- Email: [email protected]
Molecular cloning and expression analysis of NOD-like receptor 5 in Japanese flounder (Paralichthys olivaceus) after injection with two different formalin-killed pathogenic bacteria and poly (I:C)
Developmental and Comparative Immunology xxx (2016) 1e4
Contents lists available at ScienceDirect
Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci
Molecular cloning and expression analysis of NOD-like receptor 5 in Japanese flounder (Paralichthys olivaceus) after injection with two different formalin-killed pathogenic bacteria and poly (I:C) Kittipong Thanasaksiri, Ikuo Hirono, Hidehiro Kondo* Laboratory of Genome Science, Graduate School of Tokyo University of Marine Science and Technology, Konan 4-5-7, Minato, Tokyo 108-8477, Japan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 23 June 2016 Received in revised form 30 August 2016 Accepted 30 August 2016 Available online xxx
NOD-like receptors (NLRs) are members of pattern recognition receptors (PRRs) recognized intracellular pathogens. Here, we identified a type of NLR with a CARD domain (NLRC5) in Japanese flounder, Paralichthys olivaceus (JfNLRC5). The coding sequence JfNLRC5 is 5529 bp long and encodes a protein of 1842 deduced amino acid residues. JfNLRC5 transcripts were highly detected in gills, intestine and spleen of healthy fish. In Japanese flounder stimulated with poly (I:C), JfNLRC5 was significantly up-regulated after 24 h at 15 C and after 3 h at 25 C. Expression of JfNLRC5 was up-regulated by formalin-killed Edwardsiella tarda but not by formalin-killed Streptococcus iniae. These findings suggest that JfNLRC5 is involved in fish immune response against viral and Gram-negative bacterial infections. © 2016 Published by Elsevier Ltd.
Keywords: Japanese flounder NLRC5 Poly (I:C) Edwardsiella tarda Streptococcus iniae
1. Introduction The innate immune system is the first line of host defense against invading pathogens. Pathogen recognition receptors (PRRs) recognize conserved molecules associated with pathogenassociated molecular patterns (PAMPs), such as lipopolysaccharides, peptidoglycans and nucleic acids (Kumar et al., 2011). There are several types of PRRs. These include Toll-like receptors (TLRs), C-type lectin receptors (CLRs), retinoic acid inducible gene I (RIG-I)like receptors (RLRs) and the nucleotide binding oligomerization domain (NOD)-like receptors (NLRs). NLRs are intracellular microbial recognition molecules (Geddes et al., 2009) that have a role in bacterial recognition in the cytoplasm (Kumar et al., 2011). NLRs commonly contain three distinct functional domains: an N-terminal effector-binding domain (PYRIN, caspase recruitment domain (CARD) and baculovirus inhibitior of apoptosis protein repeat (BIR) domain); a centrally nucleotide binding domain termed NOD domain (also referred to as NACHT domain), and a carboxy-terminal leucine-rich repeat (LRR) domain. Mammalian NLRs are classified into five subfamilies (NLRA,
NLRB, NLRC, NLRP and NLRX) based on their N-terminal domain organization (Geddes et al., 2009). NLRAs contain an acidic transactivation domain (CIITA), NLRBs contain a BIR domain, NLRCs contain a CARD, NLRPs contain a PYRIN domain, and NLRXs contain an unknown domain (Kawai and Akira, 2009). A mammalian NLRC (NLRC5) has been shown to have roles antiviral immune responses, regulation of MHC class I gene and inflammatory pathways (Benko et al., 2010; Cui et al., 2010; Kuenzel et al., 2010; Meissner et al., 2010; Neerincx et al., 2010), indicating that it has a role in regulating the immune system. NLRC5 genes have been identified in channel catfish (Ictalurus punctatus) and zebrafish (Danio rerio) (Laing et al., 2008; Rajendran et al., 2012), but their roles are unclear. We recently found that Japanese flounder NLRC5-like gene was differentially expressed between 15 C and 25 C after poly (I:C) treatment (Thanasaksiri et al., 2015). Hence, we cloned the coding sequences of NLRC5 from Japanese flounder (JfNLRC5) and analyzed its mRNA expression in various tissues of healthy fish, and fish injected with poly (I:C), and formalin-killed Edwardsiella tarda and Streptococcus iniae cells.
* Corresponding author. E-mail address: [email protected] (H. Kondo). http://dx.doi.org/10.1016/j.dci.2016.08.017 0145-305X/© 2016 Published by Elsevier Ltd.
Please cite this article in press as: Thanasaksiri, K., et al., Molecular cloning and expression analysis of NOD-like receptor 5 in Japanese flounder (Paralichthys olivaceus) after injection with two different formalin-killed pathogenic bacteria and poly (I:C), Developmental and Comparative Immunology (2016), http://dx.doi.org/10.1016/j.dci.2016.08.017
2
K. Thanasaksiri et al. / Developmental and Comparative Immunology xxx (2016) 1e4
Japanese flounder with an average size of 5.8 g were maintained at 22 C and fed daily with commercial pellets. Fish were held for a week to prior to the start of the experiment.
were used as queries for BLAST searches of GenBank (http://www. ncbi.nlm.nih.gov/BLAST). Protein domains were analyzed using the Simple Modular Architecture Research Tool (SMART) program (http://smart.embl.de/) and INTERPRO (IPR) domain classifications (http://www.ebi.ac.uk/interpro/) (Letunic et al., 2009). Phylogenetic trees were constructed based on the ClustalX alignments by Mega 6 program (Tamura et al., 2013).
2.2. Cloning the JfNLRC5
2.4. Expression patterns
A set of primers (Table 1) was designed from EST sequences of a Japanese flounder leucocyte cDNA library obtained from the NGS result of Japanese flounder (Taechavasonyoo et al., 2013) and coding sequences of JfNLRC5 were identified with a SMART™ RACE cDNA Amplification Kit (Clontech, USA) according to the manufacturer's instructions. The obtained sequences were analyzed using bioinformatics tools as described below.
Eight tissues (brain, gills, intestine, kidney, liver, muscle, skin and spleen) were collected from each of six healthy fish. RNA extraction, cDNA synthesis and qPCR analysis were performed as described previously (Thanasaksiri et al., 2015). The primers used for qPCR are shown in Table 1.
2.3. Sequence analysis
The selection of samples of poly (I:C)-treated fish was described previously (Thanasaksiri et al., 2015). Briefly, spleen was collected from poly (I:C)- or DEPC water-treated fish reared at 15 C and 25 C, and RNA extraction and cDNA synthesis were performed. The same set of 4 cDNA samples from 4 individual fish were used in this study. The qPCR of gene expression was as described below.
2. Materials and methods 2.1. Fish maintenance
The JfNLRC5 nucleotide and deduced amino acid sequences
Table 1 Primers used in this study. Gene
Primer
Sequence (50 e30 )
Application
NLRC5
NLRC5-F1 NLRC5-F2 NLRC5-F3 NLRC5-R1 NLRC5-R2 NLRC5-R3 NLRC5-qF NLRC5-qR
CGGCATCGGAATGGA GCAGATTGCCGCAACTTC CAAGCTACAAGTTTTCAGTGCCT ATCCGTGGGCGTTTGAT CAGCAAAGCCTCTGAGAGCTTCTCA TTAGGTGGAAGAGAAATT GAACCTTGTCAGCGACGAATCAG CCTTGATGTGTGTCAGCGATGGTAG
30 RACE 30 RACE 30 RACE 50 RACE 50 RACE 50 RACE qPCR qPCR
Japanese flounder (LC158841) Channel catfish (NP_001186995.1) Large yellow croaker (KKF09127.1) Pig (AGG68119.1) Chicken (AEY11256.1) Mouse (ACP40992.1) Human (NP_115582.4)
2.5. Poly (I:C) injection
2.6. Formalin-killed E. tarda and S. iniae cells treatments E. tarda strain 54 and S. iniae strain ATCC29178 were cultured in heart infusion medium at 25 C for 24 h. The bacteria were killed by adding 2% final concentration of formalin and were incubated at 4 C overnight on a rotary shaker. The formalin-killed cells (FKC) were washed three times with phosphate buffer saline (PBS) and were suspended in PBS. Fish were intraperitoneally injected with
NACHT
NACHT
NACHT
NACHT
NACHT
NACHT
NACHT
200 aa Fig. 1. Schematic diagrams of domain organization in NLRC5 proteins in Japanese flounder and other vertebrates. The NACHT domains and LRRs domains are indicated based on domain prediction by SMART and INTERPRO programs. LRRs are indicated by rectangular boxes.
Please cite this article in press as: Thanasaksiri, K., et al., Molecular cloning and expression analysis of NOD-like receptor 5 in Japanese flounder (Paralichthys olivaceus) after injection with two different formalin-killed pathogenic bacteria and poly (I:C), Developmental and Comparative Immunology (2016), http://dx.doi.org/10.1016/j.dci.2016.08.017
Relative mRNA expression (log2)
K. Thanasaksiri et al. / Developmental and Comparative Immunology xxx (2016) 1e4
12 10 8 6 4 2 0 -2 -4
a
a
c
3
a
ab
bc
c
d
Brain
Gills Intestine Kidney
Liver
Muscle
Skin
Spleen
Fig. 2. JfNLRC5 mRNA expression in healthy Japanese flounder tissues. The relative expression level of JfNLRC5 gene in different tissues was normalized with tissue where the expression level of JfNLRC5 gene was the lowest. Different letters represent statistical significance by one-way ANOVA (p < 0.05).
Fig. 3. mRNA expression of JfNLRC5 in spleen of poly (I:C)-treated Japanese flounder. One-way ANOVA was used for statistical analysis in each temperature. Different letters represent statistical significance by one-way ANOVA (p < 0.05).
FKC of E. tarda at 2.3 108 cells per fish or FKC of S. iniae at 1.9 108 cells per fish. Five individuals were sampled at 0 (prior to injection), 3, 6, 12, 24 and 72 h post injection (hpi). Spleen tissue was collected and analysis of JfNLRC5 gene expression was performed by qPCR using cDNA samples as described below.
significance at p < 0.05 was calculated by one-way analysis of variance (one-way ANOVA).
3. Results and discussion 3.1. Identification of JfNLRC5
2.7. qPCR and statistical analyses qPCR was carried out using Thunderbird SYBR qPCR mix (Toyobo, Japan) and relative mRNA expression was determined by 2DDCt method using EF-1a as the internal reference. Statistical analysis was performed using SPSS version 17.0. The statistical
The cDNA of JfNLRC5 is 5529 bp long with 1842 amino acid residues (Supplementary Fig. 1). Conserved domain prediction of JfNLRC5 by SMART and INTERPRO programs revealed that JfNLRC5 consisted of a NACHT domain at middle (219e359 aa) and 12 Cterminal LRR domains (at 761e785, 789e813, 1015e1,042,
Fig. 4. Expression of JfNLRC5 gene in spleen of FKC of E. tarda- or S. iniae-treated Japanese flounder. Student's t-test was used for statistical analysis. Asterisks indicate significant differences between normal fish (0 h) and FKC of E. tarda- or S. iniae-treated Japanese flounder at each time point (3, 6, 12, 24 and 72 hpi) (p < 0.05).
Please cite this article in press as: Thanasaksiri, K., et al., Molecular cloning and expression analysis of NOD-like receptor 5 in Japanese flounder (Paralichthys olivaceus) after injection with two different formalin-killed pathogenic bacteria and poly (I:C), Developmental and Comparative Immunology (2016), http://dx.doi.org/10.1016/j.dci.2016.08.017
4
K. Thanasaksiri et al. / Developmental and Comparative Immunology xxx (2016) 1e4
1043e1,070, 1127e1,151, 1233e1,257, 1446e1,470, 1527e1,554, 1643e1,670, 1671e1,698, 1699e1726 and 1781e1805 aa) (http:// www.sciencedirect.com/science/article/pii/S1050464812000708 Fig. 1). NLRC5s have been identified in mammals, including human (Kuenzel et al., 2010) and mouse (Ji and Wang, 2012), and in fish, including channel catfish (Yao et al., 2015) and large yellow croaker (Larimichthys crocea) (Ao et al., 2015). All NLRC5s contain a NACHT and a variable number of LRR domains. Channel catfish and large yellow croaker have 13 and 10 LRRs, respectively (Fig. 1). 3.2. Tissue distribution of JfNLRC5 expression Transcripts of JfNLRC5 were detected in all tissues examined, with significant expression in gills, intestine and spleen but low expression in liver (Fig. 2). These results are consistent with those of previous studies in channel catfish and miiuy croaker (Miichthys miiuy), which showed that NLRC5 transcripts were clearly detected in intestine, blood and gills but were weakly detected in liver and muscle (Li et al., 2012, 2015; Sha et al., 2009). In human and mouse, NLRC5 transcripts were strongly detected in spleen, thymus, and lung (Benko et al., 2010; Cui et al., 2010). Together, these observations suggest that NLRC5s are involved in the immune response and might have a specific role at mucosal surfaces. 3.3. Expression analysis of JfNLRC5 Poly (I:C) treatment significantly increased JfNLRC5 transcript levels in spleen at 24 hpi at 15 C and at 3 hpi at 25 C (Fig. 3). This result was consistent with our previous report on the gene expression profiling of Japanese flounder modulated by temperature using a microarray (Thanasaksiri et al., 2015). Poly (I:C) also up-regulated NLRC5 mRNA expression in mouse at 4 h after stimulation (Tong et al., 2012). In miiuy croaker, the significant upregulation of NLRC5 was observed in spleen at 6 and 24 hpi (Li et al., 2015). Together, these findings suggest that JfNLRC5 is involved in the antiviral immune response. Formalin-killed E. tarda significantly induced the expression of JfNLRC5 in spleen at 12 hpi, while formalin-killed S. iniae had no effect (Fig. 4). The effects of E. tarda injection on gene expression in Japanese flounder are different from those of S. iniae injection (Dumrongphol et al., 2009; Kondo et al., 2014). Formalin-killed E. tarda up-regulated Japanese flounder NLRC5-like gene expression in kidney at 12 hpi but formalin-killed S. iniae had no effect (Kondo et al., 2014). Vibrio anguillarum, a Gram negative bacteria, also up-regulated NLRC5 mRNA expression in kidney of miiuy croaker at 12 hpi (Li et al., 2015). It is unclear why JfNLRC5 clearly responds to E. tarda but not to S. iniae. One possibility is that different cell wall components between Gram-negative bacteria (E. tarda) and Gram-positive bacteria (S. iniae) might be involved in the stimulation of JfNLRC5 expression through distinct signaling pathways. In conclusion, we identified the NLRC5 gene in Japanese flounder. The deduced amino acid sequences shared similar characteristics with other known NLRC5 genes. JfNLRC5 transcripts were constitutively expressed in tissues involved in immunity and were up-regulated by PAMPs stimulation, indicating that JfNLRC5 is involved in antiviral and bacterial responses. Acknowledgements This work was supported in part by grants from JSPS Grant-inAid for Young Scientists (B), JSPS Asian Core University Program, and a Japanese Government (Monbukagakusho: MEXT) Scholarship.
Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.dci.2016.08.017.
References Ao, J., Mu, Y., Xiang, L.X., Fan, D., Feng, M., Zhang, S., Shi, Q., Zhu, L.Y., Li, T., Ding, Y., Nie, L., Li, Q., Dong, W.R., Jiang, L., Sun, B., Zhang, X., Li, M., Zhang, H.Q., Xie, S., Zhu, Y., Jiang, X., Wang, X., Mu, P., Chen, W., Yue, Z., Wang, Z., Wang, J., Shao, J.Z., Chen, X., 2015. Genome sequencing of the perciform fish Larimichthys crocea provides insights into molecular and genetic mechanisms of stress adaptation. PLoS Genet. 11, e1005118. Benko, S., Magalhaes, J.G., Philpott, D.J., Girardin, S.E., 2010. NLRC5 limits the activation of inflammatory pathways. J. Immunol. 185, 1681e1691. Cui, J., Zhu, L., Xia, X., Wang, H.Y., Legras, X., Hong, J., Ji, J., Shen, P., Zheng, S., Chen, Z.J., Wang, R.F., 2010. NLRC5 negatively regulates the NF-kappaB and type I interferon signaling pathways. Cell 141, 483e496. Dumrongphol, Y., Hirota, T., Kondo, H., Aoki, T., Hirono, I., 2009. Identification of novel genes in Japanese flounder (Paralichthys olivaceus) head kidney upregulated after vaccination with Streptococcus iniae formalin-killed cells. Fish. Shellfish Immunol. 26, 197e200. Geddes, K., Magalhaes, J.G., Girardin, S.E., 2009. Unleashing the therapeutic potential of NOD-like receptors. Nat. Rev. Drug. Discov. 8, 465e479. Ji, J., Wang, R., 2012. Molecular cloning of large alternative transcripts based on comparative phylogenetic analysis and exploration of an EST database. Anal. Biochem. 424, 140e141. Kawai, T., Akira, S., 2009. The roles of TLRs, RLRs and NLRs in pathogen recognition. Int. Immunol. 21, 317e337. Kondo, H., Kawana, Y., Suzuki, Y., Hirono, I., 2014. Comprehensive gene expression profiling in Japanese flounder kidney after injection with two different formalin-killed pathogenic bacteria. Fish. Shellfish Immunol. 41, 437e440. €sler, R., Lipinski, S., Jung, S., Gro € tzinger, J., Kuenzel, S., Till, A., Winkler, M., Ha Fickenscher, H., Schreiber, S., Rosenstiel, P., 2010. The nucleotide-binding oligomerization domain-like receptor nlrc5 is involved in ifn-dependent antiviral immune responses. J. Immunol. 184, 1990e2000. Kumar, H., Kawai, T., Akira, S., 2011. Pathogen recognition by the innate immune system. Int. Rev. Immunol. 30, 16e34. Laing, K.J., Purcell, M.K., Winton, J.R., Hansen, J.D., 2008. A genomic view of the NOD-like receptor family in teleost fish: identification of a novel NLR subfamily in zebrafish. BMC Evol. Biol. 8, 42. Letunic, I., Doerks, T., Bork, P., 2009. SMART 6: recent updates and new developments. Nucleic Acids Res. 37, D229eD232. Li, J., Kong, L., Gao, Y., Wu, C., Xu, T., 2015. Characterization of NLR-A subfamily members in miiuy croaker and comparative genomics revealed NLRX1 underwent duplication and lose in actinopterygii. Fish. Shellfish Immunol. 47, 397e406. Li, M., Wang, Q.L., Lu, Y., Chen, S.L., Li, Q., Sha, Z.X., 2012. Expression profiles of NODs in channel catfish (Ictalurus punctatus) after infection with Edwardsiella tarda, Aeromonas hydrophila, Streptococcus iniae and channel catfish hemorrhage reovirus. Fish. Shellfish Immunol. 33, 1033e1041. Meissner, T.B., Li, A., Biswas, A., Lee, K.H., Liu, Y.J., Bayir, E., Iliopoulos, D., van den Elsen, P.J., Kobayashi, K.S., 2010. NLR family member NLRC5 is a transcriptional regulator of MHC class I genes. Proc. Natl. Acad. Sci. 107, 13794e13799. Neerincx, A., Lautz, K., Menning, M., Kremmer, E., Zigrino, P., Hosel, M., Buning, H., Schwarzenbacher, R., Kufer, T.A., 2010. A role for the human nucleotide-binding domain, leucine-rich repeat-containing family member NLRC5 in antiviral responses. J. Biol. Chem. 285, 26223e26232. Rajendran, K.V., Zhang, J., Liu, S., Kucuktas, H., Wang, X., Liu, H., Sha, Z., Terhune, J., Peatman, E., Liu, Z., 2012. Pathogen recognition receptors in channel catfish: I. Identification, phylogeny and expression of NOD-like receptors. Dev. Comp. Immunol. 37, 77e86. Sha, Z., Abernathy, J.W., Wang, S., Li, P., Kucuktas, H., Liu, H., Peatman, E., Liu, Z., 2009. NOD-like subfamily of the nucleotide-binding domain and leucine-rich repeat containing family receptors and their expression in channel catfish. Dev. Comp. Immunol. 33, 991e999. Taechavasonyoo, A., Kondo, H., Nozaki, R., Suzuki, Y., Hirono, I., 2013. Identification of novel interleukin 1 beta family genes in Japanese flounder Paralichthys olivaceus. Fish. Shellfish Immunol. 34, 393e396. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725e2729. Thanasaksiri, K., Hirono, I., Kondo, H., 2015. Temperature-dependent regulation of gene expression in poly (I: C)-treated Japanese flounder, Paralichthys olivaceus. Fish. Shellfish Immunol. 45, 835e840. Tong, Y., Cui, J., Li, Q., Zou, J., Wang, H.Y., Wang, R.F., 2012. Enhanced TLR-induced NF-kappaB signaling and type I interferon responses in NLRC5 deficient mice. Cell Res. 22, 822e835. Yao, J., Mu, W., Liu, S., Zhang, J., Wen, H., Liu, Z., 2015. Identification, phylogeny and expression analysis of suppressors of cytokine signaling in channel catfish. Mol. Immunol. 64, 276e284.
Please cite this article in press as: Thanasaksiri, K., et al., Molecular cloning and expression analysis of NOD-like receptor 5 in Japanese flounder (Paralichthys olivaceus) after injection with two different formalin-killed pathogenic bacteria and poly (I:C), Developmental and Comparative Immunology (2016), http://dx.doi.org/10.1016/j.dci.2016.08.017
Contents lists available at ScienceDirect
Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci
Molecular cloning and expression analysis of NOD-like receptor 5 in Japanese flounder (Paralichthys olivaceus) after injection with two different formalin-killed pathogenic bacteria and poly (I:C) Kittipong Thanasaksiri, Ikuo Hirono, Hidehiro Kondo* Laboratory of Genome Science, Graduate School of Tokyo University of Marine Science and Technology, Konan 4-5-7, Minato, Tokyo 108-8477, Japan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 23 June 2016 Received in revised form 30 August 2016 Accepted 30 August 2016 Available online xxx
NOD-like receptors (NLRs) are members of pattern recognition receptors (PRRs) recognized intracellular pathogens. Here, we identified a type of NLR with a CARD domain (NLRC5) in Japanese flounder, Paralichthys olivaceus (JfNLRC5). The coding sequence JfNLRC5 is 5529 bp long and encodes a protein of 1842 deduced amino acid residues. JfNLRC5 transcripts were highly detected in gills, intestine and spleen of healthy fish. In Japanese flounder stimulated with poly (I:C), JfNLRC5 was significantly up-regulated after 24 h at 15 C and after 3 h at 25 C. Expression of JfNLRC5 was up-regulated by formalin-killed Edwardsiella tarda but not by formalin-killed Streptococcus iniae. These findings suggest that JfNLRC5 is involved in fish immune response against viral and Gram-negative bacterial infections. © 2016 Published by Elsevier Ltd.
Keywords: Japanese flounder NLRC5 Poly (I:C) Edwardsiella tarda Streptococcus iniae
1. Introduction The innate immune system is the first line of host defense against invading pathogens. Pathogen recognition receptors (PRRs) recognize conserved molecules associated with pathogenassociated molecular patterns (PAMPs), such as lipopolysaccharides, peptidoglycans and nucleic acids (Kumar et al., 2011). There are several types of PRRs. These include Toll-like receptors (TLRs), C-type lectin receptors (CLRs), retinoic acid inducible gene I (RIG-I)like receptors (RLRs) and the nucleotide binding oligomerization domain (NOD)-like receptors (NLRs). NLRs are intracellular microbial recognition molecules (Geddes et al., 2009) that have a role in bacterial recognition in the cytoplasm (Kumar et al., 2011). NLRs commonly contain three distinct functional domains: an N-terminal effector-binding domain (PYRIN, caspase recruitment domain (CARD) and baculovirus inhibitior of apoptosis protein repeat (BIR) domain); a centrally nucleotide binding domain termed NOD domain (also referred to as NACHT domain), and a carboxy-terminal leucine-rich repeat (LRR) domain. Mammalian NLRs are classified into five subfamilies (NLRA,
NLRB, NLRC, NLRP and NLRX) based on their N-terminal domain organization (Geddes et al., 2009). NLRAs contain an acidic transactivation domain (CIITA), NLRBs contain a BIR domain, NLRCs contain a CARD, NLRPs contain a PYRIN domain, and NLRXs contain an unknown domain (Kawai and Akira, 2009). A mammalian NLRC (NLRC5) has been shown to have roles antiviral immune responses, regulation of MHC class I gene and inflammatory pathways (Benko et al., 2010; Cui et al., 2010; Kuenzel et al., 2010; Meissner et al., 2010; Neerincx et al., 2010), indicating that it has a role in regulating the immune system. NLRC5 genes have been identified in channel catfish (Ictalurus punctatus) and zebrafish (Danio rerio) (Laing et al., 2008; Rajendran et al., 2012), but their roles are unclear. We recently found that Japanese flounder NLRC5-like gene was differentially expressed between 15 C and 25 C after poly (I:C) treatment (Thanasaksiri et al., 2015). Hence, we cloned the coding sequences of NLRC5 from Japanese flounder (JfNLRC5) and analyzed its mRNA expression in various tissues of healthy fish, and fish injected with poly (I:C), and formalin-killed Edwardsiella tarda and Streptococcus iniae cells.
* Corresponding author. E-mail address: [email protected] (H. Kondo). http://dx.doi.org/10.1016/j.dci.2016.08.017 0145-305X/© 2016 Published by Elsevier Ltd.
Please cite this article in press as: Thanasaksiri, K., et al., Molecular cloning and expression analysis of NOD-like receptor 5 in Japanese flounder (Paralichthys olivaceus) after injection with two different formalin-killed pathogenic bacteria and poly (I:C), Developmental and Comparative Immunology (2016), http://dx.doi.org/10.1016/j.dci.2016.08.017
2
K. Thanasaksiri et al. / Developmental and Comparative Immunology xxx (2016) 1e4
Japanese flounder with an average size of 5.8 g were maintained at 22 C and fed daily with commercial pellets. Fish were held for a week to prior to the start of the experiment.
were used as queries for BLAST searches of GenBank (http://www. ncbi.nlm.nih.gov/BLAST). Protein domains were analyzed using the Simple Modular Architecture Research Tool (SMART) program (http://smart.embl.de/) and INTERPRO (IPR) domain classifications (http://www.ebi.ac.uk/interpro/) (Letunic et al., 2009). Phylogenetic trees were constructed based on the ClustalX alignments by Mega 6 program (Tamura et al., 2013).
2.2. Cloning the JfNLRC5
2.4. Expression patterns
A set of primers (Table 1) was designed from EST sequences of a Japanese flounder leucocyte cDNA library obtained from the NGS result of Japanese flounder (Taechavasonyoo et al., 2013) and coding sequences of JfNLRC5 were identified with a SMART™ RACE cDNA Amplification Kit (Clontech, USA) according to the manufacturer's instructions. The obtained sequences were analyzed using bioinformatics tools as described below.
Eight tissues (brain, gills, intestine, kidney, liver, muscle, skin and spleen) were collected from each of six healthy fish. RNA extraction, cDNA synthesis and qPCR analysis were performed as described previously (Thanasaksiri et al., 2015). The primers used for qPCR are shown in Table 1.
2.3. Sequence analysis
The selection of samples of poly (I:C)-treated fish was described previously (Thanasaksiri et al., 2015). Briefly, spleen was collected from poly (I:C)- or DEPC water-treated fish reared at 15 C and 25 C, and RNA extraction and cDNA synthesis were performed. The same set of 4 cDNA samples from 4 individual fish were used in this study. The qPCR of gene expression was as described below.
2. Materials and methods 2.1. Fish maintenance
The JfNLRC5 nucleotide and deduced amino acid sequences
Table 1 Primers used in this study. Gene
Primer
Sequence (50 e30 )
Application
NLRC5
NLRC5-F1 NLRC5-F2 NLRC5-F3 NLRC5-R1 NLRC5-R2 NLRC5-R3 NLRC5-qF NLRC5-qR
CGGCATCGGAATGGA GCAGATTGCCGCAACTTC CAAGCTACAAGTTTTCAGTGCCT ATCCGTGGGCGTTTGAT CAGCAAAGCCTCTGAGAGCTTCTCA TTAGGTGGAAGAGAAATT GAACCTTGTCAGCGACGAATCAG CCTTGATGTGTGTCAGCGATGGTAG
30 RACE 30 RACE 30 RACE 50 RACE 50 RACE 50 RACE qPCR qPCR
Japanese flounder (LC158841) Channel catfish (NP_001186995.1) Large yellow croaker (KKF09127.1) Pig (AGG68119.1) Chicken (AEY11256.1) Mouse (ACP40992.1) Human (NP_115582.4)
2.5. Poly (I:C) injection
2.6. Formalin-killed E. tarda and S. iniae cells treatments E. tarda strain 54 and S. iniae strain ATCC29178 were cultured in heart infusion medium at 25 C for 24 h. The bacteria were killed by adding 2% final concentration of formalin and were incubated at 4 C overnight on a rotary shaker. The formalin-killed cells (FKC) were washed three times with phosphate buffer saline (PBS) and were suspended in PBS. Fish were intraperitoneally injected with
NACHT
NACHT
NACHT
NACHT
NACHT
NACHT
NACHT
200 aa Fig. 1. Schematic diagrams of domain organization in NLRC5 proteins in Japanese flounder and other vertebrates. The NACHT domains and LRRs domains are indicated based on domain prediction by SMART and INTERPRO programs. LRRs are indicated by rectangular boxes.
Please cite this article in press as: Thanasaksiri, K., et al., Molecular cloning and expression analysis of NOD-like receptor 5 in Japanese flounder (Paralichthys olivaceus) after injection with two different formalin-killed pathogenic bacteria and poly (I:C), Developmental and Comparative Immunology (2016), http://dx.doi.org/10.1016/j.dci.2016.08.017
Relative mRNA expression (log2)
K. Thanasaksiri et al. / Developmental and Comparative Immunology xxx (2016) 1e4
12 10 8 6 4 2 0 -2 -4
a
a
c
3
a
ab
bc
c
d
Brain
Gills Intestine Kidney
Liver
Muscle
Skin
Spleen
Fig. 2. JfNLRC5 mRNA expression in healthy Japanese flounder tissues. The relative expression level of JfNLRC5 gene in different tissues was normalized with tissue where the expression level of JfNLRC5 gene was the lowest. Different letters represent statistical significance by one-way ANOVA (p < 0.05).
Fig. 3. mRNA expression of JfNLRC5 in spleen of poly (I:C)-treated Japanese flounder. One-way ANOVA was used for statistical analysis in each temperature. Different letters represent statistical significance by one-way ANOVA (p < 0.05).
FKC of E. tarda at 2.3 108 cells per fish or FKC of S. iniae at 1.9 108 cells per fish. Five individuals were sampled at 0 (prior to injection), 3, 6, 12, 24 and 72 h post injection (hpi). Spleen tissue was collected and analysis of JfNLRC5 gene expression was performed by qPCR using cDNA samples as described below.
significance at p < 0.05 was calculated by one-way analysis of variance (one-way ANOVA).
3. Results and discussion 3.1. Identification of JfNLRC5
2.7. qPCR and statistical analyses qPCR was carried out using Thunderbird SYBR qPCR mix (Toyobo, Japan) and relative mRNA expression was determined by 2DDCt method using EF-1a as the internal reference. Statistical analysis was performed using SPSS version 17.0. The statistical
The cDNA of JfNLRC5 is 5529 bp long with 1842 amino acid residues (Supplementary Fig. 1). Conserved domain prediction of JfNLRC5 by SMART and INTERPRO programs revealed that JfNLRC5 consisted of a NACHT domain at middle (219e359 aa) and 12 Cterminal LRR domains (at 761e785, 789e813, 1015e1,042,
Fig. 4. Expression of JfNLRC5 gene in spleen of FKC of E. tarda- or S. iniae-treated Japanese flounder. Student's t-test was used for statistical analysis. Asterisks indicate significant differences between normal fish (0 h) and FKC of E. tarda- or S. iniae-treated Japanese flounder at each time point (3, 6, 12, 24 and 72 hpi) (p < 0.05).
Please cite this article in press as: Thanasaksiri, K., et al., Molecular cloning and expression analysis of NOD-like receptor 5 in Japanese flounder (Paralichthys olivaceus) after injection with two different formalin-killed pathogenic bacteria and poly (I:C), Developmental and Comparative Immunology (2016), http://dx.doi.org/10.1016/j.dci.2016.08.017
4
K. Thanasaksiri et al. / Developmental and Comparative Immunology xxx (2016) 1e4
1043e1,070, 1127e1,151, 1233e1,257, 1446e1,470, 1527e1,554, 1643e1,670, 1671e1,698, 1699e1726 and 1781e1805 aa) (http:// www.sciencedirect.com/science/article/pii/S1050464812000708 Fig. 1). NLRC5s have been identified in mammals, including human (Kuenzel et al., 2010) and mouse (Ji and Wang, 2012), and in fish, including channel catfish (Yao et al., 2015) and large yellow croaker (Larimichthys crocea) (Ao et al., 2015). All NLRC5s contain a NACHT and a variable number of LRR domains. Channel catfish and large yellow croaker have 13 and 10 LRRs, respectively (Fig. 1). 3.2. Tissue distribution of JfNLRC5 expression Transcripts of JfNLRC5 were detected in all tissues examined, with significant expression in gills, intestine and spleen but low expression in liver (Fig. 2). These results are consistent with those of previous studies in channel catfish and miiuy croaker (Miichthys miiuy), which showed that NLRC5 transcripts were clearly detected in intestine, blood and gills but were weakly detected in liver and muscle (Li et al., 2012, 2015; Sha et al., 2009). In human and mouse, NLRC5 transcripts were strongly detected in spleen, thymus, and lung (Benko et al., 2010; Cui et al., 2010). Together, these observations suggest that NLRC5s are involved in the immune response and might have a specific role at mucosal surfaces. 3.3. Expression analysis of JfNLRC5 Poly (I:C) treatment significantly increased JfNLRC5 transcript levels in spleen at 24 hpi at 15 C and at 3 hpi at 25 C (Fig. 3). This result was consistent with our previous report on the gene expression profiling of Japanese flounder modulated by temperature using a microarray (Thanasaksiri et al., 2015). Poly (I:C) also up-regulated NLRC5 mRNA expression in mouse at 4 h after stimulation (Tong et al., 2012). In miiuy croaker, the significant upregulation of NLRC5 was observed in spleen at 6 and 24 hpi (Li et al., 2015). Together, these findings suggest that JfNLRC5 is involved in the antiviral immune response. Formalin-killed E. tarda significantly induced the expression of JfNLRC5 in spleen at 12 hpi, while formalin-killed S. iniae had no effect (Fig. 4). The effects of E. tarda injection on gene expression in Japanese flounder are different from those of S. iniae injection (Dumrongphol et al., 2009; Kondo et al., 2014). Formalin-killed E. tarda up-regulated Japanese flounder NLRC5-like gene expression in kidney at 12 hpi but formalin-killed S. iniae had no effect (Kondo et al., 2014). Vibrio anguillarum, a Gram negative bacteria, also up-regulated NLRC5 mRNA expression in kidney of miiuy croaker at 12 hpi (Li et al., 2015). It is unclear why JfNLRC5 clearly responds to E. tarda but not to S. iniae. One possibility is that different cell wall components between Gram-negative bacteria (E. tarda) and Gram-positive bacteria (S. iniae) might be involved in the stimulation of JfNLRC5 expression through distinct signaling pathways. In conclusion, we identified the NLRC5 gene in Japanese flounder. The deduced amino acid sequences shared similar characteristics with other known NLRC5 genes. JfNLRC5 transcripts were constitutively expressed in tissues involved in immunity and were up-regulated by PAMPs stimulation, indicating that JfNLRC5 is involved in antiviral and bacterial responses. Acknowledgements This work was supported in part by grants from JSPS Grant-inAid for Young Scientists (B), JSPS Asian Core University Program, and a Japanese Government (Monbukagakusho: MEXT) Scholarship.
Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.dci.2016.08.017.
References Ao, J., Mu, Y., Xiang, L.X., Fan, D., Feng, M., Zhang, S., Shi, Q., Zhu, L.Y., Li, T., Ding, Y., Nie, L., Li, Q., Dong, W.R., Jiang, L., Sun, B., Zhang, X., Li, M., Zhang, H.Q., Xie, S., Zhu, Y., Jiang, X., Wang, X., Mu, P., Chen, W., Yue, Z., Wang, Z., Wang, J., Shao, J.Z., Chen, X., 2015. Genome sequencing of the perciform fish Larimichthys crocea provides insights into molecular and genetic mechanisms of stress adaptation. PLoS Genet. 11, e1005118. Benko, S., Magalhaes, J.G., Philpott, D.J., Girardin, S.E., 2010. NLRC5 limits the activation of inflammatory pathways. J. Immunol. 185, 1681e1691. Cui, J., Zhu, L., Xia, X., Wang, H.Y., Legras, X., Hong, J., Ji, J., Shen, P., Zheng, S., Chen, Z.J., Wang, R.F., 2010. NLRC5 negatively regulates the NF-kappaB and type I interferon signaling pathways. Cell 141, 483e496. Dumrongphol, Y., Hirota, T., Kondo, H., Aoki, T., Hirono, I., 2009. Identification of novel genes in Japanese flounder (Paralichthys olivaceus) head kidney upregulated after vaccination with Streptococcus iniae formalin-killed cells. Fish. Shellfish Immunol. 26, 197e200. Geddes, K., Magalhaes, J.G., Girardin, S.E., 2009. Unleashing the therapeutic potential of NOD-like receptors. Nat. Rev. Drug. Discov. 8, 465e479. Ji, J., Wang, R., 2012. Molecular cloning of large alternative transcripts based on comparative phylogenetic analysis and exploration of an EST database. Anal. Biochem. 424, 140e141. Kawai, T., Akira, S., 2009. The roles of TLRs, RLRs and NLRs in pathogen recognition. Int. Immunol. 21, 317e337. Kondo, H., Kawana, Y., Suzuki, Y., Hirono, I., 2014. Comprehensive gene expression profiling in Japanese flounder kidney after injection with two different formalin-killed pathogenic bacteria. Fish. Shellfish Immunol. 41, 437e440. €sler, R., Lipinski, S., Jung, S., Gro € tzinger, J., Kuenzel, S., Till, A., Winkler, M., Ha Fickenscher, H., Schreiber, S., Rosenstiel, P., 2010. The nucleotide-binding oligomerization domain-like receptor nlrc5 is involved in ifn-dependent antiviral immune responses. J. Immunol. 184, 1990e2000. Kumar, H., Kawai, T., Akira, S., 2011. Pathogen recognition by the innate immune system. Int. Rev. Immunol. 30, 16e34. Laing, K.J., Purcell, M.K., Winton, J.R., Hansen, J.D., 2008. A genomic view of the NOD-like receptor family in teleost fish: identification of a novel NLR subfamily in zebrafish. BMC Evol. Biol. 8, 42. Letunic, I., Doerks, T., Bork, P., 2009. SMART 6: recent updates and new developments. Nucleic Acids Res. 37, D229eD232. Li, J., Kong, L., Gao, Y., Wu, C., Xu, T., 2015. Characterization of NLR-A subfamily members in miiuy croaker and comparative genomics revealed NLRX1 underwent duplication and lose in actinopterygii. Fish. Shellfish Immunol. 47, 397e406. Li, M., Wang, Q.L., Lu, Y., Chen, S.L., Li, Q., Sha, Z.X., 2012. Expression profiles of NODs in channel catfish (Ictalurus punctatus) after infection with Edwardsiella tarda, Aeromonas hydrophila, Streptococcus iniae and channel catfish hemorrhage reovirus. Fish. Shellfish Immunol. 33, 1033e1041. Meissner, T.B., Li, A., Biswas, A., Lee, K.H., Liu, Y.J., Bayir, E., Iliopoulos, D., van den Elsen, P.J., Kobayashi, K.S., 2010. NLR family member NLRC5 is a transcriptional regulator of MHC class I genes. Proc. Natl. Acad. Sci. 107, 13794e13799. Neerincx, A., Lautz, K., Menning, M., Kremmer, E., Zigrino, P., Hosel, M., Buning, H., Schwarzenbacher, R., Kufer, T.A., 2010. A role for the human nucleotide-binding domain, leucine-rich repeat-containing family member NLRC5 in antiviral responses. J. Biol. Chem. 285, 26223e26232. Rajendran, K.V., Zhang, J., Liu, S., Kucuktas, H., Wang, X., Liu, H., Sha, Z., Terhune, J., Peatman, E., Liu, Z., 2012. Pathogen recognition receptors in channel catfish: I. Identification, phylogeny and expression of NOD-like receptors. Dev. Comp. Immunol. 37, 77e86. Sha, Z., Abernathy, J.W., Wang, S., Li, P., Kucuktas, H., Liu, H., Peatman, E., Liu, Z., 2009. NOD-like subfamily of the nucleotide-binding domain and leucine-rich repeat containing family receptors and their expression in channel catfish. Dev. Comp. Immunol. 33, 991e999. Taechavasonyoo, A., Kondo, H., Nozaki, R., Suzuki, Y., Hirono, I., 2013. Identification of novel interleukin 1 beta family genes in Japanese flounder Paralichthys olivaceus. Fish. Shellfish Immunol. 34, 393e396. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725e2729. Thanasaksiri, K., Hirono, I., Kondo, H., 2015. Temperature-dependent regulation of gene expression in poly (I: C)-treated Japanese flounder, Paralichthys olivaceus. Fish. Shellfish Immunol. 45, 835e840. Tong, Y., Cui, J., Li, Q., Zou, J., Wang, H.Y., Wang, R.F., 2012. Enhanced TLR-induced NF-kappaB signaling and type I interferon responses in NLRC5 deficient mice. Cell Res. 22, 822e835. Yao, J., Mu, W., Liu, S., Zhang, J., Wen, H., Liu, Z., 2015. Identification, phylogeny and expression analysis of suppressors of cytokine signaling in channel catfish. Mol. Immunol. 64, 276e284.
Please cite this article in press as: Thanasaksiri, K., et al., Molecular cloning and expression analysis of NOD-like receptor 5 in Japanese flounder (Paralichthys olivaceus) after injection with two different formalin-killed pathogenic bacteria and poly (I:C), Developmental and Comparative Immunology (2016), http://dx.doi.org/10.1016/j.dci.2016.08.017