese) doi: 10.11758/yykxjz.20150304001 Yu, Z.H., Geng, Y., Huang, A.M., Wang, K.Y., Huang, X.L., Chen, D.F., Ou, Y.P., Wang, J., 2017.

Jo ur

Molecular characterization of a p38 mitogen-activated protein kinase gene from Scylla paramamosain and its expression profiles during pathogenic challenge. J. Invertebr. Pathol. 144, 32-36. doi: 10.1016/j.jip.2017.01.001 Zhu, J., Cai, L., Zhang, T.H., Chen, L.M., Jin, P., Ma, F., 2014. Identification and characterization of a p38-like gene from amphioxus (Branchiostoma belcheri), an insight into amphioxus innate immunity and evolution. Fish Shellfish Immunol. 41, 421-427. doi: 10.1016/j.fsi.2014.09.028 Zhang, C.N., Rahimnejad, S., Lu, K.L., Zhou, W.H., Zhang, J.L., 2018. Molecular characterization of p38 MAPK from blunt snout bream (Megalobrama amblycephala) and its expression after ammonia stress, and lipopolysaccharide and bacterial challenge. Fish Shellfish Immunol. 84, 23

Journal Pre-proof

848-856. doi: 10.1016/j.fsi.2018.10.074 Zapata, A., Diez, B., Cejalvo, T., Gutiérrez-de Frías C., Cortés A., 2006. Ontogeny of the immune system of fish. Fish Shellfish Immunol. 20, 126-136. doi: 10.1016/j.fsi.2004.09.005 Zwollo, P., Haines, A., Rosato, P., Gumulak-Smith, J., 2008. Molecular and cellular analysis of B-cell populations in the rainbow trout using Pax5 and immunoglobulin markers. Dev. Comp. Immunol. 32, 1482-1496. doi: 10.1016/j.dci.2008.06.008

of

Zhao, D., Zhang, X.N., Liu, D.S., Ru, S.G., 2019. Cu accumulation, detoxification and tolerance in

ro

the red swamp crayfish Procambarus clarkii. Ecotox. Environl. Safe. 175, 201-207.

Jo ur

na

lP

re

-p

doi: 10.1016/j.ecoenv.2019.03.031

24

Journal Pre-proof Conflict of Interest statement

Jo ur

na

lP

re

-p

ro

of

There are no conflict of interest exits in the submission of this manuscript, and manuscript is approved by all authors for publication.

25

Journal Pre-proof

Jo ur

na

lP

re

-p

ro

of

CRediT author statement Yahui Shui: Conceptualization, Investigation, Formal analysis, Writing-Original Draft, Writing Review & Editing Junpu Xie :Resources, Investigation Yong Zhou: Resources, Formal analysis Jinping Li ：Conceptualization, Writing - Review & Editing Jinhua Gan：Conceptualization, Funding acquisition ,Writing - Review & Editing

26

Journal Pre-proof

Fig. 1. Nucleotide sequences along with corresponding deduced amino acid sequences of p38 MAPK from the Procambarus clarkii. Sequences are numbered on the left of each line. The start codon (ATG) and stop codon (TGA) are indicated in bold. The conserved phosphorylation motif TGY and substrate-binding site ATRW are indicated by boxes. The conserved domain STKc is shaded. Fig. 2. Multiple-sequence alignment of the deduced amino acid sequence of Pc-p38 MAPK with other species’p38.

of

Fig. 3. Phylogenetic relationship of Pc-p38 MAPK with other reported P38 MAPKs. The phylogenetic tree of the alignment amino acid sequences was constructed by the neighbor-joining method using the MEGA X. The bar shows the genetic distance (0.050).

ro

Fig. 4. The distribution of p38 MAPK in different tissues of healthy Procambarus clarkii (n = 6; mean ± SD), expression values were normalized by β-actin (A). Cd content in different tissues of

-p

healthy Procambarus clarkii (n = 6; mean ± SD) (B). The regression analysis between the Cd content

re

and the expression level of p38 MAPK in tissues (C).

lP

Fig. 5. Relative expression profiles of Pc-p38MAPK in heart (A), antennal gland (B), gill (C), hepatopancreas (D) and muscle (E) after Cd stress. Data (n = 3; mean ± SD) in different tissues and significant differences of each time point expression between the challenged and control samples

na

were marked with an asterisk (*) at p < 0.05 or two asterisks (**) at p < 0.01.

Jo ur

Fig. 6. Cd content in heart (A), antennal gland (B), gill (C), hepatopancreas (D) and muscle (E) of Procambarus clarkia after Cd stress. Data are expressed as mean ± SD, n = 3 for each group.

27

Journal Pre-proof

Table 1 The primers used for cloning and expression analysis. Primer sequences (5’-3’)

Purpose

F1 R1 F2 R2 5′-RACE GSP1 GSP2

ATGCTSWCCCCWGTGGGCTCGGGG ACTTCTCTGTTGGTAATTCCATG AAGAAATTGGCTCGGCCATTCCAG GTCCTCAAAGCTCTGATCATAAGG

To obtain partical gene fragments To verify partical gene fragments

CTGTTACCCGCCGCTCACTGTCC GCAGTGAACGAATGTAGTTTCGTGC

5’RACE first round PCR 5’RACE second round nested PCR

ro

of

Primer No.

GGACAGTGAGCGGCGGGTAACAG ACAGCGGTACAGGCACTTTCACA

QPCR Pc-p38F Pc-p38R β-actin-F β-actin-R

TATACCAAGTTCTTCGCGGCCTCAA CGTCATCTCAGACTCGGTTGGTC AGTAGCCGCCCTGGTTGTAGAC TTCTCCATGTCGTCCCAGT

3’RACE first round PCR 3’RACE second round nested PCR

Jo ur

na

lP

re

-p

3′-RACE GSP1 GSP2

28

Real-time quantitative PCR Real-time quantitative PCR Real-time quantitative PCR Real-time quantitative PCR

Journal Pre-proof

Jo ur

na

lP

re

-p

ro

of

HIGHLIGHTS • The full-length cDNA sequence of Procambarus clarkii p38 MAPK was acquired. • Procambarus clarkii p38 MAPK expression and cadmium accumulation in different tissues were examined. • Procambarus clarkii hepatopancreas is the crucial tissue for cadmium accumulate. • The cadmium accumulation in the tissues of Procambarus clarkii is related to the p38 expression.

29

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6