Molecular cloning and expression study on Toll-like receptor 5 paralogs in Japanese flounder, Paralichthys olivaceus

Fish & Shellfish Immunology 29 (2010) 630e638

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Molecular cloning and expression study on Toll-like receptor 5 paralogs in Japanese flounder, Paralichthys olivaceus Seong Don Hwang, Takashi Asahi, Hidehiro Kondo, Ikuo Hirono, Takashi Aoki* Laboratory of Genome Science, Tokyo University of Marine Science and Technology, Konan 4-5-7, Minato-ku, Tokyo, 108-8477, Japan

a r t i c l e i n f o

a b s t r a c t

Article history: Received 24 March 2010 Received in revised form 22 May 2010 Accepted 8 June 2010 Available online 16 June 2010

Toll-like receptor (TLR) 5 is responsible for the bacterial flagellin recognition in vertebrates. Synergistic role of TLR 5 membrane form (TLR 5M) and TLR 5 soluble form (TLR 5S) have been reported from the study on rainbow trout. This system is regarded as the unique system in teleost fish. However, systemic response of TLR 5 genes in teleost fish has not been fully understood. Hence, we cloned Japanese flounder (Paralichthys olivaseus) TLR 5M and TLR 5S genes and their expressions were analyzed. The coding region of Japanese founder TLR 5M and TLR 5S cDNA were 2670 bp and 1923 bp, encoding 889 and 640 amino acid residues, respectively. The Japanese flounder TLR 5M was composed of an extracellular leucine rich repeats (LRRs), a transmembrane and an intracellular Toll/interleukin-1 receptor (TIR) domains, whereas TLR 5S possessed only the LRR domain. TLR 5M was highly expressed in the gill, head kidney, heart and liver. TLR 5S was highly expressed in the brain, head kidney and heart. Flagellin stimulation (1 and 5 mg/ ml) led to strong gene expression of TLR 5S in peripheral blood leukocytes (PBLs) and liver cells. In contrast to TLR 5S, TLR 5M was down-regulated until 3 h after flagellin stimulation in PBLs and liver cells. The flagellin stimulation also resulted in the production of the flounder IL-1b and IL-6 from the liver cells and PBLs. The gene expression of TLR 5M was highly induced in the liver, while TLR 5S gene expression was drastically increased in the intestine following challenge with Edwardsiella tarda. Increased number of TLR 5M- and 5S-expressing cell populations were detected by in situ hybridization in the lamina propria of the intestine and liver after E. tarda infection, respectively. These results imply that the expression of these TLR 5 paralogs in Japanese flounder are differently regulated in the whole body and play important roles in the immune response against bacterial pathogens. Ó 2010 Elsevier Ltd. All rights reserved.

Keywords: Toll-like receptor (TLR) TLR 5 membrane TLR 5 soluble Japanese flounder Paralichthys olivaceus

1. Introduction Toll-like receptors (TLRs) that have a crucial role in the host defense have been conserved in both the invertebrate and vertebrate lineages [1]. TLR families in higher vertebrates have been considered to be important mediator of the activation of innate immunity and development of antigen-specific acquired immunity against invading pathogens [2,3]. TLR family members are consist of an extracellular leucine rich repeats (LRRs), a transmembrane and an intracellular toll/interleukin-1 receptor (TIR) domains. The extracellular LRRs domain possesses solenoid structure that carry highly conserved consensus motif [4]. The different structures of the LRR domain in variable TLRs correspond to a variety of pathogen associated molecular patterns (PAMPs) from microorganisms, such as peptidoglycan,

* Corresponding author. Tel.: þ81 03 5463 0556; fax: þ81 03 5463 0690. E-mail address: [email protected] (T. Aoki). 1050-4648/$ e see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2010.06.011

lipoprotein, lipopolysaccharide and flagellin in bacterial pathogen component and dsRNA and ssRNA in the viral genome [2,3,5]. The ligand recognition by the corresponding TLR leads to activation of the subsequent signaling pathway [2,3]. TLR signaling through PAMPs recognition divided to myeloid differentiation primaryresponse protein 88 (MyD88)-dependent and -independent signaling pathway [2,3,5]. The MyD88-dependent pathway leads to inflammatory-cytokine production via NF-kB activation [2,3,5]. The Myd88-independent pathway activates interferon inducible gene production via interferon regulatory factor 3 (IRF3) [2,5]. Mammalian TLR 5 is expressed on the cellular surface of several cell types, such as intestinal epithelial cells, dendtric cells and monocytes of human (Homo sapiens) and splenic macrophages and dendritic cells of mice (Mus musculus) [6e8]. This receptor recognizes the flagellin, which contributes to motile ability of bacterial pathogens [9]. The recognition of bacterial flagellin by TLR 5 triggers MyD88edependent signaling pathway which in turn activates NF-kB to stimulate gene transcription of several proinflammatory genes, including IL-6 and TNF-a [9e11].

S.D. Hwang et al. / Fish & Shellfish Immunology 29 (2010) 630e638

The synergistic effect of the TLR 5 soluble form (TLR 5S) and TLR 5 membrane form (TLR 5M) is unique in teleost fish. Teleost fish TLR 5S is first reported in puffer fish (Takifugu rubripes) and it lacks a transmembrane domain and an intracellular TIR domain [12]. To date, TLR 5S have been reported in rainbow trout (Onchorhynchus mikiss) [13], atlantic salmon (Salmo salar) [14] and catfish (Ictalurus punctatus) [15]. The functional interaction of TLR 5M and TLR 5S have been evaluated in rainbow trout [13,16]. After recognizing bacterial flagellin by TLR 5M, NF-kB pathway is activated to generate immune-responsive genes and TLR 5S. Induced TLR 5S recognize flagellin in the fluid phase, bind to the TLR 5M to trigger the subsequent pathway [13,16]. However, the systemic reaction of teleost fish TLR 5 paralogs during bacterial infection has not been fully understood. Here, we identified both the TLR 5M and TLR 5S from Japanese flounder (Paralichthys olivaseus) and their gene expression during bacterial infection was analyzed by quantitative real-time PCR and in situ hybridization.

2. Materials and methods 2.1. Molecular cloning of Japanese flounder TLR 5M and 5S cDNAs Total RNAs were extracted from kidney of Japanese flounder using RNA iso reagent (Takara, Japan) according to the manufacturer’s instructions. First strand cDNA was synthesized from RNA template using M-MLV reverse transcriptase (Invitrogen, USA). To clone the Japanese flounder TLR 5M gene, degenerate PCR primers (w200 bp) were designed from the conserved TIR nucleotide sequences of TLR 5M in human, puffer fish, rainbow trout and zebrafish (Danio rerio). Degenerate PCR was performed with the designed degenerate primer sets (Table 1) and head kidney cDNA of Japanese flounder as template. The amplified degenerate PCR product was ligated into pGEM-T easy vector (Promega, USA) and the nucleotide sequences were determined with an ABI 3130xl Genetic analyzer (Applied Biosystems, USA). After sequencing and BLAST assay, 50 - and 30 - RACE PCRs were conducted based on the TLR 5M partial nucleotide sequence using an SMART RACE cDNA amplification kit (BD Biosciences, USA) to identify the full-length of TLR 5M cDNA. The RACE PCRs were carried out with RACE PCR primer sets (Table 1). The nucleotide sequences of the amplified TLR 5M RACE PCR products were determined as described above. A partial sequence of TLR 5S was obtained from Japanese flounder liver ESTs (GenBank accession No. C23138). 50 - and 30 RACE PCRs were performed with a RACE PCR primer set (Table 1) to identify the full-length of TLR 5S cDNA as described above. To identify the functionally important domain of both Japanese flounder TLR5 molecules, consensus domains in the TLR family were analyzed by the SMART program (Simple Modular Architecture Research Tool, http://smart.embl-heidelberg.de) and LRR consensus sequence analysis which is highly conserved as XLXXLXLXXN X*XX*X XXXFXXLX [4]. Deduced amino acid sequence of the LRR and TIR domains in Japanese flounder TLR 5M and 5S were compared with known TLR 5 genes in the GenBank database using the Clustal W program. The amino acid sequences of both Japanese flounder TLR 5s were aligned with puffer fish TLR 5M (GenBank accession No. AAW69374), puffer fish TLR 5S (GenBank accession No. AAW69378), rainbow trout TLR 5M (GenBank accession No. NP_001118216), rainbow trout TLR 5S (GenBank accession No. NP_001117680), zebrafish TLR 5 (GenBank accession No. NP_001124067), mouse TLR 5 (GenBank accession No. NP_058624) and human TLR 5 (GenBank accession No. NP_003529) by using Clustal W program.

631

Table 1 PCR primers used in this study. Primer

Primer sequence (50 e30 )

Usage

TLR 5M Degenerate F Degenerate R 30 RACE 50 RACE Real-time long F

TTCCTNAARGAYGGCTGGTG TCYTGNNNRTCMTCMGGCC TGGAGGCTGCTTTACTGAAA TTTCAGTAAAGCAGCCTCCA AGGTTGGTTCTAGGCAACAA

Real-time long R

AACTGTGTGAACTTACGGAG

Real-time short F and sense

GCAGCAGCTGTTTTTGGATCA

Real-time short R Anti sense TLR5M F TLR5M R Probe F Probe R

GCAGGTAGTTGTCAGCCAGGAT TGATCCAAAAACAGCTGCTGC GAAGGCCTCTCGAATAGCGCTGTTA GCACCCCTTGATAAAGTTGCTGCTG TGATTTCAAGCGTCTCCAGA TTACATTCGTCACATTGAGC

Degenerate PCR Degenerate PCR RACE PCR RACE PCR Construction of standard curve Construction of standard curve Detection of mRNA and In situ hybridization Detection of mRNA In situ hybridization RT-PCR RT-PCR Southern blot Southern blot

TLR 5S 30 RACE 50 RACE Real-time long F

GGCCTGAGGAACAGTTCGGTCCTCAC GTGAGGACCGAACTGTTCCTCAGGCC TGTTTCTCCAGCTGGTTACC

Real-time long R

CTGATCAAAAGCGGCACAAA

Real-time short F Real-time short R and sense

CAGATGCCAGCGTGTTTCC TCTTCAAGGCGCAGTTTGCT

Anti sense TLR5S F TLR5S R Probe F Probe R

AGCAAACTGCGCCTTGAAGA ACATCGGGGAGATTAACTCCACCTC CCTGGAAACCCACCAGATCTGATTC ACACTCATCAGTGAGGAGTA GCTATGAAGTTGTTGGAAAG

RACE PCR RACE PCR Construction of standard curve Construction of standard curve Detection of mRNA Detection of mRNA and In situ hybridization In situ hybridization RT-PCR RT-PCR Southern blot Southern blot

b-actin b-actin F b-actin R

ACTACCTCATGAAGATCCTG TTGCTGATCCACATCTGCTG

RT-PCR RT-PCR

EF1-a EF1-F EF1-R

CTCGGGCATAGACTCGTGGT CATGGTCGTGACCTTCGCTC

Detection of mRNA Detection of mRNA

IL-1b IL-1b F IL-1b R

CAGCACATCAGAGCAAGACAACA TGGTAGCACCGGGCATTCT

Detection of mRNA Detection of mRNA

IL-6 IL-6 F IL-6 R

CAGCTGCTGCAAGACATGGA GATGTTGTGCGCCGTCATC

Detection of mRNA Detection of mRNA

Others UNPA

AAGCAGTGGTATCAACGCAGAGT

RACE PCR

2.2. Determination of exon/intron structure of Japanese flounder TLR 5 genes The bacterial artificial chromosome (BAC) library of Japanese flounder [17] was used to determine exon/intron structure of Japanese flounder TLR 5 genes. Gene-specific probes for the flounder TLR 5 genes were designed in the LRR region (w500 bp). PCR-amplified probes were labeled with a-32P [CTP] using a random primer kit (Takara, Japan). The BAC membranes were hybridized with the probes for 2 h at 65  C, then were washed 3 times at 65  C using 1e2% saline sodium citrate (SSC) containing 0.1% sodium dodecyl sulfate (SDS). Positive signals were detected using FLA 9000 (Fuji Photo Film, Japan). The nucleotide sequence of the Japanese flounder TLR 5 genes encoded in the positive BAC clones were sequenced using an ABI 3130xl Genetic analyzer (Applied Biosystems, USA).

632

S.D. Hwang et al. / Fish & Shellfish Immunology 29 (2010) 630e638

2.3. Southern blot analysis For Southern blot analysis, genomic DNA was extracted from the blood of a Japanese flounder using TNES-urea buffer (10 mM TriseHCl, 12 mM NaCl, 10 mM ethylenediaminetetraacetic acid (EDTA), 0.5% SDS and 4 M urea) and digested with PstI and HindIII. Digested genomic DNA was separated by 0.6% agarose gel and transferred to a nylon membrane. The probes used in the BAC clone screening were also subjected to Southern blot analysis to confirm copy number of Japanese flounder TLR 5. The hybridization step during the Southern blot analysis was carried out with the same procedure used in the BAC screening. 2.4. Detection of TLR 5M and TLR 5S gene expression by RT-PCR Total RNAs were extracted from brain, eye, gill, head kidney, heart, intestine, liver, muscle, peripheral blood leukocytes (PBLs), skin, spleen and stomach of healthy Japanese flounder using RNA iso reagent (Takara, Japan). First strand cDNA was synthesized from RNA template using M-MLV reverse transcriptase (Invitrogen, USA). The RT-PCR was performed with cDNA templates of each organ and specific primer sets of TLR 5M and TLR 5S (Table 1) under the following PCR condition: an initial denaturation at 95  C for 4 min, followed by 35 cycle of 95  C for 30 s, 55  C for 30 s, 72  C for 1 min and a final extension of 72  C for 7 min. Amplified PCR products were electrophoresed on 1.5% agarose gel. 2.5. Effect of flagellin on TLR 5 gene expression Peripheral blood and liver were surgically isolated from a Japanese flounder. Japanese flounder PBLs were isolated as previously described [18]. Using Percoll solution (1.072 g/ml), PBLs were isolated by centrifugation (400g for 30 min). Liver cells were isolated as previously described [19]. Liver samples were dissected into 1 mm through a 5 ml syringe and 21-gauge needle, treated with 0.05% collagenase (Gibco, USA) and liver cells were isolated by centrifugation (200g for 10 min). Both PBLs and liver cells were suspended in RPMI 1640 containing 10% fetal bovine serum (FBS) (JRH Biosciences, USA). PBLs (1  106) and liver cells (1  106) were seeded onto a 6-well cell culture microplate (Corning, USA) and stimulated by phosphate buffered saline (PBS) and flagellin (InVivoGen, USA) at 1 and 5 mg/ml. PBLs and liver cells were cultured at 20  C and samples were taken at 1 and 3 h after stimulation. Total RNAs were extracted and reverse-transcribed to cDNA using M-MLV reverse transcriptase (Invitrogen, USA). Quantitative real-time PCR was carried out to confirm chronological alternation of mRNA copy number. Standard curves were produced for each primer set of TLR 5M, TLR 5S, IL-1b and IL-6 (Table 1). The expression levels of each gene were normalized to the expression level of EF-1 a, and were expressed as fold change relative to the value of control group at each time. The significance of differences between the gene expression levels of the stimulated and PBS treated control were determined with a t-test. 2.6. Gene expression profiling of Japanese flounder TLR 5M and TLR 5S after Edwardsiella tarda exposure Healthy Japanese flounder juveniles (average body length: 12.5 cm; average body weight: 15.33 g) were challenged by pathogenic Edwardsiella tarda (ET 54 strain) which was isolated from an infected Japanese flounder. The ET 54 strain was cultured on TSB (BD Biosciences, USA) with 1.5% sodium chloride at 25  C. The cultured ET 54 strain was adjusted to 4.6  105 cfu/ml with artificial sea water in a 10 L tank. The juveniles were immersed with adjusted E. tarda and PBS in 10 L tank. After 10 min later, fish were

placed into 200 L tank at 25  C. At 3 and 5 days post-exposure, the tissues of fish were taken from 3 fish in each group, including blood, gill, head kidney, intestine, liver and spleen. Quantitative real-time PCR was carried out as described above. The significance of differences between the gene expression levels of the infected and control groups were determined with a t-test. 2.7. RNA in situ hybridization Digoxigenin-labeled sense- and antisense- RNA probes for TLR 5M and TLR 5S of Japanese flounder were generated with a DIG Oligonucleotide Tailing Kit, 2nd generation (Roche, Germany). In situ hybridization was performed with an ISHR starting kit (Nippon Gene, Japan) according to the manufacturer’s instructions. Briefly, the liver and intestine were surgically excised from E. tarda infected fish and healthy fish. These tissues were fixed with 4% paraformaldehyde in phosphate buffered saline at 4  C for overnight, embedded in paraffin and sectioned at 5 mm. The sections were spread on APS-treated slides glass (Matsunami, Japan) and treated section with xylene and ethanol. The sections were treated with protease K (5 mg/ml) for 10 min, washed in glycine-PBS buffer (10 mM PBS, 0.1 M NaCl and 2 mg/ml glycine) for 10 min, washed twice in PBS for 3 min, acetylated by acetylation buffer (0.1 M triethanolamine, pH 8.0) with acetic anhydride for 15 min, washed in 4 SSC for 10 min and prehybridization in 50% formamide with 2 SSC at 42  C for 30 min. The sense- and antisense- RNA probe (Table 1) were applied onto the slide with hybridization buffer (50% formamide, 2 SSC, 1 mg/ml tRNA, 1 mg/ml salmon sperm DNA, 1 mg/ml BSA and dextran sulfate) covered with parafilm and incubated overnight in a moistened chamber at 42  C. The section and parafilm were gently separated by washing in 50% formamide with 2 SSC. The sections were washed in 50% formamide with 2 SSC 3 times at 42  C for 20 min, treated RNase A (20 mg/ml) at 37  C for 30 min and washed 3 times in 0.1 SSC at 42  C for 20 min. After blocking in 1% blocking reagent (Roche, Germany), anti-DIG alkaline phosphataseconjugated antibody (Roche, Germany) in blocking buffer was applied to incubate these slides for 1 h at room temperature. After washed 3 times in washing buffer, NBT/BCIP was applied on slide and incubated overnight at a moistened chamber in room temperature in dark room. The sections were counterstained with safranin and evaluated by microscopy. 3. Results 3.1. Sizes of Japanese flounder TLR 5 genes The size of the coding regions of TLR 5M (GenBank accession No. AB562152) and TLR 5S (GenBank accession No. AB562154) in Japanese flounder were 2670 bp and 1923 bp, and amino acid sequences had 889 and 640 residues, respectively (Fig. 1A, B). The 50 and 30 untranslated regions (UTRs) of TLR 5M cDNA were 161 bp and 204 bp, respectively, those of TLR 5S cDNA were 84 bp and 197 bp. 3.2. Structures of Japanese flounder TLR 5 genes TLR 5M of Japanese flounder consists of an LRR domain, a transmembrane domain and a TIR domain (Fig. 1A). On the other hand, TLR 5S, like other TLR 5Ss of teleost fish, has only the LRR domain (Fig. 1B). The LRR domain has a solenoid structure and the amino acid residues insertions at positions 10 and 15 of the LRR consensus sequence appear to provide a concave surface for specific binding surfaces [4,20]. These insertions in an LRR appear to be a characteristic feature of TLRs and it is highly conserved between the same subfamily of TLRs [4]. Therefore, we compared

S.D. Hwang et al. / Fish & Shellfish Immunology 29 (2010) 630e638

633

A

Fig. 1. cDNA and deduced amino acid sequences of TLR 5M (A) and TLR 5S (B) in Japanese flounder. The deduced amino acid sequence is shown under the nucleotide sequence. The box indicates the leucine repeats receptors (LRR) domain. LRR-CT is underlined and the small boxes indicate cysteine residues in LRR-CT. The transmembrane domain is shaded and double underline represents TIR domain.

the locations of the LRRs and their insertion with those of human TLR 5 (Table 3). All of three genes were consisted of 21 LRRs. LRRs 7, 9, 14, 15 and 17 contained insertions at position 15 of LRR consensus sequence (Table 3). LRR-CT is involved in the stabilization of the extracellular portion of TLR [4], but it differs between the two genes. LRR-CT has

4 cysteine residues in TLR 5M but only 2 cysteine residues in TLR 5S (Fig. 1). In a comparison of the amino acid sequences of the LRR and TIR domains of selected fish and mammals, Japanese flounder TLR 5M showed the highest identity with puffer fish TLR 5M (Table 2). The LRR domain of Japanese flounder TLR 5S also showed its highest

634

S.D. Hwang et al. / Fish & Shellfish Immunology 29 (2010) 630e638

B

Fig. 1. (continued).

identity with puffer fish TLR 5S. The amino acid sequence of LRR domain of the Japanese flounder TLR 5M and Japanese flounder TLR 5S reveal 58% identity each other.

from rainbow trout and zebrafish. On the other hand, Japanese flounder TLR 5S was shown to have a highly conserved structure similar to other teleost fish. Single band was detected by the Southern blot analysis of TLR 5M and 5S genes (Fig. 2B). This suggests that the Japanese flounder genome has one copy of each gene.

3.3. Exon/intron structure and copy number in the genome The Japanese flounder TLR 5M and TLR 5S genes were consisted of 4 and 2 exons, respectively (Fig. 2A). The number of introns of Japanese flounder and puffer fish TLR 5M are more than that of mammals, rainbow trout and zebrafish. TLR 5M of Japanese flounder and puffer fish acquired many introns after they separated

3.4. Expression of Japanese flounder TLR 5 genes Japanese flounder TLR 5M was mainly expressed in the gill, head kidney, heart and liver and was weakly expressed in brain, eye,

Table 2 Amino acid sequences identities (%) of LRR and TIR domain of Japanese flounder TLR 5 genes with other species. Japanese flounder

JF

Puffer fish

Zebra fish

Mouse

Human

TLR 5S

TLR 5M

TLR 5S

TLR 5M

TLR 5S

TLR 5M

TLR 5M

TLR 5M

TLR 5M LRR TIR

58 e

63 75

53 e

53 70

50 e

43 58

37 54

36 54

TLR 5S LRR

e

56

65

51

52

43

37

35

Rainbow trout

S.D. Hwang et al. / Fish & Shellfish Immunology 29 (2010) 630e638

635

Fig. 2. Genomic oganiztion of TLR 5M and TLR 5S. Comparison of the exon/intron structures of known TLR 5s from fish and mammals (A). Exons are shown as boxes. Numbers indicate the lengths of exons and introns in bp. Southern blot hybridization analysis of TLR 5M (left) and TLR 5S (right) (B). Genomic DNA was disgested with PstI and HindIII, electrophoresed on a 0.6% agarose gel, transferred to nylon membrane, hybridized to each probe, and exposed to X-ray film.

muscle, skin, spleen and stomach of a healthy fish (Fig. 3). On the other hand, TLR 5S was expressed in almost all organs, but less in eye and stomach and was mainly expressed in head kidney of the healthy fish. To analyze the expression of Japanese flounder TLR 5 genes against their ligand stimulation, TLR 5 genes in PBLs and liver cells were detected by real-time PCR following flagellin stimulation. In PBLs, TLR 5M was down-regulated until 3 h after flagellin

stimulation except at 1 h of higher concentration stimulation (Fig. 4A). On the other hand, induction of TLR 5S gene was significantly increased by 1 and 5 mg/ml flagellin stimulation at 1 and 3 h post stimulation (hps) in PBLs (Fig. 4B). Stimulation with the higher concentration of the flagellin induced higher level of TLR 5S gene expression of (19.8- and 31.5-fold increases at 1 and 3 hps, respectively). In liver cells, flagellin simulation was also downregulated TLR 5M expression, but strongly induced TLR 5S

Fig. 3. Expression of Japanese flounder TLR 5M and TLR 5S genes in tissues by RT-PCR. Total RNA was extracted from different tissues of healthy Japanese flounder and reversetranscribed to cDNA. RT-PCR was performed by specific primers.

636

S.D. Hwang et al. / Fish & Shellfish Immunology 29 (2010) 630e638

A

B

C

D

Fig. 4. Gene expression in flagellin stimulated PBL and liver cells as measured by real-time PCR. Genes are as follows: (A) TLR 5M, (B) TLR 5S, (C) IL-1b and (D) IL-6. Cells were stimulated PBS and flagellin (1 and 5 ug/ml). The mRNA levels of genes were determined by real-time PCR. All data were normalized to EF-1a and data are expressed as foldinduction relative to the control. Error bars indicate standard error of the mean. Asterisks represent a significant difference by t-test method (p < 0.05).

expression (Fig. 4B). IL-1b and IL-6 were induced in PBLs and liver cells after flagellin stimulation (Fig. 4C, D). The highest induction of IL-1b and IL-6 was observed at 1 h in PBLs after high concentration stimulation (18.6- and 36.4-fold increases, respectively) (Fig. 4C, D). IL-6 gene expression in liver cells was up-regulated 1.8-fold over control at 1 hps after 5 mg/ml stimulation (Fig. 4D).

The extracellular LRR domain plays an important role in the recognition of pathogen components on the surface of immune cells. The binding regions of LRR could form on the concave b-face of LRR by a combination of inserts and specific binding surfaces [4,20]. In TLR 5M and 5S of Japanese flounder, the insertion at position 15 was found in LRR 7, 9, 14, 15 and 17, and showed high similarity to insertion patterns of human TLR 5 (Table 3) [4]. These

3.5. Effect of E. tarda on expressions of TLR 5M and TLR 5S

A

100

TLR 5M

F o ld in d u c t io n

30 10

Control

1

3 day 5 day

0.1

Blood

B Fold induction

After E. tarda exposure, mRNA expression of Japanese flounder TLR 5S were increased in blood, gill, kidney, intestine and liver (Fig. 5B). The expression of TLR 5S gene was especially strong in liver at 3 and 5 days post infection (dpi) (109- and 48-fold increases, respectively). Moreover, the TLR 5S gene was up-regulated 7.5- and 22- fold in intestine at 3 and 5 dpi, respectively. On the other hand, mRNA expression of TLR 5M was slight induced in gill at 3 and 5 dpi and in liver at 3 dpi (Fig. 5A). The gene expression of TLR 5M was highly increased 9.6- and 29.1-fold in intestine at 3 and 5 dpi, respectively. A small number of TLR 5S-expressing cells were detected around the central vein of healthy fish liver (Fig. 6A), however, TLR 5S-expressing cells abruptly increased in number throughout the entire liver after infection (Fig. 6C). TLR 5M-expressing cells of Japanese flounder were detected in the lamina propria, which contains capillaries and central lacteal (Fig. 6E, G). Healthy fish had few TLR 5M-expressing cells in intestine (Fig. 6E), while large number of TLR 5M-expressing cells were detected in lamina propria of intestine at 3 days after E. tarda infection (Fig. 6G).

300

Gill

Head Intestine Liver kidney

Spleen

TLR 5S

100 20 10 Control 3 day 5 day

0.1

4. Discussion In this study, we cloned both membrane and soluble form of TLR 5 from Japanese flounder. Japanese flounder TLR 5M, same as mammalian TLR 5, consists of extracellular LRRs, a transmembrane and an intracellular TIR domain. The lack of transmembrane and intracellular domains in Japanese flounder TLR 5S suggested it can be secreted from cells as well as other TLR 5S in teleost fish.

Blood

Gill

Head Intestine kidney

Liver

Spleen

Fig. 5. Induction of Japanese flounder TLR 5M (A) and TLR 5S (B) gene expression in different tissues after Edwardsiella tarda infection. Total RNA was extracted from the indicated tissues at 3 and 5 days post infection. The mRNA levels of Japanese flounder TLR 5M and TLR 5S were determined by real-time PCR. All data were normalized to EF-1a and data are expressed as fold-induction relative to the control. Error bars indicate standard error of the mean. Asterisks represent a significant difference by t-test method (p < 0.05).

S.D. Hwang et al. / Fish & Shellfish Immunology 29 (2010) 630e638

637

Fig. 6. In situ hybridization detection of Japanese flounder TLR 5M and TLR 5S. The liver and intestine were collected at 3 days after E. tarda infection. The TLR 5M- and TLR 5Sexpressing cells were stained blue and indicated by the arrows. In situ hybridization in liver of a healthy fish (A) and an infected fish (C) with Dig-labelled antisense-probe for TLR 5S shows the number of TLR 5S-expressing cells increased after infection. In intestine, the numbers of TLR 5M-expressing cells detected in lamina propria cells of infected fish (G) were much larger than the numbers in the control group (E). B, D, F and H are the negative controls for the respective experiment. Lp indicates lamina propria in intestine. Scale bar ¼ 0.1 mm.

LRRs seem to be candidates for the flagellin-binding region in TLR 5M and TLR 5S of Japanese flounder. The position of LRR insertions are highly conserved between human and teleost fish. Therefore, Japanese flounder TLR 5 might be functionally capable of responding to the mammalian TLR 5 agonist flagellin. In the PBLs and liver cells, the expression of Japanese flounder TLR 5S was strongly induced following flagellin stimulation (Fig. 4B). This

Table 3 Comparison of leucine-rich repeats (LRRs) location between human TLR 5 (GenBank ac. NP_003259) and Japanese flounder TLR 5M and TLR 5S. LRR

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 CT

Amino acid positions Human

Japanese flounder

TLR 5

TLR 5M

TLR 5S

47e70 71e95 96e119 120e145 146e170 171e196 197e226 227e253 254e288 289e312 313e336 337e360 361e384 385e416 417e448 449e473 474e502 503e526 527e548 549e569 570e629

47e70 71e97 98e121 122e147 148e172 173e198 199e230 231e257 258e291 292e315 316e340 341e364 365e388 389e424 425e459 460e486 487e515 516e539 540e561 562e582 583e644

47e70 71e95 96e119 120e145 146e170 171e196 197e228 229e254 255e289 290e313 314e338 339e362 363e386 387e424 425e469 470e483 484e512 513e536 537e558 559e579 580e641

The bolded LRRs have amino acid residues inserted at the 15th position. CT indicates the LRR flanked at the C-terminal.

appears to be due to the acute-phase production of the flounder TLR 5S. The acute-phase production of TLR 5S for sensing bacterial flagellins was also observed in rainbow trout [21]. In contrast, TLR 5M expression was down-regulated until 3 h post stimulation except at 1 h post 5 mg/ml stimulation (Fig. 4A). The down-regulation of TLR family expression has been reported in other animals [22,23]. Therefore, expression of Japanese flounder TLR 5M seem to be suppressed by the negative feedback system. The NF-kB is activated as a result of TLR 5 signal transduction in mammals [9,10]. The proinflammatory cytokine IL-1b and pleiotropic cytokine IL-6 are regulated by the activity of NF-kB [24,25]. Both IL-1b and IL-6 genes were induced by flagellin stimulation (Fig. 4C, D), suggesting that these cytokines are functionally involved in the TLR 5-mediated immune response of Japanese flounder. The gene expression pattern of TLR 5M in healthy Japanese flounder tissues was not consistent with the gene expression patterns in other teleost fish. The TLR 5M genes of puffer fish and rainbow trout are ubiquitously expressed [12,13], whereas, in healthy fish Japanese flounder, the TLR 5M gene was expressed in all tissues examined except intestine (Fig. 3). However, after exposure to E. tarda, the expression of the TLR 5M gene in the intestine was significantly up-regulated (Fig. 5A). Intraperitoneal inoculation of Mycobacterum marinum in zebrafish also resulted in up-regulation of the TLR 5 genes [26]. Further, the gene expression of the zebrafish TLR 5M is restricted to only digestive organ in the healthy fish [27]. In situ hybridization of E. tarda-challenged fish with a probe specific for Japanese flounder TLR 5M demonstrated an increased number of TLR 5M-expressing cells in the lamina propria (Fig. 6G). Thus, teleost membrane form of TLR 5 is appears to be important for the recognition of bacteria in the intestine. Mammalian TLR 5 is also expressed higher on CD11chighCD11bhigh lamina propria dendritic cells than epithelial cells of intestine and its expression was found to induce differentiation of T helper and IgAþ cell following flagellin recognition [28e30]. The role of teleost TLR 5M-expressing cells may similar to that of mammalian TLR

638

S.D. Hwang et al. / Fish & Shellfish Immunology 29 (2010) 630e638

5-expressing cells in the intestine. Unfortunately, we could not identify the populations of Japanese flounder TLR 5M-expressing cells in this study, because the information about the population of Japanese flounder antigen presenting cells (APCs) including dendritic cells are still limited. Further studies on teleost fish TLR 5M-expressing cells may yield more novel information of APCs that are involved in mucosal immunity in digestive organs of the teleost fish. TLR 5S gene expression in the head kidney is strong in healthy Japanese flounder (Fig. 3), but was not significantly up-regulated during the bacterial infection (Fig. 5B). However, TLR 5S expression was up-regulated more than 100-folds in the liver of E. tarda infected fish (Fig. 5B). Further, TLR 5S-expressing cells were detected throughout liver (Fig. 6C). Tsujita et al. (2004) reported the acute-phase induction of rainbow trout TLR 5S gene in trout hepatoma cell line (RTH-149) following the inoculation with Vibrio anguillarum flagellin A. The combination of the inducible TLR 5S and TLR 5M synergistically mediated intracellular signaling cascade and was speculated to provoke the robust immune responses in rainbow trout [13,21]. Taken together, these results suggest that hepatocytes are a major source of TLR 5S production in teleost fish. Therefore, TLR 5S in the circulation, which is produced in liver cells, may systemically amplify the TLR 5M-mediated immune responses against E. tarda. In summary, expression of Japanese flounder TLR 5 paralogs is differently regulated in the tissues against ligand stimulation and bacterial infection. It may be important for the modulation of systemic immune responses. The flounder TLR 5M was strongly up-regulated in the intestine after E. tarda infection. It can be cased by the accumulation of TLR 5M-expressing cells at the intestinal lamina propria to detect the pathogenic enterobacteria. Japanese flounder liver cells produce a huge amount of the circulatory TLR 5S. TLR 5S in circulation may enhance the sensitivity of flagellin recognition by TLR 5M-expressing leucocytes. Acknowledgments We thank to Dr. Tomokazu Takano, National Research Institute of Aquaculture, who kindly gave us useful suggestions on this manuscript. References [1] Purcell MK, Smith KD, Hood L, Winton JR, Roach JC. Conservation of Toll-like receptor signaling pathways in teleost fish. Comp Biochem Physiol Part D Genomics Proteomics 2006;1:77e88. [2] Akira S, Takeda K. Toll-like receptor signalling. Nat Rev Immunol 2004;4:499e511. [3] Medzhitov R. Toll-like receptors and innate immunity. Nat Rev Immunol 2001;1:135e45. [4] Bell JK, Mullen GE, Leifer CA, Mazzoni A, Davies DR, Segal DM. Leucine-rich repeats and pathogen recognition in Toll-like receptors. Trends Immunol 2003;24:528e33. [5] Takeda K, Kaisho T, Akira S. Toll-like receptors. Annu Rev Immunol 2003;21:335e76. [6] Vijay-Kumar M, Aitken JD, Gewirtz AT. Toll-like receptor-5: protecting the gut from enteric microbes. Semin Immunopathol 2008;30:11e21.

[7] Kadowaki N, Ho S, Antonenko S, Malefyt RW, Kastelein RA, Bazan F, et al. Subsets of human dendritic cell precursors express different toll-like receptors and respond to different microbial antigens. J Exp Med 2001;194:863e9. [8] Means TK, Hayashi F, Smith KD, Aderem A, Luster AD. The Toll-like receptor 5 stimulus bacterial flagellin induces maturation and chemokine production in human dendritic cells. J Immunol 2003;170:5165e75. [9] Hayashi F, Smith KD, Ozinsky A, Hawn TR, Yi EC, Goodlett DR, et al. The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5. Nature 2001;410:1099e103. [10] Gewirtz AT, Navas TA, Lyons S, Godowski PJ, Madara JL. Cutting edge: bacterial flagellin activates basolaterally expressed TLR5 to induce epithelial proinflammatory gene expression. J Immunol 2001;167:1882e5. [11] Didierlaurent A, Ferrero I, Otten LA, Dubois B, Reinhardt M, Carlsen H, et al. Flagellin promotes myeloid differentiation factor 88-dependent development of Th2-type response. J Immunol 2004;172:6922e30. [12] Oshiumi H, Tsujita T, Shida K, Matsumoto M, Ikeo K, Seya T. Prediction of the prototype of the human Toll-like receptor gene family from the pufferfish, Fugu rubripes, genome. Immunogenetics 2003;54:791e800. [13] Tsujita T, Tsukada H, Nakao M, Oshiumi H, Matsumoto M, Seya T. Sensing bacterial flagellin by membrane and soluble orthologs of Toll-like receptor 5 in rainbow trout (Onchorhynchus mikiss). J Biol Chem 2004;279:48588e97. [14] Tsoi S, Park KC, Kay HH, O’Brien TJ, Podor E, Sun G, et al. Identification of a transcript encoding a soluble form of toll-like receptor 5 (TLR5) in Atlantic salmon during Aeromonas salmonicida infection. Vet Immunol Immunopathol 2006;109:183e7. [15] Baoprasertkul P, Xu P, Peatman E, Kucuktas H, Liu Z. Divergent Toll-like receptors in catfish (Ictalurus punctatus): TLR5S, TLR20, TLR21. Fish Shellfish Immunol 2007;23:1218e30. [16] Tsujita T, Ishii A, Tsukada H, Matsumoto M, Che FS, Seya T. Fish soluble Tolllike receptor (TLR)5 amplifies human TLR5 response via physical binding to flagellin. Vaccine 2006;24:2193e9. [17] Katagiri T, Asakawa S, Hirono I, Aoki T, Shimizu N. Genomic bacterial artificial chromosome library of the Japanese flounder, Paralichthys olivaceus. Mar Biotechnol 2000;2:571e6. [18] Hirono I, Nam BH, Kurobe T, Aoki T. Molecular cloning, characterization, and expression of TNF cDNA and gene from Japanese flounder, Paralichthys olivaceus. J Immunol 2000;165:4423e7. [19] Pesonen M, Andersson TB. Fish primary hepatocyte culture; an important model for xenobiotic metabolism and toxicity studies. Aquat Toxicol 1997;37:253e67. [20] Bell JK, Botos I, Hall PR, Askins J, Shiloach J, Segal DM, et al. The molecular structure of the Toll-like receptor 3 ligand-binding domain. PNAS 2005;102:10976e80. [21] Tsukada H, Fukui A, Tsujita T, Matsumoto M, Iida T, Seya T. Fish soluble Toll-like receptor 5 (TLR5S) is an acute-phase protein with integral flagellinrecognition activity. Int J Mol Med 2005;15:519e25. [22] Cabral ES, Gelderblom H, Hornung RL, Munson PJ, Martin R, Marques AR. Borrelia burgdorferi lipoprotein-mediated TLR2 stimulation causes the downregulation of TLR5 in human monocytes. J Infect Dis 2006;193:849e59. [23] van Aubel RA, Keestra AM, Krooshoop DJ, van Eden W, van Putten JP. Ligandinduced differential cross-regulation of Toll-like receptors 2, 4 and 5 in intestinal epithelial cells. Mol Immunol 2007;44:3702e14. [24] Libermann TA, Baltimore D. Activation of interleukin-6 gene expression through the NF-kB transcription factor. Mol Cell Biol 1990;10:2327e34. [25] Cogswell JP, Godlevski MM, Wisely GB, Clay WC, Leesnitzer LM, Ways JP, et al. NF-kappa B regulates IL-1 beta transcription through a consensus NF-kappa B binding site and a nonconsensus CRE-like site. J Immunol 1994;153:712e23. [26] Meijer AH, Gabby Krens SF, Medina Rodriguez IA, He S, Bitter W, Ewa SnaarJagalska B, et al. Expression analysis of the Toll-like receptor and TIR domain adaptor families of zebrafish. Mol Immunol 2004;40:773e83. [27] Jault C, Pichon L, Chluba J. Toll-like receptor gene family and TIR-domain adapters in Danio rerio. Mol Immunol 2004;40:759e71. [28] Uematsu S, Jang MH, Chevrier N, Guo Z, Kumagai Y, Yamamoto M, et al. Detection of pathogenic intestinal bacteria by Toll-like receptor 5 on intestinal CD11cþ lamina propria cells. Nat Immunol 2006;7:868e74. [29] Uematsu S, Fujimoto K, Jang MH, Yang BG, Jung YJ, Nishiyama M, et al. Regulation of humoral and cellular gut immunity by lamina propria dendritic cells expressing Toll-like receptor 5. Nat Immunol 2008;9:769e76. [30] Uematsu S, Akira S. Immune responses of TLR5þ lamina propria dendritic cells in enterobacterial infection. J Gastroenterol 2009;44:803e11.